Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Lipase और phospholipase उम्मीदवारों के लिए सब्सट्रेट specificities की परिभाषा

doi: 10.3791/54613 Published: November 23, 2016

Abstract

सूक्ष्मजीवों (phospho) lipases कि आदेश में बाहरी substrates जीव के लिए उपलब्ध बनाने के लिए में स्रावित कर रहे हैं की एक व्यापक स्पेक्ट्रम का उत्पादन। वैकल्पिक रूप से, अन्य (phospho) lipases शारीरिक रूप से उत्पादन जीव आंतरिक लिपिड का कारोबार पैदा कर रहा है और अक्सर सेलुलर झिल्ली का एक remodeling को जन्म देने के साथ जुड़ा हो सकता है। हालांकि संभावित (phospho) lipases एल्गोरिदम के एक नंबर जब जीन / प्रोटीन अनुक्रम उपलब्ध है के साथ भविष्यवाणी की जा सकती है, एंजाइम की गतिविधियों, सब्सट्रेट specificities, और संभावित शारीरिक कार्यों की प्रयोगात्मक सबूत अक्सर प्राप्त नहीं किया गया है। यह पांडुलिपि अज्ञात सब्सट्रेट specificities और कैसे एक संबंधित (phospho) lipase के प्राकृतिक सब्सट्रेट के लिए खोज में इन अनुकूलित शर्तों को रोजगार के लिए के साथ संभावित (phospho) lipases के लिए परख की स्थिति के अनुकूलन का वर्णन है। ऐसे पी -nitrophenyl डेरिवेटिव के रूप में कृत्रिम chromogenic substrates, हो सकता का उपयोग करना, एक नाबालिग का पता लगाने में मददमानक परिस्थितियों में एक भविष्यवाणी (phospho) lipase के लिए enzymatic गतिविधि। इस तरह के एक नाबालिग enzymatic गतिविधि का सामना करना पड़ा करने के बाद, एक एंजाइम परख के विशिष्ट मानकों को आदेश कृत्रिम सब्सट्रेट के एक अधिक कुशल हाइड्रोलिसिस प्राप्त करने के लिए अलग किया जा सकता है। स्थिति है जिसके तहत एक एंजाइम अच्छी तरह से काम करता है निर्धारित करने के बाद के बाद, संभावित प्राकृतिक substrates की एक किस्म है, उनकी गिरावट के लिए यत्न किया जाना चाहिए एक प्रक्रिया है कि अलग chromatographic तरीकों को रोजगार का पालन किया जा सकता है। नई एंजाइमों के लिए सब्सट्रेट specificities की परिभाषा, अक्सर इन एंजाइमों, जो तब प्रयोगात्मक परीक्षण किया जा सकता है की एक संभावित शारीरिक भूमिका के लिए परिकल्पना है। इन निर्देशों के बाद, हम एक phospholipase सी (SMc00171) कि phosphocholine और diacylglycerol, विकास की फास्फोरस सीमित शर्तों पर जीवाणु Sinorhizobium meliloti में झिल्ली के पुनर्गठन के लिए एक महत्वपूर्ण कदम में करने के लिए phosphatidylcholine degrades की पहचान करने में सक्षम थे। दो patatin- भविष्यवाणी के लिएएक ही जीव की phospholipases (SMc00930 और SMc01003) की तरह, हम उनके सब्सट्रेट specificities को फिर से परिभाषित और स्पष्ट है कि SMc01003 एक diacylglycerol lipase है हो सकता है।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

ऐसे triacylglycerols और (glycero) फॉस्फोलिपिड के रूप में ग्लिसरॉल आधारित लिपिड महत्वपूर्ण गठन और शायद सबसे प्रसिद्ध लिपिड कक्षाएं 1। Triacylglycerols (टैग) वसा या तेल, जो आम तौर पर भंडारण लिपिड के रूप में कार्य है, और इसलिए संभावित ऊर्जा और कार्बन स्रोत के रूप में कर रहे हैं। टैग lipases, जो अक्सर उत्पादन जीव द्वारा स्रावित होते हैं बाहरी TAGs पचाने और उन्हें कार्बन स्रोत के रूप में उपलब्ध बनाने के लिए द्वारा अपमानित किया जा सकता है। इसके अलावा, lipases व्यापक रूप से उनके महत्वपूर्ण जैव प्रौद्योगिकी अनुप्रयोगों 2 के कारण पिछले कुछ वर्षों में अध्ययन किया गया है।

उनकी amphiphilic प्रकृति और उनके पास बेलनाकार आकृति, (glycero) फॉस्फोलिपिड प्रदर्शनी झिल्ली के गठन गुण और आम तौर पर एक bilayered झिल्ली 3 के प्रमुख घटक lipídic का गठन करने के कारण। ऐसे कोलाई, केवल तीन प्रमुख सिर समूह वेरिएंट, phosphatidylglycerol (पीजी), cardiolipin (सीएल), और phosphatid के रूप में सरल सूक्ष्मजीवों मेंylethanolamine (पीई) सामना कर रहे हैं, हालांकि एक बारे में पता होना चाहिए कि उनमें से हर एक एक काफी अलग आणविक प्रजातियों 4 की एक बड़ी संख्या के लिए एस.एन. पर विभिन्न फैटी एसाइल चेन की संख्या -1 या एस.एन. -2 स्थिति जन्म देने के साथ प्रतिस्थापित किया जा सकता है । अन्य जीवाणुओं अलावा या बजाय अन्य फॉस्फोलिपिड हो सकता है। 5 उदाहरण के लिए, Sinorhizobium meliloti, एक मृदा जीवाणु, जो फली अल्फला (मेडिकागो पौधा) के साथ एक नाइट्रोजन फिक्सिंग जड़ गुत्थी सहजीवन बनाने में सक्षम है, इसके अलावा में शामिल एक दूसरे zwitterionic फॉस्फोलिपिड, phosphatidylcholine (पीसी) पीई के लिए। फास्फोरस या ग्लिसरॉल इसके अलावा, लिपिड युक्त नहीं सेलुलर झिल्ली की amphiphilic और फार्म का हिस्सा हो सकता है। उदाहरण के लिए, फास्फोरस सीमित विकास की स्थिति पर, एस में meliloti, (glycero) फॉस्फोलिपिड काफी हद तक झिल्ली लिपिड कि फास्फोरस, यानी, sulfolipids, ओर्निथिन लिपिड, और diacylglyceryl trimethylho शामिल नहीं है द्वारा प्रतिस्थापित कर रहे हैंmoserine (DGTS) 6। बैक्टीरिया में, DGTS एक दो कदम मार्ग 7 में diacylglycerol (डेग) से बनाई है लेकिन डेग पीढ़ी के लिए स्रोत स्पष्ट नहीं था। पल्स चेस प्रयोगों सुझाव दिया है कि पीसी DGTS 8 के लिए एक अग्रदूत साबित हो सकता है और कार्यप्रणाली इस पांडुलिपि हम एक phospholipase सी (PlcP, SMc00171) की पहचान कर सकता है में वर्णित का उपयोग कर सकता है कि फास्फोरस सीमित शर्तों के तहत गठित किया गया है और जो डेग और phosphocholine में पीसी परिवर्तित कर सकते हैं 8।

एक अलग अध्ययन में, हमें पता चला है कि एक एसाइल सीओए synthetase (Fadd) एस के -deficient उत्परिवर्ती meliloti या कोलाई मुक्त फैटी एसिड संचित जब विकास 9 के स्थिर चरण में प्रवेश। हालांकि इन फैटी एसिड झिल्ली लिपिड से प्राप्त किया जा करने के लिए लग रहा था, मुक्त फैटी एसिड या एंजाइम (s) उन्हें मुक्ति के लिए सटीक स्रोत नहीं जाने जाते थे। फिर, रणनीति काम इस पांडुलिपि में उल्लिखित, दो patatin की तरह 10 (phospho) lipases (SMc00930 और SMc01003) है कि एस में मुक्त फैटी एसिड के गठन के लिए योगदान meliloti 11 भविष्यवाणी की थी। हैरानी की बात है, यह SMc01003 monoacylglycerol और अंत में ग्लिसरॉल और मुक्त फैटी एसिड 11 को परिवर्तित सब्सट्रेट के रूप में डेग इस्तेमाल किया। इसलिए, SMc01003 एक डेग lipase (DGLA) है।

एल्गोरिदम के एक नंबर क्षमता (phospho) की भविष्यवाणी के लिए मौजूद हालांकि 12,13 lipases, उनके सटीक समारोह और शारीरिक भूमिका आम तौर पर नहीं जाना जाता है। यहाँ हम एक प्रोटोकॉल की रूपरेखा तैयार, क्लोन करने के लिए और overexpress भविष्यवाणी या संभावित (phospho) lipases। यह पांडुलिपि कैसे एंजाइम assays विकसित और कृत्रिम chromogenic substrates का उपयोग करके overexpressed (phospho) lipase के लिए अनुकूलित किया जा सकता बताते हैं। हम कैसे एक अनुकूलित एंजाइम परख के साथ रियल (phospho) lipase सब्सट्रेट सामना किया जा सकता है और कैसे इन निष्कर्षों माइक्रोबियल शरीर विज्ञान के बारे में हमारी समझ को समृद्ध हो सकता है उदाहरण देते हैं।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. क्लोन और भविष्यवाणी की Lipase के लिए overexpress स्ट्रक्चरल जीन

  1. पोलीमरेज़ चेन रिएक्शन (पीसीआर) 14 और विशिष्ट ओलईगोन्युक्लियोटाईड्स (तालिका 1) 15 का उपयोग करना, ब्याज (smc01003, smc00930, या smc00171) के जीन बढ़ाना, एक lipase के लिए कोड या phospholipase, मेजबान जीव के जीनोमिक डीएनए से की भविष्यवाणी की है (यानी एस meliloti)।
    1. (Oligonucleotides के लिए डिज़ाइन किया गया अनुक्रम के साथ) विशिष्ट प्रतिबंध साइटों का परिचय। इसी प्रतिबंध एंजाइमों के साथ प्रवर्धित डीएनए टुकड़ा डाइजेस्ट और ऐसे पालतू श्रृंखला 16 वर्ष की plasmids के रूप में एक अभिव्यक्ति वेक्टर में यह क्लोन।
    2. क्लोन जीन के लिए सही डीएनए अनुक्रम पुष्टि करने के बाद, इस तरह के कोलाई BL21 (DE3) pLysS 16 के रूप में एक अभिव्यक्ति तनाव के लिए वेक्टर बदलना।
  2. अभिव्यक्ति मेजबान की एक रात पूर्व संस्कृति तैयार कोलाई BL21 (DE3) पी एलयोगदा, क्लोन जीन या खाली वेक्टर के साथ संबंधित पीईटी वेक्टर शरण 100 मिलीलीटर संस्कृति Luria Bertani शोरबा (पौंड) 17 से 20 मिलीलीटर युक्त बोतल के साथ साथ आवश्यक एंटीबायोटिक दवाओं में। संस्कृति 30 डिग्री सेल्सियस पर कोशिकाओं (या जीवाणु से lipase originates के सामान्य विकास के तापमान पर)।
    1. रात भर पूर्व संस्कृतियों का प्रयोग, 620 एनएम (आयुध डिपो 620) = 0.05 पर एक प्रारंभिक ऑप्टिकल घनत्व प्राप्त करने के लिए 2 एल संस्कृति बोतल में prewarmed लेग माध्यम के 500 मिलीलीटर (प्लस आवश्यक एंटीबायोटिक) टीका लगाना। , संस्कृतियों की और एक आयुध डिपो 620 = 0.3 पर विकास का पालन करें 100 सुक्ष्ममापी के अंतिम एकाग्रता के लिए isopropyl-β-D-thiogalactoside (IPTG) जोड़ने के लिए, और 4 घंटे की अवधि के लिए 30 डिग्री सेल्सियस पर आंदोलन के तहत सेते हैं।
    2. ऊष्मायन अवधि के अंत में, 30 मिनट के लिए 4 डिग्री सेल्सियस पर 5000 XG पर एक 500 मिलीलीटर अपकेंद्रित्र ट्यूब और सेंट्रीफ्यूज के लिए प्रत्येक संस्कृति हस्तांतरण। (निलंबन बफर के 5 मिलीलीटर जैसे, एस में बैक्टीरिया कोशिका छर्रों ResuspendMc00930- और 50 मिमी Diethanolamine एचसीएल पीएच 9.8) में 50 मिमी Tris एचसीएल पीएच 8.0 और SMc00171 व्यक्त कोशिकाओं में SMc01003 व्यक्त कोशिकाओं। -80 डिग्री सेल्सियस उपयोग करें जब तक सेल निलंबन स्टोर।

2. सेल मुक्त प्रोटीन के अर्क तैयार है और प्रोटीन एकाग्रता का निर्धारण

  1. बैक्टीरिया कोशिका निलंबन Defrost और बर्फ पर दुकान। 2 में प्रति 20,000 पौंड में सेल निलंबन एक ठंडा दबाव सेल के माध्यम से तीन बार गुजरती हैं। बरकरार कोशिकाओं और सेल मलबे 4 डिग्री सेल्सियस पर 30 मिनट के लिए 5000 XG पर centrifugation द्वारा निकालें।
  2. Centrifugation के बाद, बाद के विश्लेषण के लिए सतह पर तैरनेवाला से 100 और 500 μl की aliquots तैयार करने और उन्हें -80 डिग्री सेल्सियस उपयोग करें जब तक दुकान।
  3. 100 μl विभाज्य में से एक का उपयोग पसंद का एक विधि द्वारा या वर्णित 18 के रूप में अलग सेल मुक्त अर्क के प्रोटीन एकाग्रता का निर्धारण करने के लिए।

अनुकूलन एंजाइम के लिए 3. का प्रयोग कृत्रिम Substrates(फास्फो) lipases की क्रियाएँ

  1. अलग एंजाइम गतिविधियों का एक प्रारंभिक कवरेज के लिए, इस तरह के पी -nitrophenol (पी -NP) के रूप में कृत्रिम substrates कि हाइड्रोलिसिस पर एक रंगीन उत्पाद उपज, का उपयोग करें।
    1. कृत्रिम पी -nitrophenyl एस्टर substrates के साथ पहले से ही अनुकूलित एंजाइम assays के लिए (phospholipase सी PlcP (SMc00171) के लिए रेखांकित किया है, साथ ही भविष्यवाणी की patatin-तरह phospholipases SMc00930 और SMc01003 के लिए), उपयोग pipetting योजनाओं तालिका 2 में वर्णित है।
    2. जब एक नया संभावित (phospho) lipase की खोज, 50 मिमी Tris एचसीएल, पीएच 8.5, 100 मिमी NaCl, 0.05% ट्राइटन X-100, 0.5 मिमी पी -nitrophenyl युक्त यौगिक (पी -nitrophenyl फॉस्फेट युक्त पहली बार एक मानक एंजाइम परख तैयार , bis- पी -nitrophenyl फॉस्फेट, पी -nitrophenyl decanoate, या पी -nitrophenyl palmitate), और सेल मुक्त प्रोटीन निकालने जांच (1, 3, 10, 30, 100, 300, और 1000 माइक्रोग्राम) 1 की कुल मात्रा में मिलीलीटर में 1 मिलीलीटर की प्लास्टिक Cuveटीटीई।
      नोट: क्षारीय पीएच उपयोग (चित्रा 1) जब एक सतत परख में पी -nitrophenyl एस्टर हाइड्रोलिसिस के बाद। वैकल्पिक रूप से, पीएच मान की एक श्रृंखला के लिए एक समय बिंदु assays का उपयोग करें, ऊष्मायन अवधि के अंत में NaOH जोड़ने एंजाइम की प्रतिक्रिया को समाप्त करने और यह सुनिश्चित करें कि सभी पी -NP phenolate रूप में मौजूद है।
    3. एक एक 5 मिनट की अवधि में 30 डिग्री सेल्सियस पर 405 एनएम पर absorbance की वृद्धि हुई है, पी -NP के गठन के कारण, एक स्पेक्ट्रोफोटोमीटर में लिए समय पाठ्यक्रम का पालन करें। समय के अनुसार absorbance की वृद्धि की प्रारंभिक ढलान का निर्धारण करके पी -NP के शुरू में रेखीय गठन यों।
    4. लैम्बर्ट बीयर की कानून (ΔA = ε Δc घ) 1 का उपयोग कर पी -NP के लिए एकाग्रता (Δc) के परिवर्तन की गणना।
      नोट: ΔA चुना गया absorbance के रैखिक परिवर्तन है, ε संबंधित तरंग लंबाई पर दाढ़ विलुप्त होने के गुणांक (एम की इकाइयों में है -1 -1), डी प्रकाश पथ (1 सेमी) की लंबाई है, और Δc (एकाग्रता के परिवर्तन एम की इकाइयों में) निर्धारित किया जा रहा है।
      1. यह देखते हुए कि परख मात्रा 1 मिलीग्राम है, का गठन पी -NP की राशि की गणना।
        नोट: राशि = एकाग्रता एक्स मात्रा।
      2. जो समय में यह बनाई है द्वारा गठित पी -NP की राशि को विभाजित करके एंजाइम गतिविधि की गणना। प्रोटीन की मात्रा (एमजी में) जो इस गतिविधि पैदा करने के लिए जिम्मेदार था द्वारा एंजाइम गतिविधि को विभाजित करके विशेष एंजाइम गतिविधि का निर्धारण।
    5. प्रोटीन के अर्क से उकसाया absorbance के परिवर्तन जिसमें एक उम्मीदवार जीन (smc00171, smc00930, या smc01003) के अर्क है कि केवल एक खाली वेक्टर बंदरगाह के साथ व्यक्त किया गया था की तुलना करें।
      नोट: निम्न चरणों के साथ जारी रखने के लिए, विशिष्ट गतिविधियों, प्रोटीन के अर्क, जिसमें एक उम्मीदवार जीन व्यक्त किया गया था, की वजह से कम से कम दो बार या मीटर होना चाहिएप्रोटीन के अर्क है कि केवल एक खाली वेक्टर बंदरगाह की वजह से विशिष्ट गतिविधियों के लिए प्राप्त मूल्यों की तुलना अयस्क।
    6. आगे के प्रयोगों के लिए, उन परिस्थितियों में पी -nitrophenyl युक्त यौगिक की hydrolysis सेल मुक्त अर्क (यानी, खाली वेक्टर) और जिसके लिए पी -NP का सबसे स्पष्ट गठन और पी -nitrophenolate आयनों (चित्रा के साथ बहुत कम है का चयन 1) जब प्रोटीन के अर्क कार्यरत हैं, जिसमें एक उम्मीदवार जीन व्यक्त की गई थी मनाया जा सकता है।
  2. 3.1 में प्रारंभिक एंजाइम गतिविधि का निर्धारण करने के बाद, संबंधित एंजाइम के लिए परख की स्थिति पीएच, बफर के प्रकार के अलग करके, सोडियम क्लोराइड की सांद्रता का अनुकूलन शक्ति बफर, इस तरह के ट्राइटन X-100 के रूप में डिटर्जेंट, और अभाव या अलग द्विसंयोजक फैटायनों की उपस्थिति।
    1. प्रत्येक चर के विभिन्न सांद्रता के लिए, विशेष एंजाइम गतिविधि का निर्धारण (3.1.4.2 देखें) (उच्चतम संख्या प्राप्त की हालत को परिभाषित करता हैअधिक से अधिक एंजाइम गतिविधि का)। एक अनुकूलित एंजाइम परख जिसमें प्रत्येक चर अपने इष्टतम एकाग्रता में मौजूद है परिभाषित करने के लिए प्रत्येक चर के लिए इष्टतम स्थितियों का सामना करना पड़ा के संयोजन का उपयोग करें।

आकृति 1
चित्रा 1. पी -Nitrophenyl एस्टर (phospho) एक spectrophotometric परख में lipases के लिए के रूप में कृत्रिम substrates। पी -nitrophenyl एस्टर की hydrolysis पर, एक एसिड (आर-OH) और पी -nitrophenol (पी -NP) का गठन कर रहे हैं। PK एक = 7.2 पी -NP से phenolic एच + की हदबंदी के लिए, के कारण एक पीएच> और अधिक से अधिक 9.2 99% चमकीले पीले पी -nitrophenolate फार्म और 18,000 एम -1 सेमी की एक दाढ़ विलुप्त होने के गुणांक में हैं - 1 एक तरंग लंबाई पर इस्तेमाल किया जा सकता है मुक्त P -nitrophenolate 22 की मात्रा का ठहराव के लिए 405 एनएम की। जब 8.5 की एक पीएच के साथ buffers इस्तेमाल किया गया, absorbance के 400 एनएम और 14,500 एम -1 सेमी की एक दाढ़ विलुप्त होने के गुणांक में निर्धारित किया गया था -1 23 नियोजित किया गया था। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

नोट: ब्याज की एंजाइम की गतिविधि के लिए इष्टतम स्थितियों में परिभाषित करने के बाद, इस lipase की वास्तविक / शारीरिक सब्सट्रेट के लिए खोज पर लगना। सिद्धांत रूप में, दो, अक्सर पूरक ले, इस लक्ष्य है, एक में विवो दृष्टिकोण या इन विट्रो दृष्टिकोण को प्राप्त करने के लिए दृष्टिकोण।

4. Vivo एक lipase की शारीरिक सब्सट्रेट की पहचान

ove_content "> नोट:। एक विवो दृष्टिकोण में, ताकि समय पर कि क्या lipase की अभिव्यक्ति host's लिपिड प्रोफाइल बदल खत्म रजिस्टर करने के लिए एक मेजबान जीव 8,11 में ब्याज की lipase का इजहार एक और इन विवो दृष्टिकोण में, एक उत्पन्न उत्परिवर्ती ब्याज 8,11 के जीन की कमी और अध्ययन है कि क्या इसकी लिपिड प्रोफाइल जंगली प्रकार संस्करण 6,8,11 से अलग है। क्रम में एक जीव के लिपिड प्रोफाइल का एक मात्रात्मक आकलन प्राप्त करने के लिए, एक सरल विधि सेलुलर यौगिकों radiolabeling में होते हैं , लिपिड निकालने क्रोमैटोग्राफी द्वारा उन्हें अलग, और radioactively लेबल अलग लिपिड बढ़ाता।

  1. लिपिड के radiolabeling।
    1. वांछित संस्कृति के माध्यम से (जटिल मध्यम या परिभाषित कम से कम मध्यम) के 5 मिलीलीटर में ब्याज (ई कोलाई या एस meliloti) के एक जीव की एक रात में प्री-संस्कृति को तैयार है और 30 डिग्री सेल्सियस पर बढ़ता है।
    2. प्री-संस्कृति से, एसए के 20 मिलीलीटर में टीका लगानामुझे एक 100 मिलीलीटर संस्कृति कुप्पी में ताजा मध्यम एक प्रारंभिक आयुध डिपो 620 = संस्कृति के लिए 0.3 प्राप्त करने के लिए।
    3. बाँझ शर्तों के तहत संस्कृति का एक विभाज्य (1 मिलीलीटर) ले लो और एक 14 मिलीलीटर बाँझ polystyrene दौर नीचे ट्यूब को हस्तांतरण।
    4. [1- 14 सी] एसीटेट (mmol प्रति 60 एमसीआई) 1 मिलीलीटर संस्कृति के 1 μCi जोड़ें।
    5. 24 घंटे की अवधि के लिए 30 डिग्री सेल्सियस पर आंदोलन के तहत तरल संस्कृति सेते हैं।
    6. ऊष्मायन अवधि के अंत में, 5 मिनट के लिए कमरे के तापमान पर 12,000 XG पर एक 1.5 मिलीलीटर microcentrifuge ट्यूब और सेंट्रीफ्यूज संस्कृति हस्तांतरण।
    7. पानी के 100 μl में गोली Resuspend। इस बिंदु पर, -20 डिग्री सेल्सियस पर सेल निलंबन की दुकान या तुरंत ध्रुवीय लिपिड (खंड 4.2) की निकासी के साथ जारी है।
  2. ध्रुवीय लिपिड के निष्कर्षण।
    नोट: इस विधि यहां अनिवार्य रूप से वर्णित प्रक्रिया Bligh और डायर 19 द्वारा रिपोर्ट इस प्रकार है।
    1. जलीय सेल susp के 100 μl करने के लिए(:; खंड / खंड 1 2) क्लोरोफॉर्म समाधान: ension, मेथनॉल के 375 μl जोड़ें।
    2. 30 सेकंड के लिए भंवर और कमरे के तापमान पर 5 मिनट के लिए सेते हैं।
    3. अपकेंद्रित्र 5 कमरे के तापमान पर 12,000 XG पर मिनट।
    4. एक नया 1.5 मिलीलीटर microcentrifuge ट्यूब स्थानांतरण सतह पर तैरनेवाला।
    5. क्लोरोफॉर्म के 125 μl और पानी के 125 μl, भंवर 30 सेकंड जोड़ें।
    6. अपकेंद्रित्र 1 कमरे के तापमान पर 12,000 XG पर मिनट।
    7. नाइट्रोजन गैस की एक धारा के साथ एक ताजा ट्यूब और सूखी करने के लिए कम क्लोरोफॉर्म चरण हस्तांतरण।
    8. (:; खंड / खंड 1 1) मेथनॉल समाधान: क्लोरोफॉर्म के 100 μl में सूखे लिपिड भंग।
      नोट: इस बिंदु पर, लिपिड समाधान के 5 μl के एक विभाज्य तरल जगमगाहट गिनती द्वारा मात्रा निर्धारित किया जा सकता है।
    9. पतली परत chromatographic (टीएलसी) विश्लेषण के लिए, नाइट्रोजन गैस की एक धारा के साथ शेष 95 μl नीचे सूखी और क्लोरोफॉर्म के 20 μl में सूखे लिपिड redissolve: मेथनॉल समाधान (1: 1; / खंड खंड)। एक 3 μl विभाज्य का प्रयोग करेंटीएलसी विश्लेषण के लिए।
  3. पतली परत क्रोमैटोग्राफी (टीएलसी) द्वारा ध्रुवीय लिपिड के पृथक्करण।
    नोट: लिपिड वर्गों के आधार पर विश्लेषण किया जा सकता है, ठोस और मोबाइल चरणों के विभिन्न संयोजनों के अलग होने के लिए नियोजित किया जा सकता है। यहां आरोप लगाया ध्रुवीय लिपिड और दूसरा, तटस्थ ध्रुवीय लिपिड के लिए अधिक अनुकूल है, ठोस चरण के रूप में उच्च प्रदर्शन पतली परत क्रोमैटोग्राफी (HPTLC) सिलिका जेल एल्यूमीनियम शीट का उपयोग कर के लिए एक विशिष्ट जुदाई, रेखांकित कर रहे हैं।
    1. दो आयामी टीएलसी (2 डी-टीएलसी) ने आरोप लगाया ध्रुवीय लिपिड के पृथक्करण।
      1. एक HPTLC सिलिका जेल एल्यूमीनियम शीट (10 x 10 सेमी), थाली के किनारे से 2 सेमी के एक कोने में लिपिड नमूना के एक 3 μl विभाज्य लागू करें।
      2. तैयार है और पहला आयाम में अलग होने के लिए मोबाइल चरण (140 मिलीलीटर क्लोरोफॉर्म, 60 मिलीलीटर मेथनॉल, और 10 मिलीलीटर पानी) मिश्रण।
      3. कोट क्रोमैटोग्राफी कागज के साथ एक टीएलसी चैम्बर आंतरिक रूप से विकसित किया गया।
        नोट: यह सुनिश्चित करने के लिए है कि चैम्बर के गैस चरणतेजी से संतृप्त किया जाएगा (30 मिनट के भीतर) पहली आयाम के लिए मोबाइल चरण के बाद चैम्बर के लिए जोड़ दिया गया है और चैम्बर एक गिलास प्लेट के साथ बंद कर दिया गया है।
      4. तैयार है और मोबाइल चरण मिश्रण (130 मिलीलीटर क्लोरोफॉर्म, 50 मिलीलीटर मेथनॉल, और 20 एमएल हिमनदों एसिटिक एसिड) एक दूसरे टीएलसी विकासशील चैम्बर आंतरिक रूप से क्रोमैटोग्राफी कागज के साथ लेपित करने के लिए दूसरा आयाम में जुदाई और हस्तांतरण के लिए और कक्ष तर करते हैं।
      5. ध्यान से HPTLC सिलिका जेल एल्यूमीनियम शीट सूखे लिपिड नमूना के साथ पहली बार चैम्बर के लिए प्लेट 60 मिनट के लिए बंद कक्ष में पहला आयाम 5 में हस्तांतरण और विकास (यानी, क्रोमैटोग्राफी प्रदर्शन)।
      6. चैम्बर से थाली निकालें और सॉल्वैंट्स 30 मिनट के लिए एक प्रवाह हुड में बंद से सूखे।
      7. पिछले क्रोमैटोग्राफी के संबंध में 90 डिग्री से प्लेट बदल के बाद, HPTLC सिलिका जेल एल्यूमीनियम शीट, जिस पर लिपिड एक आयाम में अलग हो गया है हस्तांतरण secon करने के लिएडी चैम्बर और दूसरा आयाम 5 में 60 मिनट के लिए थाली का विकास।
      8. चैम्बर से चादर निकालें और सॉल्वैंट्स कम से कम 2 घंटे के लिए एक प्रवाह हुड में बंद से सूखे।
    2. तटस्थ ध्रुवीय लिपिड के पृथक्करण।
      1. एक HPTLC सिलिका जेल एल्यूमीनियम शीट थाली के किनारों से 2 सेमी शुरू करने पर लिपिड नमूनों की 3 μl aliquots लागू करें। कई नमूने एक आयामी क्रोमैटोग्राफी में विश्लेषण कर रहे हैं, तो अलग नमूना आवेदन स्पॉट के बीच कम से कम 1.5 सेमी की दूरी रखने के लिए।
      2. तैयार है और मोबाइल चरण मिश्रण (140 मिलीलीटर हेक्सेन, 60 मिलीलीटर diethylether, और 8 एमएल एसिटिक एसिड) एक टीएलसी के विकास के चैम्बर के लिए और हस्तांतरण आंतरिक रूप से क्रोमैटोग्राफी कागज के साथ लिपटे और एक गिलास प्लेट चैम्बर तर (30 मिनट) जाने के लिए के साथ कवर किया।
      3. चैम्बर के लिए सूखे लिपिड नमूनों के साथ HPTLC सिलिका जेल एल्यूमीनियम शीट स्थानांतरण और बंद कक्ष में 30 मिनट के लिए प्लेट का विकास।
      4. चैम्बर से थाली निकालेंऔर सॉल्वैंट्स 2 घंटे के लिए एक प्रवाह हुड में बंद से सूखे।
  4. मात्रा का ठहराव और अलग ध्रुवीय लिपिड के दृश्य।
    1. एक बार विकसित टीएलसी चादर सूखी है, 3 दिनों के लिए एक बंद कैसेट में एक फोटोस्टिमुलेबल luminescence (पीएसएल) स्क्रीन के साथ यह सेते हैं।
    2. एक पीएसएल स्कैनर के लिए incubated स्क्रीन बेनकाब और अलग radiolabeled लिपिड के एक आभासी छवि अधिग्रहण।
    3. पीएसएल सॉफ्टवेयर का उपयोग कर 20 मात्रा का ठहराव प्रदर्शन करना।
  5. दृश्य और व्यक्तिगत ध्रुवीय लिपिड वर्गों के अलगाव।
    1. आयोडीन क्रिस्टल के 1 जी की उपस्थिति में एक क्रोमैटोग्राफी कक्ष में 10 मिनट के लिए विकसित टीएलसी चादर सेते हैं।
      नोट: अलग lipídic यौगिकों आयोडीन भंग करने और भूरे धब्बे के रूप में दिखाई देगा।
    2. सर्किल एक पेंसिल के साथ धब्बे, उन्हें मानक यौगिकों (यानी, 1,2-dipalmitoyl- एस.एन. -glycerol, dipalmitoyl एल α-फॉसफोरस के रिश्तेदार गतिशीलता (आर एफ) के लिए की तुलनाphatidylcholine, डीएल-α-monopalmitin, या पामिटिक एसिड), और पहचान जो लिपिड वर्ग वे संबंधित हो सकता है।
    3. एक धूआं हुड में, आयोडीन टीएलसी चादर से लुप्त हो जाना।
    4. एक रंग की मदद से, सिलिका चादर से ब्याज की यौगिक युक्त जेल परिमार्जन, और पानी के 100 μl और मेथनॉल के 375 μl का एक मिश्रण के साथ सिलिका जेल से यौगिक निकालें: क्लोरोफॉर्म समाधान (2: 1; वॉल्यूम / खंड)।
    5. Bligh और डायर के अनुसार निकासी के साथ जारी रखें उल्लिखित के रूप में (4.2.2 के बाद)।
    6. -20 डिग्री सेल्सियस उपयोग करें जब तक;: (/ खंड खंड 1 1) मेथनॉल समाधान: क्लोरोफॉर्म के 100 μl में स्टोर शुद्ध लिपिड वर्ग।

5. इन विट्रो एक lipase की शारीरिक सब्सट्रेट की पहचान

नोट: इन विट्रो दृष्टिकोण में, अध्ययन है कि क्या ब्याज की lipase इसी Hydrol को अलग-थलग लिपिड या व्यक्ति शुद्ध लिपिड का एक मिश्रण में बदल सकते हैंशर्तों 3.2 में इष्टतम के रूप में परिभाषित के तहत विश्लेषण उत्पादों।

  1. पीसी-विशिष्ट phospholipase सी SMc00171 (5.2 देखें), phospholipase ए (5.3 देखें), और डेग lipase SMc01003 के लिए प्रति 3 टेबल के रूप में एंजाइम assays के लिए pipetting योजनाओं का उपयोग गतिविधि (5.4 देखें)।
  2. पीसी-विशिष्ट phospholipase सी गतिविधि (3 टेबल) का निर्धारण।
    1. एक 1.5 मिलीलीटर microcentrifuge ट्यूब, प्रति मिनट 5000 की गिनती के कुल 14 सी लेबल पीसी के (सीपीएम) और ट्राइटन X-100 का एक समाधान जोड़ें।
    2. मिक्स और नाइट्रोजन की एक धारा के तहत शुष्क।
    3. Diethanolamine एचसीएल, पीएच 9.8 बफर, साथ ही NaCl और MnCl 2 समाधान और bidistilled पानी 99.5 μl के अंतिम मात्रा प्राप्त करने के लिए जोड़ें। 5 सेकंड के लिए भंवर।
    4. एंजाइम (5 माइक्रोग्राम प्रोटीन) के 0.5 μl जोड़ें (यानी, एक सेल मुक्त निकालने जिसमें overexpressed SMc00171 मौजूद है) प्रतिक्रिया आरंभ करने के लिए। संक्षेप में मिलाएं।
    5. 4 घंटे के लिए 30 डिग्री सेल्सियस पर सेते हैं।
    6. प्रतिक्रिया बंद करोमेथनॉल के 250 μl और क्लोरोफॉर्म के 125 μl के अलावा।
    7. के रूप में पहले से वर्णित लिपिड (देखें 4.2) निकालें।
    8. एक आयामी (1 डी) -TLC से अलग लिपिड (4.3.2 और 4.4 देखें), और पीएसएल इमेजिंग द्वारा उन्हें विश्लेषण।
  3. Phospholipase एक गतिविधि का निर्धारण (3 टेबल)।
    1. एक 1.5 मिलीलीटर microcentrifuge ट्यूब, कुल 14 सी लेबल फॉस्फोलिपिड के 5,000 सीपीएम और ट्राइटन X-100 का एक समाधान जोड़ें।
    2. मिक्स और नाइट्रोजन की एक धारा के तहत शुष्क।
    3. एक अंतिम 100 μl परख के लिए, Tris एचसीएल, पीएच 8.5 बफर, सोडियम क्लोराइड समाधान और पानी जोड़ें। 5 सेकंड के लिए भंवर।
    4. (50 ग्राम प्रोटीन) एंजाइम के 5 μl जोड़ें (यानी, एक सेल मुक्त निकालने जिसमें overexpressed SMc00930 या SMc01003 मौजूद है)।
    5. 5 घंटे के लिए 30 डिग्री सेल्सियस पर सेते हैं।
    6. मेथनॉल के 250 μl और क्लोरोफॉर्म के 125 μl के अलावा द्वारा प्रतिक्रिया बंद करो।
    7. के रूप में पहले से वर्णित लिपिड (देखें 4.2), अलग निकालेंद्वारा -1 डी-टीएलसी 130 मिलीलीटर क्लोरोफॉर्म, 50 मिलीलीटर मेथनॉल, और मोबाइल चरण के रूप में 20 मिलीलीटर हिमनदों एसिटिक एसिड का उपयोग, और पीएसएल इमेजिंग द्वारा उन्हें विश्लेषण उन्हें।
  4. diacylglycerol (डेग) lipase गतिविधि का निर्धारण।
    1. 14 सी लेबल डेग की तैयारी।
      1. Radiolabel एस meliloti संस्कृतियों (4.1 देखें) और ध्रुवीय लिपिड निकालने (देखें 4.2) के रूप में वर्णित है। अलग एस मेथनॉल: में क्लोरोफॉर्म -1 डी-टीएलसी द्वारा meliloti कुल लिपिड अर्क एसिटिक एसिड (130: 50: 20; खंड / खंड) 4.3.1 में दूसरा आयाम में अलग होने के लिए वर्णित शर्तों का उपयोग।
      2. आयोडीन धुंधला द्वारा पीसी कल्पना और phosphatidylcholine (पीसी) का स्थानीयकरण चिह्नित करने के लिए एक पेंसिल का उपयोग करें।
      3. radiolabeled पीसी पृथक 4.5 में वर्णित है।
      4. जगमगाहट गिनती द्वारा निकाले पीसी यों।
        नोट: के बारे में 320,000 सीपीएम पीसी की उम्मीद है।
      5. 50 मिमी Tris एचसीएल, पीएच 7.2, 0.5 में क्लोस्ट्रीडियम perfringens से phospholipase सी के 0.1 यू के साथ पीसी (250,000 सीपीएम) का इलाज% ट्राइटन X-100 और 100 μl की कुल मात्रा में 2 घंटे के लिए 10 मिमी 2 CaCl और मेथनॉल के 250 μl और क्लोरोफॉर्म के 125 μl जोड़कर प्रतिक्रिया बंद करो।
      6. के रूप में 1 डी-टीएलसी (4.3.2 देखें) द्वारा उनके द्वारा पहले से और अलग वर्णित लिपिड निकालें।
      7. सिलिका थाली से diacylglycerol अलग करने और (4.2 में वर्णित) जगमगाहट गिनती द्वारा यों
    2. Diacylglycerol lipase परख (3 टेबल)।
      1. एक 1.5 मिलीलीटर microcentrifuge ट्यूब, 14 सी लेबल डेग के 5,000 सीपीएम और ट्राइटन X-100 का एक समाधान जोड़ें।
      2. मिक्स और नाइट्रोजन की एक धारा के तहत शुष्क।
      3. एक अंतिम 100 μl परख के लिए, Tris एचसीएल (पीएच 9.0) बफर, एक सोडियम क्लोराइड समाधान और bidistilled पानी जोड़ें। 5 सेकंड के लिए भंवर।
      4. (सेल मुक्त निकालने की 50 ग्राम प्रोटीन) एंजाइम के 5 μl जोड़कर प्रतिक्रिया आरंभ।
      5. 4 घंटे के लिए 30 डिग्री सेल्सियस पर सेते हैं।
      6. मेथनॉल एक के 250 μl के अलावा द्वारा प्रतिक्रिया बंद करोडी 125 क्लोरोफॉर्म और निकालने लिपिड के रूप में पहले से वर्णित के μl (देखें 4.2)।
      7. -1 डी-टीएलसी (4.1.3.2 देखें) और बाद में पीएसएल इमेजिंग द्वारा तटस्थ ध्रुवीय लिपिड का विश्लेषण।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bis- पी -nitrophenyl फास्फेट के साथ पीसी-विशिष्ट phospholipase सी SMc00171 की गतिविधि

सेल मुक्त अर्क से प्राप्त कोलाई BL21 (DE3) x pLysS, जो था smc00171 व्यक्त की, bis- पी -nitrophenyl फॉस्फेट एस्टर hydrolyze के लिए उनकी क्षमता के लिए अध्ययन किया गया है, एक spectrophotometric एंजाइमी परख का उपयोग, पी -NP गठन को मापने। कोई hydrolytic गतिविधि से प्राप्त सेल मुक्त अर्क में मौजूद था कोलाई BL21 (DE3) एक्स pLysS एक खाली pET9a वेक्टर शरण (नहीं दिखाया डेटा) जब bis- पी -nitrophenyl फॉस्फेट सब्सट्रेट के रूप में कार्यरत था।

पी -NP गठन के लिए समय पाठ्यक्रम का संकेत सेल मुक्त निकालने की राशि पर एक मजबूत निर्भरता (ई कोलाई BL21 (DE3) से X pLysS, जो एसएम था कि वहाँ हैc00171 व्यक्त) परख (2A चित्रा) को जोड़ा गया। पी -NP उत्पाद की राशि का गठन केवल एंजाइम एकाग्रता पर निर्भर करेगा, तो एंजाइम (प्रोटीन) के बीच एक रैखिक संबंध एकाग्रता कार्यरत हैं और उत्पाद एक निश्चित समय के बाद गठित मनाया जाना चाहिए। जाहिर है, इस से प्राप्त सेल मुक्त अर्क के लिए मामला नहीं है कोलाई BL21 (DE3) x pLysS, जो smc00171 व्यक्त की थी (चित्रा 2 बी)। हालांकि वहाँ प्रोटीन एकाग्रता 21 पर एंजाइम गतिविधि का एक घातीय निर्भरता के लिए कई कारणों से हो सकता है, अक्सर कारण यह है कि एक एंजाइम युक्त प्रोटीन निकालने के कमजोर पड़ने पर, निकालने में अन्य घटक है जो एंजाइम गतिविधि, यानी, संभावित सहकारकों के लिए सीमित किया जा सकता है , के रूप में अच्छी तरह से पतला कर रहे हैं। ऐसे मामलों में, अप्रत्याशित रूप से कम एंजाइम गतिविधियों पतला सेल मुक्त अर्क के साथ पंजीकृत हैं। एंजाइम परख में 3 मिमी की saturating एकाग्रता MnCl 2 सहित करके, पी -NP उत्पाद गठन के बाद एक निश्चित समय केवल एंजाइम की मात्रा पर निर्भर करता है जोड़ा (डेटा नहीं दिखाया गया है) यह दर्शाता है कि MnCl 2 की सेल मुक्त अर्क में SMc00171 गतिविधि के लिए एक सीमित घटक था कोलाई।

चित्र 2
कृत्रिम सब्सट्रेट bis- पी -nitrophenyl फॉस्फेट का उपयोग कर SMc00171 (phospholipase) गतिविधि की चित्रा 2. निर्धारण। पी -NP गठन के लिए समय पाठ्यक्रम रोजगार दिखाया सेल मुक्त प्रोटीन अर्क (10 माइक्रोग्राम / एमएल ●, ■ 15 माइक्रोग्राम / एमएल, ▲ 20 माइक्रोग्राम / एमएल) जिसमें SMc00171 (व्यक्त किया गया था कि एक)। पी -NP अलग सेल मुक्त प्रोटीन के अर्क की जिसमें SMc00171 व्यक्त किया गया था (बी) मात्रा के साथ ऊष्मायन के 40 मिनट के बाद बनाई। त्रुटि सलाखों के मानक विचलन का संकेत मिलता है।.jove.com / फ़ाइलें / ftp_upload / 54613 / 54613fig2large.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

विभिन्न श्रृंखला लंबाई के पी -Nitrophenyl Acyl एस्टर के साथ भविष्यवाणी Patatin-तरह Phospholipases SMc00930 और SMc01003 की क्रियाएँ

में smc00930 या smc01003 की अभिव्यक्ति के बाद कोलाई BL21 (DE3) x pLysS, सेल मुक्त अर्क प्राप्त और पी -nitrophenyl फैटी एसाइल एस्टर hydrolyze के लिए उनकी क्षमता के लिए अध्ययन किया गया। एंजाइमी परख के दौरान, पी -NP का गठन एक स्पेक्ट्रोफोटोमीटर में निर्धारित किया गया था। माइनर hydrolytic गतिविधियों से प्राप्त सेल मुक्त अर्क में उपस्थित थे विभिन्न की कोलाई BL21 (DE3) एक खाली pET17b वेक्टर के साथ एक्स pLysS (तालिका 4) जब पी -nitrophenyl एसाइल एस्टरNT श्रृंखला लंबाई substrates के रूप में कार्यरत थे। जब smc01003 व्यक्त की गई थी, अर्क प्राप्त विभिन्न श्रृंखला लंबाई के पी -nitrophenyl एस्टर का एक बढ़ा हाइड्रोलिसिस दिखाया। SMc01003 मध्यम श्रृंखला पी -nitrophenyl decanoate के साथ ही लंबी श्रृंखला पी -nitrophenyl palmitate और पी -nitrophenyl stearate (तालिका 4) अपमानित। जैसा कि SMc01003 एस में लंबी श्रृंखला मुक्त फैटी एसिड के गठन के लिए एक प्रमुख योगदान है meliloti स्थिर चरण 11 के दौरान, यह आश्चर्य की बात है कि SMc01003 लंबी श्रृंखला पी -nitrophenyl एसाइल एस्टर (तालिका 4) पर की तुलना में मध्यम श्रृंखला पर समान रूप से अच्छी तरह से कार्य करने के लिए लग रहा था। अप्रत्याशित रूप से, SMc01003 भी इस तरह के पी -nitrophenyl butyrate या पी -nitrophenyl octanoate के रूप में लघु श्रृंखला substrates पर कार्य करता है (डेटा) नहीं दिखाया। हालांकि, इन बाद substrates भी की सेल मुक्त अर्क में वर्तमान गतिविधियों से अपमानित कर रहे हैं कोली (यानी, खाली vect शरणया pET17b) किसी भी अतिरिक्त जीन और लघु श्रृंखला substrates के साथ (सी 4) व्यक्त किए बिना, सब्सट्रेट के आधे पहले से ही द्वारा अपमानित किया जाता है कोलाई आंतरिक एंजाइमों (डेटा) नहीं दिखाया। जाहिर है, SMc01003 स्पष्ट है कि SMc01003, लघु मध्यम और लंबी श्रृंखला substrates पर समान रूप से अच्छी तरह से काम करता है क्रम में शुद्ध किया जा करने की जरूरत है। सामान्य में, पी -nitrophenyl एसाइल एस्टर जो जानते हुए भी कि SMc01003 वास्तविकता एक डेग lipase 11 में समझा जा सकता है हो सकता है SMc01003 के लिए अच्छा substrates होने के लिए नहीं लग रहे हैं। सेल मुक्त अर्क, जिसमें smc00930 व्यक्त किया गया था, पी -nitrophenyl एस्टर (तालिका 4) के साथ काफी ज्यादा एंजाइम गतिविधियों दिखा। इसके अलावा, SMc00930, विभिन्न श्रृंखला लंबाई (C10, C12, C14, C16 और C18) के पी -nitrophenyl एसाइल एस्टर hydrolyze करने में सक्षम है, हालांकि पी -nitrophenyl palmitate (विशिष्ट गतिविधि 5.5 mmol एनपी मिनट - 1 मिलीग्राम प्रोटीन - 1) में स्पष्ट रूप से है SMc00930 के लिए सबसे अच्छा सब्सट्रेट। तिथि करने के लिए, physioloSMc00930 के लिए gical सब्सट्रेट ज्ञात नहीं है।

तलाश चाहे ध्रुवीय लिपिड अनुमानित (फास्फो) lipases के लिए substrates के रूप में कार्य कर सकते हैं

एक बार एक (phospho) lipase एंजाइमी परख कृत्रिम substrates, radiolabeled लिपिड मिश्रण या शुद्ध लिपिड के साथ अनुकूलित किया गया है संभावित substrates के रूप में परीक्षण किया जा सकता है।

जब परख करने की क्रिया 14 सी लेबल अनुकूलित शर्तों के तहत पीसी के साथ SMc00171 युक्त सेल मुक्त अर्क, हम दिखा सकता है कि SMc00171 डेग, एक परिणाम है कि बड़े पैमाने पर spectrometric अध्ययनों 8 द्वारा पुष्टि की गई करने के लिए पीसी degrades। SMc00171 भी degrades 32 पी लेबल पीसी phosphocholine करने के लिए और इसलिए एक पीसी-विशिष्ट phospholipase सी (PlcP) 8 के रूप में कार्य करता है, कि विकास की फास्फोरस सीमित शर्तों के तहत प्रेरित है।

कबपरख करने की क्रिया SMc00930- या SMc01003 युक्त अनुकूलित शर्तों के तहत 14 सी या 32 पी लेबल कुल ध्रुवीय लिपिड के साथ सेल मुक्त अर्क, हम दिखा सकता है कि फॉस्फोलिपिड से कोई भी शर्तों जहां पी -nitrophenyl एसाइल एस्टर कार्य के तहत SMc00930 या SMc01003 द्वारा अपमानित किया जाता है के रूप में substrates 11। इसके विपरीत, एक वाणिज्यिक phospholipase एक 2 सांप के जहर से फॉस्फोलिपिड 11 के इस तरह के एक मिश्रण नीचा करने में सक्षम था। इन परिणामों के आश्चर्य की बात है और दोनों के रूप में अप्रत्याशित थे, SMc00930 और SMc01003, patatin-तरह बनने की phospholipases भविष्यवाणी की थी।

जब SMc00930- या SMc01003 युक्त अनुकूलित शर्तों के तहत 14 सी लेबल diacylglycerol (डेग) के साथ सेल मुक्त अर्क, हम दिखा सकता है कि डेग SMc00930 द्वारा या की सेल मुक्त अर्क द्वारा अपमानित नहीं है परख करने की क्रिया कोलाई, जबकि SMc01003 डेग degrades और यौगिकों कि तरह मुक्त फैटी एसिड की ओर पलायन रूपों (चित्रा 3)। हाल ही में हम दिखा सकता है कि SMc01003 एक डेग lipase कि डेग नीचा या ग्लिसरॉल और मुक्त फैटी एसिड 11 (चित्रा 4) को monoacylglycerol कर सकते हैं के रूप में कार्य करता है।

चित्र तीन
चित्रा 3. SMc01003 diacylglycerol degrades। की सेल मुक्त अर्क कोलाई BL21 (DE3) × pLysS SMc01003, SMc00930 व्यक्त या खाली pET17b वेक्टर युक्त, या बफर 24 घंटे के लिए 14 सी-डेग (एस meliloti से प्राप्त) के साथ incubated रहे थे। संबंधित ऊष्मायन अवधि के अंत में, radiolabeled लिपिड निकाले और तटस्थ ध्रुवीय लिपिड को अलग करने के लिए मोबाइल चरण (4.3.2 देखें) का उपयोग -1 डी-टीएलसी से अलग हो गए थे। एफए, फैटी एसिड होता है; डेग, diacylglycerol। यह आंकड़ा [Sahonero-Canavesi एट अल। 2015] 11 से संशोधित किया गया है।3large.jpg "लक्ष्य =" _blank "> यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. एंजाइमी diacylglycerol lipase DGLA (SMc01003) का कार्य करते हैं। Diacylglycerol (डेग) lipase SMc01003 monoacylglycerol और एक फैटी एसिड के लिए डेग degrades, और फिर monoacylglycerol ग्लिसरॉल और एक अन्य फैटी एसिड के लिए आगे degrades। इस का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें चित्रा।

oligonucleotide
नाम
अनुक्रम
(5'-3 ')
जीन
ब्याज की
एनजाइम प्रतिबंध
साइट जोड़ा
वेक्टर
अभिव्यक्ति के लिए
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 NDE मैं pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho मैं pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 NDE मैं pET17b
oLOP152 एएए GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam HI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 NDE मैं pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam HI pET9a
बोल्ड में पत्र प्रतिबंध साइटों से संकेत मिलता है।

तालिका 1 बढ़ाना और क्लोन करने के लिए इस्तेमाल ओलईगोन्युक्लियोटाईड्स phospho (lipase) pET17b या pET9a वेक्टर में जीन की भविष्यवाणी की। प्राइमर ओलईगोन्युक्लियोटाईड्स वर्णित सॉफ्टवेयर 15 का उपयोग कर बनाया गया था।

SMc00171 के लिए परख SMc01003 के लिए परख SMc00930 के लिए परख
भण्डार अंग
Tris एचसीएल, पीएच 8.5 25 μl
2 एम Tris एचसीएल, पीएच 9.0 25 μl
1 एम Diethanolamine एचसीएल, पीएच 9.8 50 μl
1 एम NaCl 40 μl 150 μl 150 μl
1% ट्राइटन X-100 200 μl 200 μl
50 मिमी पी nitrophenyl palmitate 12.5 μl 12.5 μl
200 मिमी bis- पी nitrophenyl फॉस्फेट 2.5 μl
सेल मुक्त निकालने (1 मिलीग्राम protein / एमएल) के उम्मीदवार जीन के साथ व्यक्त किया 20 μl 100 μl 1 μl
bidistilled पानी 887.5 μl 512.5 μl 611.5 μl
अंतिम वॉल्यूम 1 मिलीलीटर 1 मिलीलीटर 1 मिलीलीटर

कृत्रिम पी -nitrophenyl एस्टर substrates के साथ अनुकूलित एंजाइम assays के लिए तालिका 2 Pipetting योजनाओं।

Smc00171 -encoded phospholipase सी के लिए परख Smc01003 के लिए परख - इनकोडिंग डेग lipase Phospholipase एक गतिविधि के लिए अनुकूलित परख
भण्डार अंग
2 एम Tris एचसीएल पीएच 8.5 2.5 μl
2 एम Tris एचसीएल पीएच 9.0 2.5 μl
100 मिमी MnCl 2 3 μl
1 एम Diethanolamine एचसीएल पीएच 9.8 5 μl
1 एम NaCl 4 μl 15 μl 15 μl
1% ट्राइटन X-100 2 μl 20 μl 20 μl 14 सी लेबल लिपिड (फॉस्फोलिपिड) 20 μl (5,000 सीपीएम)
14 सी लेबल लिपिड (पीसी) 20 μl (5,000 सीपीएम)
14 सी लेबल लिपिड (डेग) 20 μl (5,000 सीपीएम)
10 मिलीग्राम / एमएल व्यक्त उम्मीदवार जीन के साथ प्रोटीन निकालने 0.5 μl 5 μl 5 μl
bidistilled पानी 87.5 μl 77.5 μl 77.5 μl
अंतिम मात्रा 100 μl 100 μl 100 μl

तालिकाके लिए अनुकूलित एंजाइम assays (phospho) के लिए 3. Pipetting योजनाओं radiolabeled लिपिड substrates के साथ lipases।

गतिविधि (μmol nitrophenol / मिलीग्राम प्रोटीन एक्स मिनट) इकाइयों में दी गई है
बोल्ड संख्या से संकेत मिलता है पी -nitrophenyl एस्टर सब्सट्रेट के एसाइल श्रृंखला लंबाई 10 12 14 16 18
ई कोलाई निकालने (पृष्ठभूमि) 16 ± 0.3 10 ± 1.1 13 ± 0.3 11 ± 0.8 10 ± 0.6
SMc00930 में व्यक्त किया कोलाई निकालने 1,839 ± 283 2,873 ± 117 5,517 ± 394 3,402 ± 65
SMc01003 में व्यक्त किया कोलाई निकालने 43 ± 2.1 29 ± 2 20 ± 0.7 25 ± 1.5 22 ± 0.9
SMc00930 शून्य पृष्ठभूमि 1,823 ± 283 1,829 ± 283 2,860 ± 117 5506 ± 394 3,392 ± 65
SMc01003 शून्य पृष्ठभूमि 27 ± 2.1 18 ± 2 7 ± 0.7 14 ± 1.5 12 ± 0.9

के लिए patatin-तरह lipases SMc00930 और SMc01003 substrates के रूप में तालिका 4. पी -Nitrophenyl एसाइल एस्टर।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

पिछले 20 वर्षों में, कई जीवों के जीनोम अनुक्रम निर्धारण किया गया है और हालांकि जीनोम अनुक्रम डेटा का धन उत्पन्न किया गया है, कार्यात्मक व्याख्या पिछड़ रहा है और इसलिए जीनोम समारोह के बारे में हमारी समझ को बाधित। जीनोम में जीन कार्यों अक्सर जाना जाता समारोह या संरक्षित रूपांकनों की घटना के जीन को समानता के आधार पर आवंटित कर रहे हैं। हालांकि, किसी जीन की सटीक समारोह अक्सर ज्ञात नहीं है। विशेष रूप से, भविष्यवाणी की एंजाइमों के लिए संरचनात्मक जीन आसानी से तथ्य यह है कि सबसे जटिल एंजाइमों दो substrates और दो उत्पादों को शामिल प्रतिक्रियाओं को उत्प्रेरित करने के लिए कारण omic तकनीक से पता लगाया जा सकता है। वर्तमान में, यह जहां कम से कम एक सब्सट्रेट तय हो गई है और जहां अन्य अलग किया जा सकता एंजाइमों के समूहों के लिए सब्सट्रेट specificities पता लगाने के लिए और अधिक व्यावहारिक लगता है। उदाहरण के लिए, eukaryotes में प्रोटीन में सबसे फोस्फोराइलेशन रूपांकनों जाना जाता है और kinases के लिए आम सहमति पेप्टाइड्स ठोस समर्थन करता है पर आदेश पेप्टाइड की गिरफ्तारी को उत्पन्न करने में देखा गया है कर रहे हैंकिरणों। ऐसे सरणियों और radiolabeled एटीपी, सब्सट्रेट specificities और एक जीव के विशिष्ट kinases की गतिविधि का स्तर एक kinome प्रोफ़ाइल की स्थापना की अनुमति देने निर्धारित किया जा सकता का उपयोग करना और सब्सट्रेट को परिभाषित 24 specificities। हाइड्रोलिसिस एंजाइमों का एक और बड़ा समूह है, जिसके लिए एक सब्सट्रेट, पानी, ठीक हो गई है लेकिन जिसके लिए (अन्य) सब्सट्रेट की सटीक प्रकृति hydrolyzed जा करने के लिए अक्सर ज्ञात नहीं है रचना करते हैं। तथ्य यह है कि एक नए एंजाइम के लिए इष्टतम परख की स्थिति तो नहीं जाना जाता है, एक बहु-चर समस्या में एक नए एंजाइम गतिविधि का पता लगाने के धर्मान्तरित। इसलिए यह आदेश जो एंजाइम की शर्तों के तहत सबसे अच्छा काम करता परिभाषित करने के लिए hydrolyzed जा करने के लिए सब्सट्रेट ठीक करने में सक्षम होना करने के लिए मदद मिल सकती है।

वर्तमान पांडुलिपि में, हम भावी (phospho) के लिए परख की स्थिति के अनुकूलन का वर्णन अज्ञात सब्सट्रेट specificities के साथ lipases और कैसे फिर से प्राकृतिक सब्सट्रेट के लिए खोज में इन अनुकूलित शर्तों को रोजगार के लिए विस्तृतspective (phospho) lipase। वर्तमान तकनीक का महत्व इस तथ्य में होते हैं कि fluorogenic या chromogenic, कृत्रिम substrates, कि कुछ हद तक प्राकृतिक substrates की नकल की hydrolysis, spectrophotometry 25 के द्वारा पीछा किया जा सकता है और है कि इन assays बड़े पैमाने पर करने के लिए आसानी से लागू कर रहे हैं अध्ययन 26। इस तरह के परीक्षणों की संवेदनशीलता और प्रतिक्रिया की निगरानी के लिए उनकी सादगी के कारण, वे आसानी से एक दिया एंजाइम के लिए अनुकूलित किया जा सकता। जाहिर है, कृत्रिम substrates के लिए एक कम अनुकूल गतिज स्थिरांक उम्मीद कर सकते हैं (यानी, उच्च कश्मीर एम, कम कश्मीर कैट) प्राकृतिक substrates 1,21 लिए की तुलना में एक विशेष एंजाइम के लिए। व्यवहार में, हालांकि, सतही उपलब्धता और कृत्रिम substrates के detectability के रूप में (बुरा) अक्सर अधिक से अधिक नुकसान की भरपाई एंजाइमों के पूरे समूह के लिए substrates कार्य। एक बार (कृत्रिम सब्सट्रेट के साथ) के लिए काम करने के लिए एक एंजाइम के लिए परिस्थितियों का सामना करना पड़ा रहा है, यह प्रकृति के साथ ऐसा करेंगेअल / शारीरिक रूप में अच्छी तरह से सब्सट्रेट। तैयारी और संभावित लिपिड substrates के अलगाव श्रमसाध्य और समय लेने वाली हो सकते हैं, यह आश्वासन दिया है कि एक एंजाइम जब संयोजन और मूल्यवान substrates के साथ यह incubating काम करने के लिए तैयार है के लिए महत्वपूर्ण है। महत्वपूर्ण बात है, पहले एक एंजाइम काम करने के लिए शर्तों के अनुकूलन की प्रक्रिया, एक नया (phospho) lipase के लिए शारीरिक सब्सट्रेट का एक और अधिक तेजी से पहचान की अनुमति होगी। अवधारणा के एक सबूत के रूप में, हम सफलतापूर्वक lipases SMc00171, SMc00930, और SMc01003 8,11 के सब्सट्रेट specificities के लक्षण वर्णन के लिए इस विधि कार्यरत है। इसके विपरीत, कई पारंपरिक, वैकल्पिक (phospho) lipase गतिविधियों के लिए assays की स्थापना के तरीकों प्रतिक्रियाओं जहां सब्सट्रेट और उत्पाद पहले से जाना जाता है को शामिल करना।

जाहिर है, assays के संशोधनों इष्टतम एंजाइम गतिविधि का पता लगाने, बदलाव, chromogenic, या अन्यथा कृत्रिम substrates चिह्नित अन्य fluorogenic के उपयोग के शामिल कर सकते हैंएंजाइम एकाग्रता, प्रकार और buffers की एकाग्रता, या अन्य additives (यानी, डिटर्जेंट या द्विसंयोजक फैटायनों) के। कोई एंजाइम गतिविधि कृत्रिम substrates के साथ पाया जाता है तो संबंधित एंजाइम बस इस सब्सट्रेट के साथ काम नहीं कर सकता, लेकिन इस तरह के मामलों में समस्या निवारण निश्चित रूप से आश्वासन दिया है कि सभी सावधानियों लिया गया था आवश्यक किया गया है हो सकता है कि राशि के लिए एंजाइम गतिविधि बरकरार बनाए रखने के लिए शामिल करना चाहिए 27 (यानी, 4 डिग्री सेल्सियस पर सेल मुक्त अर्क या उपयोग करें जब तक कम तापमान और भंडारण, अगर जरूरत है, क्रम में सेल मुक्त अर्क के लिए प्रोटीज अवरोधकों का कॉकटेल जोड़ने के हित के एंजाइम की प्रोटिओलिटिक गिरावट से बचने के लिए)।

इस पांडुलिपि में प्रस्तुत तकनीक की सीमाएं तथ्य यह है कि कृत्रिम सब्सट्रेट और प्राकृतिक सब्सट्रेट एक-दूसरे से बायोइनरजेटिक्स और परिणाम में अलग करने के लिए उत्प्रेरित प्रतिक्रिया के रूप में अच्छी तरह से 1 हो जाएगा के कारण हैं। विभिन्न सममूल्यएंजाइम गतिविधि का इष्टतम स्थितियों के लिए ameters प्राकृतिक सब्सट्रेट के लिए भी स्थापित किया जाना चाहिए (पीएच बदलती बफर के प्रकार के अनुसार, शक्ति बफर, ऐसे ट्राइटन X-100, अभाव या अलग द्विसंयोजक फैटायनों की उपस्थिति के रूप में सोडियम क्लोराइड और डिटर्जेंट की सांद्रता), के रूप में वे बाहर बारी के लिए कृत्रिम सब्सट्रेट के लिए इष्टतम स्थितियों का सामना करना पड़ा से थोड़ा अलग हो सकता है। एक अन्य महत्वपूर्ण सीमा यह है कि शायद नहीं सभी (phospho) lipases कृत्रिम chromogenic substrates के उपयोग के द्वारा पहचाने जा रहे हैं। उदाहरण के लिए, एस्टर substrates के कृत्रिम पी -nitrophenyl अवशेषों बस भी भारी हो सकता है, या अन्य रासायनिक गुण है कि रोकने कि इस तरह के एक सब्सट्रेट एक एंजाइम के सक्रिय साइट के लिए उपयोग हो सकता है प्रदर्शन कर सकता है। यह पाया गया कि डेग lipase SMc01003 अलग श्रृंखला लंबाई 11 के सभी पी -nitrophenyl एस्टर substrates के साथ कम गतिविधियों का प्रदर्शन किया। ज्ञान है कि डेग SMc01003 के लिए और कहा कि प्राकृतिक सब्सट्रेट है साथ डेग एक रिलायंस एनर्जी हैatively छोटे ध्रुवीय सिर समूह, ग्लिसरॉल से मिलकर केवल 11 है, यह आसानी से कल्पना है कि भारी पी -nitrophenyl अवशेषों बस SMc01003 के सक्रिय साइट के लिए एक आसान पहुँच के लिए बहुत बड़ा है। हालांकि, SMc01003 के लिए आणविक ब्यौरा क्यों पी -nitrophenyl एस्टर अच्छा substrates नहीं हैं इस बिंदु पर नहीं जाना जाता है।

प्रोटोकॉल के भीतर महत्वपूर्ण कदम सुनिश्चित करने के लिए एंजाइम का अध्ययन संबंधित सब्सट्रेट करने के लिए उपयोग किया है कि लिया सभी प्रावधानों में शामिल हैं। उदाहरण के लिए, शारीरिक लिपिड सब्सट्रेट के लिए खोज में, यह महत्वपूर्ण है कि लिपिड सब्सट्रेट एक solubilized रूप में प्रदान की जाती है। इसलिए, जब इस तरह के एंजाइम assays की स्थापना (प्रोटोकॉल का 5 में वर्णित), lipídic substrates, आमतौर पर की मेथनॉल मिश्रण में भंग: क्लोरोफॉर्म, एक साबुन का एक पानी का समाधान, यानी साथ मिलाया जाना चाहिए, ट्राइटन X-100, पहले नीचे सुखाने नाइट्रोजन गैस के साथ मिश्रण। यह प्रक्रिया सुनिश्चित करता है कि, शेष ingre जोड़ने के बादपरख के लिए dients, संभावित लिपिड सब्सट्रेट डिटर्जेंट micelles में और परख के दौरान एंजाइम के लिए इस तरह के रूप में सुलभ एम्बेडेड है।

मुख्यतः, यहाँ प्रस्तुत तकनीक नया (phospho) lipases की खोज के लिए और उनके प्राकृतिक substrates की परिभाषा के लिए भविष्य में व्यापक रूप से लागू किया जाना चाहिए। तकनीक हाइड्रोलिसिस के अन्य वर्गों के लिए आसानी से बढ़ाया जा सकता है, लेकिन यह अधिक नए एंजाइमों कि दो, आमतौर पर अज्ञात, substrates उनकी उत्प्रेरक चक्र पूरा करने के लिए की आवश्यकता के लिए कृत्रिम substrates के साथ assays विकसित करने के लिए जटिल हो सकता है।

भविष्यवाणी (phospho) lipases या फास्फेटेजों न सही सब्सट्रेट में जाना जाता है और न ही परख की स्थिति में जो एंजाइम अच्छी तरह से काम करता है। इसलिए, यह अध्ययन करने के लिए उपयोगी हो सकता है कि क्या इस तरह अलग पी -nitrophenyl युक्त यौगिकों (पी -nitrophenyl फॉस्फेट, bis- पी -nitrophenyl फॉस्फेट के रूप में कृत्रिम यौगिकों की एक बैटरी से कुछ यौगिक, पी -nitrophenyl palmitate), सब्सट्रेट के रूप में कार्य कर सकता है। कृत्रिम substrates के साथ प्रारंभिक एंजाइम गतिविधियों की खोज हल करने के लिए है कि SMc00171 एक पीसी विशिष्ट phospholipase सी 8 मार्ग प्रशस्त किया है, कि SMc01003 एक डेग lipase 11 है, और जिन स्थितियों SMc00930 एक hydrolase 11 के रूप में कार्य को परिभाषित करने में मदद की। जाहिर है, SMc00930 के प्राकृतिक सब्सट्रेट वर्तमान में अभी भी अज्ञात है और SMc00930 और SMc01003 के शारीरिक संदर्भों अभी भी हल किया जाना है। इसलिए, एक भविष्यवाणी की lipase के लिए एक शारीरिक समारोह का प्रस्ताव करने का कार्य चुनौतीपूर्ण है और नहीं हमेशा तुरंत सफलता के साथ मुलाकात की। भविष्यवाणी की lipase जीन की कमी म्यूटेंट का प्रयोग और उन्हें संबंधित जंगली प्रकार तनाव की तुलना में प्रयोगात्मक सबूत है कि lipase अपने मूल तनाव की पृष्ठभूमि में विशिष्टता है कि प्रोटोकॉल के भाग 4) में माने किया गया है के साथ काम करता है दे सकता है। जाहिर है, एक नया lipase गतिविधि श के दावेइन विट्रो सबूत है कि एक निश्चित सब्सट्रेट परिभाषित उत्पादों में हाइड्रोलिसिस द्वारा परिवर्तित किया जाता है द्वारा समर्थित हो ould। कभी कभी माने शारीरिक समारोह चयापचय मार्ग में अंतराल को भरने सकता है या उत्पादन जीव के शारीरिक व्यवहार की व्याख्या है, लेकिन अन्य मामलों में वहाँ बस अभी भी कुछ गतिविधियों की भावना बनाने के लिए पर्याप्त जैव रासायनिक ज्ञान नहीं हो सकता है। हमारे अध्ययन के पाठ्यक्रम में, हम कई एंजाइमों कि उन्हें अपमानजनक बैक्टीरिया की आंतरिक ध्रुवीय झिल्ली लिपिड पर कार्रवाई की पहचान की और, कुछ मामलों में, उन्हें और अधिक जटिल लिपिड चक्रों में एक खिलाड़ी के रूप में परिवर्तित। उदाहरण के लिए, नए ज्ञान के संयोजन कि SMc00171 एक पीसी विशिष्ट phospholipase सी (PlcP) 8 कि पहले से मौजूद डेटा के साथ विकास की फास्फोरस सीमित शर्तों के तहत प्रेरित है, है, एक एक उपन्यास डेग चक्र है कि कई पर्यावरण proteobacteria में मौजूद हो सकता है मांगना और कर सकते हैं जो फास्फोरस मुक्त झिल्ली लिपिड के गठन को जन्म देता है जब फास्फोरस विकास सीमित है। contr मेंएएसटी, जब फास्फोरस की आपूर्ति प्रचुर मात्रा में हैं, डेग phosphatidic एसिड नए सिरे से फॉस्फोलिपिड biosynthesis में प्रवेश, जिससे इस लिपिड चक्र बंद करने और यह सुनिश्चित करना है कि मुख्य रूप से (glycero) फॉस्फोलिपिड झिल्ली 8,28 में मौजूद हैं rephosphorylated है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों के पास खुलासे के लिए कुछ भी नहीं है।

Acknowledgments

यह काम (Investigación एन Fronteras डे ला Ciencia में Investigación Científica Basica में 82614, 153998, 253549, और 178,359 के साथ ही 118) और Dirección जनरल डी से Consejo Nacional de Ciencias y Tecnología-मेक्सिको (CONACYT-मैक्सिको) से अनुदान द्वारा समर्थित किया गया Asuntos डी व्यक्तिगत Académico-Universidad Nacional ऑटोनोमा डी मेक्सिको (DGAPA-UNAM; PAPIIT IN202616, IN203612)।

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
Lipase और phospholipase उम्मीदवारों के लिए सब्सट्रेट specificities की परिभाषा
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter