Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

הגדרת מצע ספציפי עבור מועמדי lipase ו פוספוליפאז

doi: 10.3791/54613 Published: November 23, 2016

Abstract

מיקרואורגניזמים לייצר קשת רחבה של (phospho) lipases כי מופרשים על מנת להפוך מצעים חיצוניים זמינים עבור האורגניזם. לחלופין, אחרים (phospho) lipases עשויה להיות קשורה פיזי עם האורגניזם הפקת גרימת מחזור של שומנים מהותיים ולעתים קרובות והוליד שיפוץ של קרום התא. למרות lipases פוטנציאל (phospho) ניתן לחזות עם מספר אלגוריתמים כאשר רצף הגן / חלבון זמין, הוכחה ניסיונית של פעילויות האנזים, ספציפיות המצע, תפקודים פיזיולוגיים פוטנציאל שתואר פעמים רבות לא ניתנה. כתב יד זה מתאר את אופטימיזציה של תנאי assay עבור פוטנציאליים (phospho) lipases עם ספציפיות מצע ידוע ואיך להעסיק בתנאים אופטימיזציה אלה בחיפוש אחר המצע הטבעי של lipase בהתאמה (phospho). באמצעות מצעים chromogenic מלאכותיים, כגון נגזרות -nitrophenyl p, עשוי לסייע לזהות קטיןהפעילות האנזימטית עבור lipase חזה (phospho) בתנאים סטנדרטיים. שנפגש כזה פעילות האנזימטית קטין, הפרמטרים הברורים של assay אנזים יכולים להיות מגוונים על מנת להשיג הידרוליזה יעיל יותר של המצע המלאכותי. לאחר משקבע את התנאים שבם אנזים עובד היטב, מגוון מצעים טבעיים פוטנציאליים צריך להיות assayed השפלה שלהם, תהליך שיכול להיות מלווה בשיטות chromatographic ברורות. ההגדרה ספציפית מצע אנזימים חדשים, לעתים קרובות מספקת השערות עבור תפקיד פיסיולוגי פוטנציאל של אנזימים אלה, אשר לאחר מכן ניתן לבדוק באופן ניסויי. בעקבות הנחיות אלו, הצלחנו לזהות C פוספוליפאז (SMc00171) כי מדרדרת phosphatidylcholine כדי phosphocholine ו diacylglycerol, בצעד מכריע על עיצובו מחדש של ממברנות בתוך meliloti חיידק Sinorhizobium בתנאים מגבילים-זרחן של צמיחה. במשך שני ניבאו patatin-כמו phospholipases (SMc00930 ו SMc01003) מאותו אורגניזם, נוכל להגדיר מחדש ספציפיות המצע שלהם ולהבהיר כי SMc01003 הוא lipase diacylglycerol.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

גליצרול מבוסס שומנים כגון triacylglycerols ו (glycero) פוספוליפידים מהווים חשובים וכנראה מעמדות השומנים הידועות ביותר -1. Triacylglycerols (תגיות) הם שומנים או שמנים, אשר בדרך כלל לתפקד כמו שומני אחסון, ולכן כמקורות אנרגיה ופחמן פוטנציאליים. תגיות יכולות להיות מושפלות על ידי lipases, אשר מופרשים לעתים קרובות על ידי האורגניזם הפיק לעכל תגיות חיצוניות ולהפוך אותם לזמינים כמקורות פחמן. כמו כן, lipases נחקר בהרחבה לאורך השנים בשל היישומים ביוטכנולוגיים החשובים שלהם 2.

בשל אופייה amphiphilic שלהם וצורה כמעט cylindric שלהם, (glycero) התערוכה פוספוליפידים נכסים מייצרי קרום מהווים בדרך כלל את הרכיבים lipidic העיקריים של קרום bilayered 3. בשנת מיקרואורגניזמים פשוטים, כגון coli Escherichia החיידק, רק שלוש גרסות קבוצת הראש גדולות, phosphatidylglycerol (PG), cardiolipin (CL), ו phosphatidylethanolamine (PE) הם נתקלו, אף אחד לא צריך להיות מודעים לכך כל אחד מהם ניתן להחליף עם מספר לא מבוטל של רשתות acyl השומן שונות בבית SN -1 או עלייה נותנת מיקום -2 SN למספר רב של מינים מולקולריים שונים 4 . חיידקים אחרים שאולי יש פוספוליפידים אחרים בנוסף או במקום. לדוגמה, Sinorhizobium meliloti, חיידק אדמה, אשר מסוגל ליצור סימביוזה גולה שורש תיקון-חנקן עם אספסת קטניות (Sativa Medicago), מכיל בנוסף PE A (PC) השני zwitterionic פוספוליפידים, phosphatidylcholine 5. כמו כן, שומנים לא המכילים זרחן או גליצרול יכול להיות חלק amphiphilic וצורה של הממברנה התאית. לדוגמה, על תנאי גידול הגבלת זרחן, ב ס meliloti, (glycero) פוספוליפידים מוחלפים בעיקר על ידי שומנים קרום שאינם מכילים זרחן, כלומר, sulfolipids, שומנים ornithine, ו diacylglyceryl trimethylhomoserine (DGTS) -6. אצל חיידקים, DGTS נוצר מן diacylglycerol (DAG) בתוך מסלול דו-שלבי 7 אבל המקור עבור הדור DAG לא היה ברור. ניסויים Pulse-מרדף הציע PC עשוי להיות סימן מקדים עבור 8 DGTS ושימוש המתודולוגיה המתוארת בכתב היד הזה נוכל לזהות C פוספוליפאז (PlcP, SMc00171) כי נוצר בתנאים מגבילים-זרחן אשר יכול להמיר המחשב לתוך דאג phosphocholine 8.

במחקר נפרד, גילינו כי synthetase acyl-CoA (FadD) מוטציה -deficient של ס meliloti או של Escherichia coli שנצבר חומצות שומן חופשיות כאשר נכנס לשלב נייח הצמיחה 9. למרות חומצות שומן אלה נראות להיגזר ליפידים קרום, את המקור המדויק של חומצות שומן חופשיות או האנזים (ים) משחרר אותם לא היו ידוע. שוב, העסקת האסטרטגיה שמתווה בכתב היד הזה, שתי 10 patatin הדמוי (phospho) lipases (SMc00930 ואת SMc01003) שתרם להיווצרות של חומצות שומן חופשיות ב ס meliloti 11 נחזה. באופן מפתיע, SMc01003 בשימוש DAG כמו המצע להפוך אותו monoacylglycerol ולבסוף גליצרול וחומצות שומן חופשיות 11. לכן SMc01003 הוא lipase DAG (DglA).

למרות מספר אלגוריתמים קיימים לניבוי פוטנציאל (phospho) lipases 12,13, תפקידו המדויק שלהם תפקיד פיזיולוגי הוא בדרך כלל לא ידוע. כאן אנו מתארים פרוטוקול, לשבט overexpress חזה או פוטנציאל (phospho) lipases. כתב יד זה מסביר כיצד מבחני אנזים ניתן לפתח והותאמו במיוחד lipase (phospho) overexpressed באמצעות מצעי chromogenic מלאכותיים. אנו מספקים דוגמאות כיצד עם assay האנזים אופטימיזציה המצע (phospho) lipase אמיתי ניתן נתקל ואיך ממצאים אלו יכולים להיות להעשיר את הבנתנו בפיזיולוגיה של חיידקים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Clone 1. overexpress מבנית ג'ין עבור חזוי lipase

  1. באמצעות תגובת שרשרת של פולימראז (PCR) 14 ו oligonucleotides הספציפי (טבלה 1) 15, להגביר את הגן של עניין (smc01003, smc00930, או smc00171), חזה קוד עבור lipase או פוספוליפאז, מן הדנ"א הגנומי של האורגניזם המארח (כלומר , ס meliloti).
    1. להציג אתרי הגבלה ספציפיים (עם הרצף המתוכנן של oligonucleotides). לעכל את קטע DNA המוגבר עם אנזימי הגבלה המקביל ולשכפל אותו לתוך וקטור ביטוי כגון פלסמידים של סדרת PET 16.
    2. לאחר וידוי רצף ה- DNA הנכון עבור גנים משובטים, להפוך את וקטור זן ביטוי כגון BL21 Escherichia coli (DE3) pLysS 16.
  2. כן-תרבות מראש לילה של מארח הביטוי E. coli BL21 (DE3) PLysS, מחסה וקטור PET בהתאמה עם הגן המשובט או הווקטור הריק, ב 100 מ"ל צלוחיות תרבות המכילות 20 מיליליטר של מרק לוריא Bertani (LB) 17 בתוספת האנטיביוטיקה הנדרשת. התרבות התאים על 30 מעלות צלזיוס (או בטמפרטורה הצמיחה הרגיל של החיידק שממנו lipase מקורו).
    1. שימוש-תרבויות קדם לילה, לחסן 500 מ"ל של מדיום LB prewarmed (בתוספת אנטיביוטיקה חובה) צלוחיות תרבות 2 L להשיג צפיפות אופטית הראשונית ב 620 ננומטר (OD 620) 0.05 =. עקוב צמיחה של תרבויות ותמורת OD 620 = 0.3, להוסיף איזופרופיל- β-D-thiogalactoside (IPTG) לריכוז סופי של 100 מיקרומטר, דגירה תחת תסיסה על 30 מעלות צלזיוס למשך תקופה של 4 שעות.
    2. בסוף תקופת הדגירה, להעביר כל תרבות לצינור צנטריפוגות 500 מ"ל ו צנטריפוגות ב 5000 XG ב 4 מעלות צלזיוס למשך 30 דקות. Resuspend כדורי תא החיידק ב 5 מ"ל של חיץ ההשעיה (למשל, SMc00930- ואת SMc01003 לבטא בתאי ב 50 mM Tris-HCl pH 8.0 ו SMc00171 לבטא בתאי ב 50 מ"מ-Diethanolamine HCl pH 9.8). אחסן את המתלים תא ב -80 ° C עד השימוש.

2. כן תמציות חלבון ללא סלולריים לקבוע ריכוז חלבון

  1. הפשר השעיות תא חיידק ולאחסן על קרח. Pass השעיות תא שלוש פעמים באמצעות תא לחץ קר ב -20,000 ליברות לכל ב 2. הסר תאים שלמים ופסולת התא על ידי צנטריפוגה ב 5000 XG במשך 30 דקות ב 4 ° C.
  2. לאחר צנטריפוגה, להכין aliquots של 100 ו 500 μl מן supernatant לניתוח שלאחר מכן ולאחסן אותם ב -80 ° C עד השימוש.
  3. השתמש באחת aliquot 100 μl כדי לקבוע ריכוז חלבון של תמציות תא ללא מובחנת על ידי שיטת הבחירה או כמתואר 18.

3. מצעים מלאכותיים השתמש עבור אנזים אופטימיזציהפעילויות של (phospho) lipases

  1. לקבלת כיסוי ראשוני של פעילויות אנזים ברורות, להשתמש מצעים מלאכותיים להניב מוצר בצבע על הידרוליזה, כגון p -nitrophenol (-NP p).
    1. עבור מבחני אנזים מותאמים כבר עם מצעי אסתר -nitrophenyl הנדסאית (מזדקרים על פוספוליפאז C PlcP (SMc00171), כמו גם עבור phospholipases patatin דמוי חזה SMc00930 ו SMc01003), תוכניות pipetting שימוש מתוארות בטבלה 2.
    2. במהלך סיור lipase פוטנציאליים חדשים (phospho), להכין assay האנזים תחילה רגיל המכיל 50 mM Tris-HCl, pH 8.5, 100 מ"מ NaCl, 0.05% Triton X-100, 0.5 מ"מ p -nitrophenyl המכילים תרכובת (פוספט -nitrophenyl p , פוספט p -nitrophenyl בשדרה, decanoate p -nitrophenyl, או palmitate p -nitrophenyl), ותמצית חלבון ללא תאים (לבדוק 1, 3, 10, 30, 100, 300, ו -1,000 מיקרוגרם) בהיקף כולל של 1 מ"ל ב 1 מ"ל cuve פלסטיקttes.
      הערה: pH בסיסי השתמש (איור 1) כאשר בעקבות הידרוליזה אסתר p -nitrophenyl ב assay רציפה. לחלופין, להשתמש מבחני זמן-נקודה אחת עבור מגוון של ערכי ה- pH, הוספת NaOH בסוף תקופת הדגירה כדי לסיים את התגובה אנזים ועל מנת להבטיח כי כל -NP p הוא להציג בצורה phenolate.
    3. בצע את מהלך הזמן עבור גידול של ספיגה ב 405 ננומטר, עקב ההיווצרות של -NP p, ספקטרופוטומטר על 30 מעלות צלזיוס במשך 5 דקות. לכמת את למבנה הישר בהתחלה של p -NP ידי קביעת המדרון הראשוני של גידול של ספיגה לכל זמן.
    4. חשב את השינוי של ריכוז (Δc) עבור -NP p באמצעות חוק למברט-באר (ΔA = ε Δc ד) 1.
      הערה: ΔA הוא שינוי לינארי של ספיגת נקבע, ε הוא מקדם הכחדה טוחנת על אורך גל, בהתאמה (ביחידות של M -1 -1 ס"מ), d הוא אורכו של נתיב האור (1 ס"מ), ו Δc הוא השינוי של ריכוז (ביחידות של M) שייקבע.
      1. בהתחשב בכך נפח assay הוא 1 מ"ל, לחשב את כמות p -NP נוצר.
        הערה: סכום = ריכוז נפח x.
      2. חשב את פעילות האנזים על ידי חלוקת סכום p -NP נוצר על ידי הזמן שבו הוא נוצר. קבע את פעילות אנזים מסוים על ידי חלוקת פעילות האנזים על ידי כמות חלבון (במ"ג) שהייתה אחראית על יצירת פעילות זו.
    5. השווה את השינויים ספיגים שעוררו תמציות חלבון בו גן מועמד (smc00171, smc00930, או smc01003) כבר הובע עם תמציות כי הנמל רק וקטור ריק.
      הערה: על מנת להמשיך בביצוע השלבים הבאים, הפעילויות הספציפיות, הנגרמות על ידי תמציות חלבון בו גן מועמד כבר הובע, צריכות להיות לפחות פעמים או מ 'בצר מ הערכים שהתקבלו עבור פעילויות ספציפיות הנובעות מכך תמציות חלבון כי הנמל רק וקטור ריק.
    6. עבור ניסויים נוספים, לבחור תנאים בם הידרוליזה של המתחם p -nitrophenyl המכיל הוא מינימאלי עם תמציות תא חינם (כלומר, וקטור ריק) ואשר ההיווצרות הבולטת של -NP p ואת אניון p -nitrophenolate (איור 1) ניתן להבחין כאשר תמציות חלבון מועסקים, בו גן מועמד כבר הובע.
  2. לאחר קביעת פעילות אנזים הראשונית 3.1, לייעל את התנאים assay עבור האנזים בהתאמה על ידי שינוי pH, סוג של חיץ, חיץ כוח, ריכוזים של NaCl, דטרגנטים כגון טריטון X-100, והעדר או נוכחות של קטיונים דו ערכי שונה.
    1. עבור ריכוזים שונים של כל משתנה, קבע את פעילות אנזים מסוים (ראה 3.1.4.2) (המספר הגבוה ביותר שהושג מגדיר את התנאיפעילות האנזים מקסימלי). השתמש שילוב של התנאים האופטימליים נתקלו לכל משתנה להגדיר assay אנזים אופטימיזציה שבו כל משתנה הוא מצוי בריכוז האופטימלי שלה.

איור 1
איור 1. אסטרים -Nitrophenyl p כמו מצעים מלאכותיים (phospho) lipases ב assay spectrophotometric. לאחר הידרוליזה של אסטרים p -nitrophenyl, חומצת (R-OH) ו- p -nitrophenol (-NP p) נוצרות. בשל א PK = 7.2 עבור ניתוק של + פנוליות H מ- p -NP, ב- pH> 9.2 יותר מ -99% הם בצורת p -nitrophenolate צהוב בהיר מקדם הכחדה טוחנת של 18,000 M -1 ס"מ - 1 ניתן להשתמש בכל אורך גל של 405 ננומטר עבור כימות של -nitrophenolate p חינם 22. כאשר מאגרים עם pH של 8.5 שימשו, ספיגת נקבע ב 400 ננומטר ו מקדם הכחדה טוחנת של 14,500 M -1 cm -1 הועסק 23. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

הערה: לאחר לאחר שהגדיר את התנאים האופטימליים עבור הפעילות של האנזים של עניין, לצאת בחיפוש אחר המצע האמיתי / פיסיולוגי של lipase זה. באופן עקרוני, לקחת שני, לעתים קרובות משלימים, גישות להשגת מטרה זו, גישה vivo או בגישה חוץ גופית.

4. זיהוי Vivo של המצע הפיזיולוגי של lipase

ove_content "> הערה:. בגישת in vivo, לבטא את lipase של עניין פונדקאי 8,11 כדי לרשום לאורך זמן אם ביטוי של lipase משנה את פרופיל שומני host's בעוד גישת in vivo, ליצור מוטציה הלקויה של הגן של עניין 8,11 וללמוד אם פרופיל השומנים שלה נבדל מגרסת סוג בר 6,8,11. על מנת לקבל הערכה כמותית של פרופיל השומנים של האורגניזם, שיטה פשוטה מורכבת radiolabeling תרכובות הסלולר , חילוץ שומנים, תוך הפרדתם ידי כרומטוגרפיה, וכימות שומנים מופרדים שכותרתו רדיואקטיבית.

  1. Radiolabeling של שומנים.
    1. הכן-תרבות מראש לילה של אורגניזם של עניין (E. coli או ס meliloti) ב 5 מ"ל של מדיום תרבות הרצוי (בינוני מורכב או בינוני מינימלית מוגדרת) ולצמוח בקצב של 30 ° C.
    2. מתוך תרבות מראש, לחסן לתוך 20 מ"ל של saלי בינוני טרי בבקבוק תרבות 100 מ"ל להשיג OD הראשונית 620 = 0.3 עבור התרבות.
    3. קח aliquot (1 מ"ל) של התרבות בתנאים סטריליים ולהעביר לצינור מסביב לתחתית פוליסטירן 14 מ"ל סטרילי.
    4. הוסף 1 μCi של [1- 14 C] אצטט (60 MCI לכל מילימול) לתרבות 1 מ"ל.
    5. דגירת ההתרבות הנוזלת תחת תסיסה על 30 מעלות צלזיוס למשך תקופה של 24 שעות.
    6. בסוף תקופת הדגירה, ולהעביר את התרבות לצינור microcentrifuge 1.5 מ"ל ו צנטריפוגות ב XG 12,000 בטמפרטורת החדר למשך 5 דקות.
    7. Resuspend גלולה ב 100 μl של מים. בשלב זה, לאחסן את ההשעיה תא ב -20 ° C או מיד להמשיך עם החילוץ של שומנים קוטביים (סעיף 4.2).
  2. הפקת שומנים קוטביים.
    הערה: השיטה המתוארת כאן בעצם מלווה את ההליך שדווח על ידי בליי דאייר 19.
    1. אל 100 μl של תליוני תא מימייםension, להוסיף 375 μl של מתנול: פתרון כלורופורם (2: 1; כרך / כרך).
    2. וורטקס למשך 30 שניות ו דגירה במשך 5 דקות בטמפרטורת החדר.
    3. צנטריפוגה 5 דקות ב XG 12,000 בטמפרטורת החדר.
    4. מעבירים את supernatant לצינור microcentrifuge 1.5 מ"ל חדש.
    5. להוסיף 125 μl של כלורופורם 125 μl של מים, מערבולת 30 שניות.
    6. צנטריפוגה 1 דקות ב XG 12,000 בטמפרטורת החדר.
    7. מעביר את שלב כלורופורם התחתון לצינור טרי ויבש עם זרם של גז חנקן.
    8. ממסי שומנים מיובשים 100 μl של כלורופורם: פתרון מתנול (1: 1; כרך / כרך).
      הערה: בשלב זה, aliquot של 5 μl של פתרון השומנים ניתן לכמת ידי ספירת נצנץ נוזלית.
    9. לקבלת chromatographic-שכבה דקה (TLC) ניתוח, לייבש את 95 μl הנותרים עם זרם של גז חנקן redissolve שומנים מיובש 20 μl של כלורופורם: פתרון מתנול (1: 1; כרך / כרך). השתמש aliquot 3 μlלניתוח TLC.
  3. הפרדת שומנים קוטביים ידי כרומטוגרפיה בשכבה דקה (TLC).
    הערה: בהתאם מעמדות השומנים להיות מנותח, שילובים שונים של שלבים מוצקים ניידים עשויים להיות מועסקים על הפרדה. כאן הפרדה אופיינית שומנים קוטביים טעונה אחרת, מתאימים יותר שומני קוטב ניטראליים, באמצעות כרומטוגרפיה בשכבה דקה ביצועים גבוהים (HPTLC) פחי אלומיניום ג'ל סיליקה כשלב המוצק, מתוארות.
    1. הפרדת שומנים קוטבי שגובים דו מימדי TLC (2D-TLC).
      1. למרוח aliquot 3 μl של מדגם השומנים באחת הפינות של גיליון אלומיניום ג'ל סיליקה HPTLC (10 x 10 ס"מ), 2 ס"מ מהקצה של הצלחת.
      2. כן ומערבבים בשלב הנייד (כלורופורם 140 מיליליטר, 60 מיליליטר מתנול, ו -10 מיליליטר מים) להפרדה בממד הראשון.
      3. מעיל בתא בפיתוח TLC פנימי עם נייר כרומטוגרפיה.
        הערה: זו היא להבטיח כי שלב הגז של התאיהיה רוויים במהירות (תוך 30 דקות) לאחר השלב הנייד עבור הממד הראשון נוסף התא והתא נסגר עם צלחת זכוכית.
      4. כן ומערבבים בשלב הנייד (כלורופורם 130 מיליליטר, 50 מיליליטר מתנול, ו -20 מיליליטר קרחוני חומצה אצטית) להפרדה בממד והעברת השני אל חדר בפיתוח שני TLC מצופה פנימי עם נייר כרומטוגרפיה ולתת הרווי הקאמרי.
      5. להעביר בזהירות את סדין ג'ל אלומיניום HPTLC סיליקה עם מדגם שומנים היבש לתא הראשון ולפתח (כלומר, לבצע כרומטוגרפיה) את הצלחת במשך 60 דקות בחדר הסגור בממד הראשון 5.
      6. הסר את הצלחת מן החדר ולתת ממסים להתנגב במנדף זרימה למשך 30 דקות.
      7. לאחר סיבוב צלחת ב -90 מעלות ביחס כרומטוגרפיה הקודמת, להעביר את גיליון אלומיניום ג'ל סיליקה HPTLC, שעליו שומנים שהופרדו במימד אחד, אל SECONתא ד ולפתח את הצלחת במשך 60 דקות בממד השני 5.
      8. הסר את הגיליון מהאולם ולתת ממיסים להתנגב במנדף זרימה במשך שעה לפחות 2.
    2. הפרדת שומנים קוטב נייטרלי.
      1. החל 3 aliquots μl של דגימות השומנים על גיליון אלומיניום ג'ל סיליקה HPTLC החל 2 ס"מ מקצות הצלחת. אם דוגמאות רבות מנותחות בתוך כרומטוגרפיה חד ממדי, לשמור על מרחק של 1.5 סנטימטרים לפחות בין כתמי יישום מדגם השונים.
      2. הכן ומערבבים בשלב ניידים (140 מ"ל הקסאן, 60 מ"ל דיאתיל אתר, ו -8 מ"ל חומצה אצטית) והעברה בתא בפיתוח TLC פנימי מצופה נייר כרומטוגרפיה מכוסה בצלחת זכוכית לתת רווי קאמרית (30 דק ').
      3. מעביר את גיליון אלומיניום סיליקה ג'ל HPTLC עם דגימות שומנים היבשות לתא ולפתח את הצלחת למשך 30 דקות בחדר הסגור.
      4. הסר את הצלחת מן החדרולתת ממיסים להתנגב במנדף זרימה עבור שעה 2.
  4. כימות וויזואליזציה של שומנים קוטביים מופרדים.
    1. לאחר גיליון TLC פתח יבש, דגירה אותו עם הארת photostimulable (PSL) מסך קסטה סגורה במשך 3 ימים.
    2. לחשוף את המסך וטופח על סורק PSL ולרכוש תמונה וירטואלית של שומני radiolabeled המופרדים.
    3. בצע כימות באמצעות PSL תוכנה 20.
  5. ויזואליזציה ובידוד של כיתות שומנים קוטביים פרט.
    1. דגירת גיליון TLC מפותח במשך 10 דקות בתא כרומטוגרפיה בנוכחות 1 גרם של גבישי יוד.
      הערה: תרכובות lipidic פרוד יהיה לפזר את יוד מופיעים כתמים חומים.
    2. הקף את הנקודות בעיפרון, ולהשוות אותם ניידות יחסית (f R) של תרכובות סטנדרטי (כלומר, 1,2-dipalmitoyl- SN -glycerol, dipalmitoyl-L-α-phosphatidylcholine, DL-α-monopalmitin, או חומצה פלמיטית), ולזהות שאליו בכיתת שומנים הוא שייך.
    3. במנדף, לתת יוד להתאדות מגיליון TLC.
    4. בעזרת מרית, לגרד את ג'ל סיליקה המכיל את המתחם של עניין מן הגיליון, ולחלץ את המתחם מן הג'ל סיליקה בתערובת של 100 μl של מים ו 375 μl של מתנול: פתרון כלורופורם (2: 1; כרך / כרך).
    5. המשך עם מיצוי פי בליי דייר כפי שמתואר (4.2.2 ואילך).
    6. חנות בכיתה השומנים מטוהרים 100 μl של כלורופורם: פתרון מתנול (1: 1; כרך / כרך) ב -20 ° C עד השימוש.

5. זיהוי חוץ-גופייה של המצע הפיזיולוגי של lipase

הערה: גישה במבחנה, לחקור האם lipase של עניין ניתן להמיר תערובת של ליפידים מבודד או שומנים טהורים פרט אל hydrol המקבילמוצרים יסיס בתנאים המוגדרים אופטימלי 3.2.

  1. להשתמש בצירופי pipetting עבור מבחני אנזים לפי טבלה 3 עבור פעילות המחשב הספציפי פוספוליפאז C SMc00171 (ראה 5.2), פוספוליפאז A (ראה 5.3), ואת דאג lipase SMc01003 (ראה 5.4).
  2. קביעת פעילות C פוספוליפאז PC ספציפי (לוח 3).
    1. כדי צינור 1.5 מ"ל microcentrifuge, להוסיף 5,000 ספירות לדקה (CPM) בסך הכל 14 PC C שכותרתו ופתרון של טריטון X-100.
    2. מערבבים ויבש תחת זרם של חנקן.
    3. להוסיף Diethanolamine HCl, pH 9.8 חיץ, כמו גם NaCl ו MnCl 2 פתרונות ומים bidistilled להשיג נפח סופי של 99.5 μl. וורטקס למשך 5 שניות.
    4. הוסף 0.5 μl של אנזים (5 מיקרוגרם חלבון) (כלומר, תמצית חינם תאים בהם ביתר SMc00171 קיים) כדי ליזום את התגובה. מערבבים בקצרה.
    5. לדגור על 30 מעלות צלזיוס למשך 4 שעות.
    6. עצור את התגובה על ידיתוספת של 250 μl של מתנול 125 μl של כלורופורם.
    7. חלץ ליפידים כפי שתואר לעיל (ראה 4.2).
    8. שומנים נפרדים על ידי חד-ממדי (1D) -TLC (ראו 4.3.2 ו -4.4), ולנתח אותם על ידי הדמית PSL.
  3. קביעת פעילות פוספוליפאז (לוח 3).
    1. כדי צינור 1.5 מ"ל microcentrifuge, להוסיף 5,000 עותקים לדקה בסך הכל 14 פוספוליפידים C שכותרתו ופתרון של טריטון X-100.
    2. מערבבים ויבש תחת זרם של חנקן.
    3. עבור assay 100 μl הסופי, להוסיף Tris-HCl, חיץ pH 8.5, פתרון NaCl ומים. וורטקס למשך 5 שניות.
    4. הוסף 5 μl של אנזים (50 מיקרוגרם חלבון) (כלומר, תמצית חינם תאים בהם ביתר SMc00930 או SMc01003 קיים).
    5. לדגור על 30 מעלות צלזיוס למשך 5 שעות.
    6. עצור את התגובה על ידי תוספת של 250 μl של מתנול 125 μl של כלורופורם.
    7. חלץ ליפידים כפי שתואר לעיל (ראה 4.2), נפרדאותם על ידי 1D-TLC באמצעות כלורופורם 130 מ"ל, 50 מ"ל מתנול, וחומצה אצטית קרחונית 20 מ"ל כשלב ניידים, ולנתח אותם על ידי הדמיה PSL.
  4. קביעת diacylglycerol (DAG) פעילות lipase.
    1. הכנת 14 C שכותרתו DAG.
      1. Radiolabel ס תרבויות meliloti (ראו 4.1) ולחלץ שומנים קוטביים (ראה 4.2) כמתואר. ס נפרד תמציות שומנים הכוללות meliloti ידי 1D-TLC כלורופורם: מתנול: חומצה אצטית (130: 50: 20; כרך / כרך) באמצעות בתנאים המתוארים להפרדה בממד השני ב 4.3.1.
      2. דמיין PC ידי מכתים יוד להשתמש בעיפרון כדי לסמן את הלוקליזציה של phosphatidylcholine (PC).
      3. לבודד PC radiolabeled כמתואר 4.5.
      4. לכמת PC שחולץ על ידי ספירת נצנץ.
        הערה: על 320,000 PC לדקה צפויה.
      5. פנקו את המחשב (250,000 עותקים לדקה) עם 0.1 U של C פוספוליפאז מ perfringens Clostridium ב 50 mM Tris-HCl, pH 7.2, 0.5טריטון% X-100 לבין 10 מ"מ CaCl 2 עבור שעה 2 בנפח כולל של 100 μl ולעצור את התגובה על ידי הוספת 250 μl של מתנול 125 μl של כלורופורם.
      6. חלץ ליפידים כפי שתואר לעיל ונפרדת על ידם על ידי 1D-TLC (ראה 4.3.2).
      7. לבודד diacylglycerol מצלחת סיליקה ולכמת ידי ספירת נצנץ (כמתואר 4.2)
    2. Assay lipase Diacylglycerol (לוח 3).
      1. כדי צינור 1.5 מ"ל microcentrifuge, להוסיף 5,000 עותקים לדקה של 14 C-שכותרתו DAG ופתרון של טריטון X-100.
      2. מערבבים ויבש תחת זרם של חנקן.
      3. עבור assay 100 μl הסופי, להוסיף Tris-HCl (9.0 pH) חיץ, פתרון NaCl ומים bidistilled. וורטקס למשך 5 שניות.
      4. ליזום את התגובה על ידי הוספת 5 μl של אנזים (50 מיקרוגרם חלבון של תמצית התא ללא).
      5. לדגור על 30 מעלות צלזיוס למשך 4 שעות.
      6. עצור את התגובה על ידי תוספת של 250 μl של מתנולד 125 μl של שומנים כלורופורם לחלץ כפי שתואר לעיל (ראה 4.2).
      7. לנתח שומנים קוטב נייטרלי ידי 1D-TLC (ראה 4.1.3.2) והדמיה PSL שלאחר מכן.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

פעילות של פוספוליפאז PC ספציפי C SMc00171 עם בשדרת p -nitrophenyl פוספט

תמציות תא ללא המתקבל E. BL21 coli (DE3) x pLysS, אשר הביעו smc00171, נחקרו על יכולתם hydrolyze אסטרים פוספט בשדרת p -nitrophenyl, באמצעות assay האנזימטית spectrophotometric, מדידת p -NP נוצר. אין פעילות hydrolytic נכחה תמציות תא ללא המתקבל E. BL21 coli (DE3) x pLysS מחסה וקטור pET9a ריק (מידע לא מוצג) כאשר בשדרת פוספט p -nitrophenyl הועסק המצע.

קורסים זמן עבור p -NP נוצר מצביעים על כך שקיימת תלות חזקה על סכום של תמצית התא חינם (מ BL21 E. coli (DE3) x pLysS, אשר היה SMc00171 הביע) מתווסף assay (איור 2 א). אם כמות המוצר p -NP יצרה יהיה תלוי רק על ריכוז האנזים, קשר לינארי בין אנזים (חלבון) ריכוז מועסקים המוצר שנוצר לאחר פרק זמן מסוים יש לשים לב. ברור, זה לא המקרה של תמציות תא ללא המתקבל E. BL21 coli (DE3) x pLysS, אשר הביע smc00171 (איור 2 ב). למרות שאולי יש כמה סיבות תלות מעריכית של פעילות אנזים על ריכוז חלבון 21, סיבה נפוצה היא שעם דילול של תמצית חלבון אנזים המכיל רכיבים אחרים לחלץ אשר עשויים להיות מגביל פעילות אנזים, כלומר, קו-פקטורים פוטנציאל , הם בדילול גם כן. במקרים כאלה, פעילויות אנזים נמוכות באופן בלתי צפוי רשומות בתמציות תא ללא מדולל. על ידי הוספת ריכוז להרוות של 3 מ"מ MnCl 2 ב assay האנזים, את p המוצר -NP נוצר לאחר פרק זמן מסוים תלוי רק את כמות אנזים הוסיף (מידע לא מוצג) המציין כי MnCl 2 היה מרכיב מגביל פעילות SMc00171 תמציות תא ללא של E. coli.

איור 2
קביעת איור 2. SMc00171 (פוספוליפאז) פעילות באמצעות המצע המלאכותי בשדרת פוספט p -nitrophenyl. קורס הזמן להיווצרות p -NP מוצגת העסקת תמציות חלבונים ללא תאים (● 10 מיקרוגרם / מיליליטר, ■ 15 מיקרוגרם / מיליליטר, ▲ 20 מיקרוגרם / מ"ל) שבו SMc00171 כבר הובע (א). p -NP נוצרו לאחר 40 דקות של דגירה עם כמויות שונות של תמציות חלבונים ללא התא שבו SMc00171 כבר הובע (B). ברי שגיאה מצביעים סטיית התקן..jove.com / קבצים / ftp_upload / 54,613 / 54613fig2large.jpg "target =" _ blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

פעילויות של חזוי Patatin דמוי phospholipases SMc00930 ו SMc01003 עם p -Nitrophenyl acyl אסטרים באורכים שונים שרשרת

לאחר הבעת smc00930 או smc01003 ב E. BL21 coli (DE3) x pLysS, תמציות ללא תא התקבלו ולמדו על יכולתם hydrolyze אסטרים שומן acyl p -nitrophenyl. במהלך assay האנזימטית, את -NP p נוצר נקבע ספקטרופוטומטר. פעילויות hydrolytic מינור נכחו תמציות תא ללא המתקבל E. BL21 coli (DE3) x pLysS עם וקטור pET17b ריק (לוח 4) כאשר אסטרים acyl p -nitrophenyl של differeאורכי שרשרת NT הועסקו כמו מצעים. כאשר smc01003 התבטא, התמציות שהושגו הראו הידרוליזה מוגברת של אסטרים p -nitrophenyl באורכי שרשרת שונים. SMc01003 מושפל decanoate בינוני שרשרת p -nitrophenyl וכן stearate -nitrophenyl palmitate ו- p ארוכי שרשרת p -nitrophenyl (לוח 4). כפי SMc01003 היא תורמת רב להיווצרות של חומצות שומן חופשיות ארוכת שרשרת ב ס meliloti בשלב נייח 11, זה היה מפתיע כי SMc01003 נראה לפעול באותה מידה על-בינונית שרשרת מאשר על אסטרים acyl ארוך שרשרת p -nitrophenyl (לוח 4). באופן בלתי צפוי, SMc01003 גם מעשים על מצעים קצרות שרשרת כמו בוטיראט p -nitrophenyl או p -nitrophenyl octanoate (מידע לא מוצג). עם זאת, מצעים אלה האחרונים מפורקים גם מפעילות נוכח תמציות תא ללא של E. coli (כלומר, מחסה vect ריקאו pET17b) מבלי להביע כל גן נוסף ועם מצעים קצרות שרשרת (C4), מחצית המצע כבר מושפל על ידי א ' אנזימים מהותיים coli (מידע לא מוצג). ברור, SMc01003 צריך להיטהר כדי לברר אם SMc01003 עובד באותה מידה על קצר, בינוני, מצעים ארוכי שרשרת. באופן כללי, אסטרים acyl p -nitrophenyl נראה לא להיות מצעים טובים SMc01003 אשר עשוי להיות מובנים בידיעת SMc01003 הנו למעשה lipase DAG 11. תמציות סלולרי חינם, שבו smc00930 כבר הובע, להראות הרבה פעילויות האנזים גבוה עם אסטרים p -nitrophenyl (לוח 4). כמו כן, SMc00930 הוא מסוגל hydrolyze אסטרים p -nitrophenyl acyl באורכים שרשרת שונים (C10, C12, C14, C16 ו- C18), אם כי palmitate p -nitrophenyl (פעילות ספציפית 5.5 מילימול NP דק '- 1 מ"ג חלבון - 1) הוא בבירור את המצע הטוב ביותר עבור SMc00930. נכון להיום, physioloמצע gical עבור SMc00930 אינו ידוע.

היכרות עם ליפידים פולאר אם יכול לתפקד כמו מצעים עבור חזוי (phospho) lipases

פעם assay האנזימטית (phospho) lipase בצורה מיטבית עם מצעים מלאכותיים, תערובות שומנים רדיואקטיבי או שומנים טהורים יכול להיבדק כמו מצעים פוטנציאליים.

כאשר מנסה לאמוד SMc00171 המכיל תמציות ללא תאים עם 14 PC C שכותרתו בתנאים אופטימיזציה, נוכל להראות כי SMc00171 מדרדרת מחשב DAG, מכך כי אושר על ידי מחקרים ספקטרומטריה 8. SMc00171 גם מדרדרת 32 PC P שכותרתו כדי phosphocholine ולכן משמש תנאי PC ספציפי פוספוליפאז C (PlcP) 8, כי הוא המושרה תחת הגבלת זרחן של צמיחה.

מתימנסה לאמוד SMc00930- או SMc01003 המכיל תמציות ללא תאים עם 14 C- או 32 שומנים קוטביים הכוללים שכותרתו P בתנאים אופטימיזציה, נוכל להראות כי אף אחד מן פוספוליפידים הוא מושפל על ידי SMc00930 או SMc01003 בתנאי שבה p -nitrophenyl אסטרים acyl תפקדו כמו מצעים 11. לעומת זאת, פוספוליפאז מסחרי A 2 מארס הנחש הצליח לבזות תערובת של פוספוליפידים כזה 11. תוצאות אלו היו מפתיעים ובלתי צפויים תוך הן, SMc00930 ו SMc01003, נחזו להיות patatin דמוי phospholipases.

כאשר מנסה לאמוד SMc00930- או SMc01003 המכילים תמציות ללא תאים עם 14 C- diacylglycerol שכותרתו (DAG) בתנאים אופטימיזציה, נוכל להראות כי דאג אינו מושפל על ידי SMc00930 או על ידי תמציות ללא תאים של E. coli, ואילו SMc01003 מדרדרת DAG ויוצר תרכובות הנודדים כמו חומצות שומן חופשיות (איור 3). לאחרונה שנוכל להראות כי SMc01003 משמש lipase DAG עלול לפגום דאג או monoacylglycerol כדי גליצרול וחומצות שומן חופשיות 11 (איור 4).

איור 3
איור 3. SMc01003 מדרדרת diacylglycerol. תמציות Cell-ללא E. coli BL21 (DE3) × pLysS להביע SMc01003, SMc00930 או המכיל וקטור pET17b ריק, או חיץ הודגרו עם 14 C-DAG (המתקבל ס meliloti) למשך 24 שעות. בסוף התקופות דגירה בהתאמה, שומני radiolabeled חולצו והופרדו 1D-TLC באמצעות בשלב הנייד להפרדת שומני קוטב ניטראליים (ראה 4.3.2). FA, חומצות שומן; דאג, diacylglycerol. נתון זה יש הבדל בין [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 4
איור 4. אנזימתי פונקציה של lipase diacylglycerol DglA (SMc01003). Diacylglycerol (DAG) lipase SMc01003 מדרדרת DAG כדי monoacylglycerol ו חומצת שומן אחת, ולאחר מכן מדרדרת monoacylglycerol נוספת גליצרול אחר חומצות שומן. אנא לחץ כאן כדי להציג גרסה גדולה יותר של זה דמות.

oligonucleotide
שֵׁם
סדר פעולות
(5'-3 ")
גֵן
של עניין
הגבלת אנזימים
האתר הוסיף
וֶקטוֹר
לביטוי
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 חס"ם אני pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho לי pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 חס"ם אני pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam HI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 חס"ם אני pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam HI pET9a
מכתבים בכתב מודגש מצביעים אתרי הגבלה.

Oligonucleotides בטבלה 1. נעשה שימוש כדי להגביר ולשכפל חזה phospho (lipase) גנים לתוך וקטור pET17b או pET9a. Oligonucleotides פריימר תוכננו באמצעות תוכנת תיאר 15.

Assay עבור SMc00171 Assay עבור SMc01003 Assay עבור SMc00930
המניה רְכִיב
Tris-HCl, pH 8.5 25 μl
2 M Tris-HCl, pH 9.0 25 μl
1 M Diethanolamine HCl, pH 9.8 50 μl
1 M NaCl 40 μl 150 μl 150 μl
1% טריטון X-100 200 μl 200 μl
50 מ"מ p- nitrophenyl palmitate 12.5 μl 12.5 μl
200 מ"מ פוספט nitrophenyl p- בשדרה 2.5 μl
תא ללא לחלץ (1 מ"ג protein / מ"ל) עם הגן המועמד הביע 20 μl 100 μl 1 μl
מי bidistilled 887.5 μl 512.5 μl 611.5 μl
נפח סופי 1 מ"ל 1 מ"ל 1 מ"ל

תוכניות Pipetting טבלה 2. עבור מבחני אנזים מותאם עם מצעים אסתר מלאכותית p -nitrophenyl.

Assay עבור smc00171 -encoded פוספוליפאז C Assay עבור smc01003 - מקודד lipase DAG Assay אופטימלי עבור פוספוליפאז פעילות
המניה רְכִיב
2 M Tris-HCl pH 8.5 2.5 μl
2 M Tris-HCl pH 9.0 2.5 μl
100 מ"מ MnCl 2 3 μl
1 M pH Diethanolamine-HCl 9.8 5 μl
1 M NaCl 4 μl 15 μl 15 μl
1% טריטון X-100 2 μl 20 μl 20 μl 14 ג שכותרתו שומנים (פוספוליפידים) 20 μl (5,000 עותקים לדקה)
14 ג שכותרתו שומנים (PC) 20 μl (5,000 עותקים לדקה)
14 ג שכותרתו שומנים (DAG) 20 μl (5,000 עותקים לדקה)
10 מ"ג / מ"ל תמצית חלבון עם גני מועמדים הביעו 0.5 μl 5 μl 5 μl
מי bidistilled 87.5 μl 77.5 μl 77.5 μl
נפח סופי 100 μl 100 μl 100 μl

שולחן3. תוכניות Pipetting עבור מבחני אנזים מותאמים במיוחד (phospho) lipases עם מצעי שומנים רדיואקטיבי.

הפעילות ניתנת ביחידות (μmol nitrophenol / חלבון מ"ג דקות x)
מספרים מודגשים מצביעי אורך שרשרת acyl של מצע אסתר p -nitrophenyl 10 12 14 16 18
תמצית E. coli (ברקע) 16 ± 0.3 10 ± 1.1 13 ± 0.3 11 ± 0.8 10 ± 0.6
SMc00930 לידי ביטוי E. תמצית coli 1,839 ± 283 2,873 ± 117 5517 ± 394 3,402 ± 65
SMc01003 לידי ביטוי E. תמצית coli 43 ± 2.1 29 ± 2 20 ± 0.7 25 ± 1.5 22 ± 0.9
SMc00930 מינוס רקע 1,823 ± 283 1,829 ± 283 2,860 ± 117 5506 ± 394 3,392 ± 65
SMc01003 מינוס רקע 27 ± 2.1 18 ± 2 7 ± 0.7 14 ± 1.5 12 ± 0.9

אסטרים acyl לוח 4. p -Nitrophenyl כמו מצעים עבור lipases דמוי patatin SMc00930 ו SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

במהלך 20 השנים האחרונות, גנומים של אורגניזמים רבים היו רצף ועל אף נתוני רצף עושר של הגנום נוצר, פירוש פונקציונלי מפגר אחרי ולכן מעכב את הבנתנו הפונקציה הגנום. ג'ין פונקציות הגנומים לעתים קרובות מוקצות בהתבסס על דמיון לגנים של תפקוד או תופעה הידועות של מוטיבים נשמרים. עם זאת, הפונקציה המדויקת של גן מסוים היא לעתים קרובות לא ידועה. במיוחד, ניבא גנים מבניים עבור אנזימים לא ניתן לחקור בקלות על ידי טכניקות omic בשל העובדה שרוב האנזימים לזרז תגובות מורכבות שני מצעים ושני מוצרים. נכון להיום, נראה ריאלי יותר לחקור ספציפיות מצע לקבוצות של אנזימים שבו לפחות מצע אחד הוא קבוע שבו האחרים יכול להיות מגוונת. לדוגמה, אאוקריוטים מוטיבים זירחון ביותר חלבונים ידועים ופפטידים קונצנזוס קינאזות נצפו על תומך איתן במטרה ליצור פפטיד arקרני. באמצעות מערכים כאלה ו- ATP רדיואקטיבי, ספציפיות מצע ורמות פעילות של קינאזות ברורים של אורגניזם יכול להיקבע מתיר הקמת פרופיל kinome והגדרת מצע ספציפי 24. Hydrolases לחבר עוד קבוצה גדולה של אנזימים אשר אחד המצע, מים, הוא קבוע, אך כאלה שעבורם טיבה המדויק של המצע (אחר) כדי להיות הידרוליזה הוא לעתים קרובות לא ידוע. העובדה שבמשך אנזים חדש תנאי assay האופטימליים אינם ידועים או, ממירה את זיהוי של פעילות אנזים חדשה בעיה רבה-משתנית. לפיכך עשוי לעזור כדי להיות מסוגל לתקן את המצע להיות הידרוליזה על מנת להגדיר ובאילו תנאים האנזים עובד הכי טוב.

בכתב היד הנוכחית, אנו מתארים את אופטימיזציה של תנאי assay עבור פוטנציאליים (phospho) lipases עם ספציפיות מצע ידועות לפרט איך להעסיק בתנאים אופטימיזציה אלה בחיפוש אחר המצע הטבעי של מחדשפרספקטיבה (phospho) lipase. המשמעות של הטכניקה הנוכחית מורכבת בעובדה הידרוליזה של מצעי fluorogenic או chromogenic, מלאכותיים, המחקים מצעים טבעיים במידה מסוימת, יכול להיות מלווה spectrophotometry 25 וכי מבחנים אלו חלות בקלות בקנה מידה גדולה שמלומדת 26. בשל הרגישות של מבחנים כזה והפשטות שלהם כדי לפקח על התגובה, הם יכולים להיות מותאמים בקלות על אנזים נתון. מן סתם, על מצעים מלאכותיים שאפשר לצפות פחות קבוע הקינטית נוח (כלומר, גבוה K M, חתול k נמוך) עבור אנזים ספציפי מאשר 1,21 מצעים טבעיים. בפועל, עם זאת, הזמינות ויכולת הגילוי הקלילה של מצעים מלאכותיים מתפקדים (רעים) מצעים עבור קבוצות שלמות של אנזימים לעתים קרובות יותר מאשר פיצוי על החסרונות. לאחר שנפגש אז תנאי אנזים לעבוד (עם המצע המלאכותי), היא תעשה זאת עם נאטוראל / מצע פיסיולוגי כמו גם. כמו ההכנה והבידוד של מצעי שומנים פוטנציאליים יכולים להיות מייגעות זמן רב, חשוב לקיים את הבטחתך, כי אנזים הוא מוכן לעבוד כאשר שילוב דוגר אותו עם מצעים יקרים. חשוב לציין כי ההליך של הראשון אופטימיזציה של תנאי אנזים לעבוד, יאפשר זיהוי מהיר יותר של המצע הפיזיולוגי lipase חדש (phospho). כהוכחת מושג, יש לנו בהצלחה מועסקת בשיטה זו על האפיון של ספציפיות מצע של lipases SMc00171, SMc00930, ו SMc01003 8,11. לעומת זאת, רבים מסורתיים, שיטות חלופיות הקמת מבחנים עבור (phospho) פעילויות lipase לערב תגובות שבו מצע המוצר ידוע בעבר.

ברור, שינויים של מבחני לזהות פעילות אנזים אופטימלי יכול לכלול את השימוש של fluorogenic האחר, chromogenic, או בכל דרך אחרת מצעים מלאכותיים מסומנים, וריאציהריכוז, סוג וריכוז אנזים של מאגרים, או תוספים אחרים (כלומר, דטרגנטים או קטיונים דו ערכיים). אם אין פעילות אנזים מזוהית עם מצעים מלאכותיים, אנזים בהתאמה פשוט לא יכול לעבוד עם המצע הזה, אבל תקלות במקרים כאלה בהחלט צריכות לכלול לקיים את הבטחתך, כי כל אמצעי הזהירות נלקחת שאולי הייתה צורך לשמור על פעילות אנזים ללא פגע (כלומר, לאחסון תמציות ללא תאים ב 4 מעלות צלזיוס או בטמפרטורות נמוכות עד לשימוש, ואם יש צורך, מוסיפים קוקטיילים של מעכבי פרוטאז תמציות ללא התא כדי למנוע השפלה פרוטאוליטים של האנזים של עניין) 27.

מגבלות הטכניקה הציגה בכתב היד הזה הן בשל העובדה כי המצע המלאכותי ואת המצע הטבעי הוא שונים זה מזה וגם מכך את bioenergetics עבור תגובת catalyzed תהיה גם כן 1. הנקוב השונהameters עבור תנאים אופטימליים של פעילות האנזים יש להקים גם עבור המצע הטבעי (על ידי שינוי pH, סוג של חיץ, חיץ כוח, ריכוזי NaCl ודטרגנטים כגון טריטון X-100, בהעדר או בנוכחות קטיונים דו ערכי שונה), כפי שהם עלולים להתברר מעט שונים את התנאים האופטימליים נתקלו עבור המצע המלאכותי. מגבלה נוספת חשובה היא כי כנראה לא כל (phospho) lipases ניתנת לזיהוי על ידי שימוש מצעי chromogenic מלאכותיים. לדוגמא, שאריות p -nitrophenyl המלאכותיות של מצעי אסתר פשוט עשויות להיות מגושמות מדי, או שהם משקפים תכונות כימיות אחרות המונעות כי מצע כזה יכול לקבל גישה אל האתר הפעיל של אנזים. צוין כי דאג lipase SMc01003 מוצגת פעילות נמוכה עם כל מצעי אסתר p -nitrophenyl באורכים שרשרת שונים 11. בידיעה DAG הוא המצע הטבעי עבור SMc01003 וכי יש לדאג relקבוצת ראש קוטב קטנה atively, מורכב גליצרול רק 11, זה שניתן להעלות על דעת בקלות כי p -nitrophenyl השאריות המגושמות הן פשוט גדולות מדי עבור גישה נוחה אל האתר הפעיל של SMc01003. עם זאת, את הפרטים המולקולריים למה אסטרים p -nitrophenyl אינם מצעים טובים SMc01003 אינם ידועים בשלב זה.

צעדים קריטיים בתוך הפרוטוקול לכלול את כל ההוראות לנקוט על מנת להבטיח כי האנזים למד יש גישת המצע בהתאמה. לדוגמא, בחיפוש אחר מצע השומנים הפיזיולוגי, זה קריטי, כי מצע השומנים מסופק בצורת solubilized. לכן, בעת הגדרת מבחני אנזים כזה (מתואר 5 לפרוטוקול), מצעי lipidic, בדרך כלל מומסים תערובות של מתנול: כלורופורם, צריך להיות מעורבים עם תמיסה מימית של סבון, כלומר, טריטון X-100, לפני הייבוש למטה את התערובת עם גז חנקן. הליך זה מבטיח כי, לאחר הוספת Ingre הנותרdients עבור assay, מצע השומנים פוטנציאל מוטבע מיצלות חומרי ניקוי כמו נגיש כגון עבור האנזים במהלך assay.

בעיקר, הטכניקה המוצגת כאן צריך להיות רלוונטי נרחב בעתיד על גילוי חדש (phospho) lipases ו להגדרת מצעים הטבעי שלהם. הטכניקה ניתן להרחבה בקלות בסוגים אחרים של hydrolases, אבל זה יכול להיות יותר מסובך לפתח מבחנים עם מצעים מלאכותיים עבור אנזימים חדשים הדורשות שני, בדרך כלל לא ידועים, מצעים כדי להשלים את מעגל הקטליטית שלהם.

עבור חזה (phospho) lipases או phosphatases לא המצע הנכון ידוע ולא התנאים assay שבו האנזים עובד היטב. לכן, זה עשוי להיות שימושי כדי לחקור האם מתחם כמה מסוללה של תרכובות מלאכותיות, כגון תרכובות -nitrophenyl המכיל p המובהק (פוספט p -nitrophenyl, פוספט -nitrophenyl p בשדרה, p -nitrophenyl palmitate), עשוי לתפקד כמו המצע. התגלית של פעילויות אנזים הראשונית עם מצעים מלאכותיים סללה את הדרך לפתור כי SMc00171 היא C פוספוליפאז PC ספציפי 8, כי SMc01003 הוא lipase DAG 11, ועזר להגדיר את התנאים שבהם SMc00930 משמש hydrolase 11. ברור, המצע הטבעי של SMc00930 כיום עדיין לא ידוע וההקשרים הפיסיולוגיים של SMc00930 ו SMc01003 עדיין להיפתר. לכן, המשימה של מציעים תפקיד פיזיולוגי עבור lipase חזה הוא מאתגר ולא תמיד מיד להצלחה. באמצעות מוטציות לקויות של גן lipase חזה והשוואתן לזן הסוג בר בהתאמה עשוי לתת ראיות ניסיוניות כי lipase מעשים עם סגוליות ברקע הזן המקורי שלו כי כבר הניחו בחלק 4) לפרוטוקול. ברור, הטענה של sh פעילות lipase חדשהולד להיות נתמך בראיות במבחנה כי מצע מסוים מומר על ידי הידרוליזה למוצרים מוגדרים. לפעמים התפקוד הפיזיולוגי הניח עשויה למלא פערי מסלולים מטבוליים או להסביר את ההתנהגות הפיזיולוגית של האורגניזם הייצור, אך במקרים אחרים יש פשוט עדיין לא בטוח שזה יספיק ידע ביוכימי להבין כמה פעילויות. במהלך לימודינו, זיהינו כמה אנזימים הפועלים על שומני קרום קוטב פנימיים של חיידקי מפרקים אותם, ובמקרים מסוימים, והפיכתם שחקן במחזורי שומנים מורכבים יותר. לדוגמא, שילוב של הידע החדש כי SMc00171 היא C פוספוליפאז PC הספציפי (PlcP) 8 כי מושרה בתנאים מגבילים-זרחן של צמיחה, עם נתונים קיימים מראש, אפשר להניח מחזור DAG רומן שעשוי להתקיים פרוטאובקטריה סביבתי רב אשר מוליד את ההיווצרות של שומנים הממברנה ללא זרחן כאשר זרחן הוא הגבלת צמיחה. ב contrאס, כאשר החומרים המתכלים זרחן נמצאים בשפע, DAG הוא rephosphorylated לחומצה phosphatidic הזנת דה נובו ביוסינתזה פוספוליפידים, ובכך סוגר מעגל השומנים הזאת ולהבטיח כי בעיקר (glycero) פוספוליפידים נוכחים בקרום 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים אין לי מה לחשוף.

Acknowledgments

עבודה זו נתמכה על ידי מענקי Consejo Nacional de Ciencias y Tecnología-מקסיקו (CONACyT-מקסיקו) (82,614, 153,998, 253,549, ו 178,359 ב Investigación Científica BASICA וכן 118 Investigación en Fronteras de la Ciencia) ומן Dirección הגנרל דה Asuntos דה אישי Académico-Universidad הלאומית האוטונומית דה מקסיקו (DGAPA-UNAM; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
הגדרת מצע ספציפי עבור מועמדי lipase ו פוספוליפאז
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter