Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

La definizione del substrato Specificità per lipasi e fosfolipasi candidati

doi: 10.3791/54613 Published: November 23, 2016

Abstract

I microrganismi producono un ampio spettro di lipasi (fosfo) che vengono secreti per rendere substrati esterni disponibili per l'organismo. In alternativa, altri (fosfo) lipasi possono essere fisicamente associate con l'organismo producendo causando un turnover di lipidi intrinseche e spesso dando origine ad un rimodellamento delle membrane cellulari. Sebbene potenziali (fosfo) lipasi possono essere previsti con un certo numero di algoritmi quando la sequenza del gene / proteina è disponibile, prova sperimentale delle attività enzimatiche, specificità di substrato e potenziali funzioni fisiologiche è spesso non è stata ottenuta. Questo manoscritto descrive l'ottimizzazione delle condizioni di analisi per i potenziali (fosfo) lipasi con specificità di substrato sconosciute e come impiegare queste condizioni ottimali nella ricerca per il substrato naturale di un rispettivo (fosfo) lipasi. Usando substrati cromogeni artificiali, come i derivati p -nitrophenyl, può aiutare a rilevare un minoreattività enzimatica per un (fosfo) lipasi previsto in condizioni standard. Avendo riscontrato un attività enzimatica tale minore, i parametri distinti di un saggio enzimatico possono essere variate per ottenere un'idrolisi più efficiente del substrato artificiale. Dopo aver determinato le condizioni in cui un enzima funziona bene, una varietà di potenziali substrati naturali devono essere analizzati per la loro degradazione, un processo che può essere seguita con metodi cromatografici distinti. La definizione di specificità di substrato per nuovi enzimi, fornisce spesso ipotesi per un potenziale ruolo fisiologico di questi enzimi, che poi possono essere testati sperimentalmente. Seguendo queste linee guida, siamo stati in grado di identificare una fosfolipasi C (SMc00171) che degrada fosfatidilcolina di phosphocholine e diacylglycerol, in una fase cruciale per il rimodellamento delle membrane nel batterio Sinorhizobium meliloti dalle condizioni di fosforo-limitante della crescita. Per due predetto patatin-come fosfolipasi (SMc00930 e SMc01003) dello stesso organismo, potremmo ridefinire le loro specificità di substrato e chiarire che SMc01003 è una lipasi diacilglicerolo.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Lipidi glicerolo-based come trigliceridi e fosfolipidi (glycero) costituiscono importanti e probabilmente il più noti classi di lipidi 1. Trigliceridi (tag) sono grassi o oli, che di solito fungono da lipidi di stoccaggio, e quindi come potenziali fonti di energia e di carbonio. TAG possono essere degradati dalla lipasi, che sono spesso secrete dall'organismo produzione di digerire variabili esterne e renderli disponibili come fonti di carbonio. Inoltre, lipasi sono stati ampiamente studiati negli anni, grazie alle loro importanti applicazioni biotecnologiche 2.

A causa della loro natura anfifilica e la loro forma quasi cilindrica, proprietà di membrana formante (glycero) fosfolipidi esporre e generalmente costituiscono i principali componenti lipidici di membrana doppo strato 3. In microrganismi semplici, come il batterio Escherichia coli, solo tre varianti principali del gruppo testa, fosfatidilglicerolo (PG), cardiolipina (CL), e phosphatidylethanolamine (PE) è riscontrabile, anche se si deve essere consapevoli che ciascuno di essi può essere sostituito con un considerevole numero di differenti catene grassi acil al sn -1 o sn posizione -2 dando luogo ad un grande numero di differenti specie molecolari 4 . Altri batteri possono avere altri fosfolipidi in aggiunta o al posto. Ad esempio, Sinorhizobium meliloti, un batterio del suolo, che è in grado di formare una radice nodulo simbiosi azotofissatrice con l'erba medica legume (Medicago sativa), contiene in aggiunta al PE un secondo fosfolipide zwitterionico, fosfatidilcolina (PC) 5. Inoltre, i lipidi non contenenti fosforo o glicerolo potrebbe essere parte anfifilico e la forma della membrana cellulare. Ad esempio, dalle condizioni di crescita fosforo limitativo, in S. meliloti, (glycero) fosfolipidi sono in gran parte sostituiti da lipidi di membrana che non contengono fosforo, cioè, sulfolipids, lipidi ornitina, e diacylglyceryl trimethylhomoserine (DGTS) 6. Nei batteri, DGTS è formata da diacilglicerolo (DAG) in un percorso in due fasi 7, ma la fonte per la generazione di DAG non era chiaro. Esperimenti di pulse-chase suggerito che il PC potrebbe essere un precursore per DGTS 8 e utilizzando la metodologia descritta in questo manoscritto abbiamo potuto identificare un fosfolipasi C (PLCP, SMc00171) che si forma in condizioni di fosforo-limitante e che può convertire il PC in DAG e phosphocholine 8.

In uno studio separato, abbiamo scoperto che un sintetasi acil-CoA (FADD) mutante -carente di S. meliloti o di Escherichia coli accumulato acidi grassi liberi entrando fase stazionaria della crescita 9. Sebbene questi acidi grassi sembravano essere derivato da lipidi di membrana, la fonte precisa per gli acidi grassi liberi o l'enzima (s) liberandoli non erano noti. Anche in questo caso, utilizzando la strategia delineata in questo manoscritto, due 10 (fosfo) lipasi Patatin-like (SMc00930 e SMc01003), che ha contribuito alla formazione di acidi grassi liberi a S. meliloti 11 sono stati previsti. Sorprendentemente, SMc01003 utilizzato DAG come substrato convertirlo monoacilglicerolo e infine glicerolo e acidi grassi liberi 11. Pertanto, SMc01003 è una lipasi DAG (DGLA).

Sebbene un certo numero di algoritmi esistenti per prevedere il potenziale (fosfo) lipasi 12,13, la loro funzione precisa e ruolo fisiologico non è generalmente noto. Qui descriviamo un protocollo, per clonare e iperespressione di lipasi (fosfo) previsti o potenziali. Questo manoscritto spiega come saggi enzimatici possono essere sviluppati e ottimizzati per la (fosfo) lipasi sovraespresso utilizzando substrati cromogeni artificiali. Forniamo esempi di come con un metodo enzimatico ottimizzato il vero (fosfo) substrato lipasi può essere incontrato e di come queste scoperte potrebbero arricchire la nostra comprensione della fisiologia microbica.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Clone e iperespressione del gene strutturale per lipasi prevista

  1. Utilizzando la reazione a catena della polimerasi (PCR) 14 e oligonucleotidi specifici (Tabella 1) 15, amplificare il gene di interesse (smc01003, smc00930 o smc00171), previsto per codificare per una lipasi o fosfolipasi, dal DNA genomico dell'organismo ospite (ie , S. meliloti).
    1. Introdurre siti specifici di restrizione (con la sequenza creazione degli oligonucleotidi). Digerire il frammento di DNA amplificato con gli enzimi di restrizione corrispondenti e clonare in un vettore di espressione, come plasmidi della serie pET 16.
    2. Dopo aver verificato la sequenza di DNA corretta per il gene clonato, trasformare il vettore ad un ceppo espressioni quali Escherichia coli BL21 (DE3) pLysS 16.
  2. Preparare una notte pre-cultura dell'espressione ospite E. coli BL21 (DE3) pLYSS, l'ospitare il rispettivo vettore animale domestico con il gene clonato o il vettore vuoto, in 100 ml fiasche di coltura contenente 20 ml di Luria Bertani brodo (LB) 17, più gli antibiotici necessari. Cultura le cellule a 30 ° C (o alla solita temperatura di crescita del batterio da cui la lipasi origine).
    1. Usando i overnight pre-culture, inoculare 500 ml di terreno LB preriscaldata (più antibiotici richiesti) in 2 fiasche di coltura L per ottenere una densità ottica iniziale a 620 nm (OD 620) = 0,05. Seguire crescita di colture e ad una OD 620 = 0.3, aggiungere isopropil-β-D-tiogalattoside (IPTG) ad una concentrazione finale di 100 mM, e incubare sotto agitazione a 30 ° C per un periodo di 4 ore.
    2. Al termine del periodo di incubazione, trasferire ogni cultura in una provetta da centrifuga da 500 ml e centrifugare a 5000 xga 4 ° C per 30 min. Risospendere pellet cellulari batteriche in 5 ml di tampone di sospensione (ad esempio, SMc00930- e SMc01003-cellule che esprimono in 50 mM Tris-HCl pH 8.0 e le cellule che esprimono SMc00171-in 50 mm dietanolammina-HCl pH 9.8). Conservare le sospensioni cellulari a -80 ° C fino al momento dell'uso.

2. Preparare estratti proteici privi di cellule e determinare proteine ​​Concentrazione

  1. Scongelare sospensioni cellulari batteriche e memorizzare sul ghiaccio. Passare sospensioni cellulari tre volte attraverso una cella di pressione a freddo a 20.000 libbre per a 2. Rimuovere le cellule intatte e detriti cellulari mediante centrifugazione a 5000 xg per 30 min a 4 ° C.
  2. Dopo centrifugazione, preparare aliquote di 100 e 500 microlitri dal supernatante per la successiva analisi e conservarli a -80 ° C fino al momento dell'uso.
  3. Utilizzare una delle un'aliquota di 100 microlitri per determinare la concentrazione di proteine di estratti privi di cellule distinte da un metodo di scelta o come descritto 18.

3. Utilizzare substrati artificiali per l'ottimizzazione EnzymeAttività di (fosfo) lipasi

  1. Per una copertura iniziale delle attività enzimatiche distinte, utilizzare substrati artificiali che producono un prodotto colorato per idrolisi, come p -nitrophenol (p -NP).
    1. Per i saggi enzimatici ottimizzati già con substrati p -nitrophenyl esteri artificiali (delineate per fosfolipasi C PLCP (SMc00171), così come per le fosfolipasi Patatin come previsti SMc00930 e SMc01003), schemi di pipettaggio indicata nella tabella 2.
    2. Quando esplorando un nuovo potenziale (fosfo) lipasi, preparare un primo dosaggio enzimatico standard contenente 50 mM Tris-HCl, pH 8,5, 100 mM NaCl, 0,05% Triton X-100, 0,5 mM p -nitrophenyl composto contenente (p -nitrophenyl fosfato , bis- p -nitrophenyl fosfato, p -nitrophenyl decanoato, o p -nitrophenyl palmitato), ed estratto proteico cell-free (controllo 1, 3, 10, 30, 100, 300, e 1000 mg) in un volume totale di 1 ml in 1 ml cuve plasticaTTES.
      NOTA: Utilizzare pH alcalino (figura 1) quando segue p -nitrophenyl idrolisi in un saggio continuo. In alternativa, utilizzare dosaggi singoli time-point per un intervallo di valori di pH, aggiungendo NaOH al termine del periodo di incubazione per bloccare la reazione enzimatica e per garantire che tutti p -NP è presente nella forma fenolato.
    3. Seguire l'andamento temporale di un aumento di assorbanza a 405 nm, a causa della formazione di p -NP, in uno spettrofotometro a 30 ° C per un periodo di 5 min. Quantificare la formazione inizialmente lineare di p -NP determinando la pendenza iniziale di aumento di assorbanza per volta.
    4. Calcolare la variazione di concentrazione (Δc) per p -NP utilizzando la legge di Lambert-Beer (ΔA = ε Δc d) 1.
      NOTA: ΔA è la variazione lineare di assorbanza determinato, ε è il coefficiente di estinzione molare alla rispettiva lunghezza d'onda (in unità di M -1 -1), d è la lunghezza del percorso ottico (1 cm), e Δc è il cambiamento di concentrazione (in unità di M) da determinare.
      1. Considerando che il volume di dosaggio è di 1 ml, calcolare la quantità di p -NP formata.
        NOTA: Importo = concentrazione volumetrica x.
      2. Calcolare l'attività enzimatica dividendo la quantità di p -NP formata dal momento in cui è formato. Determinare l'attività enzimatica specifica dividendo attività enzimatica dalla quantità di proteine ​​(in mg) che era responsabile della generazione questa attività.
    5. Confronta i cambiamenti di assorbanza provocate da estratti proteici in cui un gene candidato (smc00171, smc00930, o smc01003) era stato espresso con estratti che ospitano solo un vettore vuoto.
      NOTA: Per continuare con le seguenti operazioni, le attività specifiche, causate da estratti proteici in cui un gene candidato era stato espresso, dovrebbe essere almeno il doppio o more rispetto ai valori ottenuti per le attività specifiche causate da estratti proteici che ospitano solo un vettore vuoto.
    6. Per ulteriori esperimenti, seleziona quelle condizioni in cui l'idrolisi del composto p -nitrophenyl contenente è minimo con estratti privi di cellule (cioè, vettore vuoto) e per i quali la formazione più pronunciata p -NP e l'anione p -nitrophenolate (Figura 1) possono essere osservati quando estratti proteici sono impiegati, in cui un gene candidato era stato espresso.
  2. Dopo la determinazione della attività enzimatica iniziale 3.1, ottimizzare le condizioni di analisi per il rispettivo enzima variando pH, tipo di tampone, tampone forza, concentrazioni di NaCl, detergenti come Triton X-100, e l'assenza o la presenza di diversi cationi bivalenti.
    1. Per diverse concentrazioni di ciascuna variabile, a determinare l'attività enzimatica specifica (vedi 3.1.4.2) (il numero più alto ottenuto definisce la condizionedell'attività enzimatica massima). Utilizzare la combinazione delle condizioni ottimali riscontrate per ciascuna variabile per definire un saggio enzimatico ottimizzato in cui ciascuna variabile è presente nella sua concentrazione ottimale.

Figura 1
Figura esteri -Nitrophenyl 1. p substrati artificiali per (fosfo) lipasi in un saggio spettrofotometrico. Su idrolisi degli esteri p -nitrophenyl, un acido (R-OH) e p -nitrophenol (p -NP) si formano. Grazie al pK a = 7,2 per la dissociazione del fenolica H + da p -NP, a pH> 9,2 oltre il 99% sono nella luminosa forma p -nitrophenolate giallo e un coefficiente di estinzione molare di 18.000 M -1 cm - 1 può essere utilizzato ad una lunghezza d'onda di 405 nm per la quantificazione del libero p -nitrophenolate 22. Quando sono stati utilizzati i buffer con un pH di 8,5, l'assorbanza è stata determinata a 400 nm e un coefficiente di estinzione molare di 14.500 M -1 cm -1 è stato impiegato 23. Si prega di cliccare qui per vedere una versione più grande di questa figura.

NOTA: Dopo aver definito le condizioni ottimali per l'attività dell'enzima di interesse, intraprendere la ricerca del reale / fisiologica substrato di questo lipasi. In linea di principio, prendere due, spesso complementari, approcci per raggiungere questo obiettivo, un vivo approccio o un approccio in vitro.

4. In Vivo Identificazione della fisiologica Substrato di un Lipasi

ove_content ">. NOTA: In un approccio in vivo, esprimono la lipasi di interesse in un organismo ospite 8,11 al fine di registrare nel corso del tempo se l'espressione della lipasi altera il profilo lipidico host's In un altro approccio in vivo, generare un mutante carente del gene di interesse e di studio 8,11 se il suo profilo lipidico è distinto dal tipo di versione selvaggia 6,8,11. al fine di ottenere una valutazione quantitativa del profilo lipidico di un organismo, un metodo semplice consiste nel radiomarcatura composti cellulari , l'estrazione dei lipidi, separandoli mediante cromatografia, e quantificare i lipidi separati marcati radioattivamente.

  1. Radiomarcatura di lipidi.
    1. Preparare una notte pre-coltura di un organismo di interesse (E. coli o S. meliloti) in 5 ml di terreno di coltura desiderato (media complessa o terreno minimo definito dall'utente) e crescere a 30 ° C.
    2. Dalla pre-coltura, inoculare in 20 ml di same mezzo fresco in un pallone di coltura 100 ml per ottenere una OD 620 = 0.3 iniziale per la cultura.
    3. Prelevare un 'aliquota (1 ml) della coltura in condizioni sterili e trasferire in una provetta a fondo rotondo polistirene 14 ml sterile.
    4. Aggiungere 1 pCi di acetato [1- 14 C] (60 mCi per mmol) alla coltura 1 ml.
    5. Incubare la coltura liquida sotto agitazione a 30 ° C per un periodo di 24 ore.
    6. Al termine del periodo di incubazione, trasferire la coltura in una provetta da 1,5 ml e centrifugare a 12.000 xg a temperatura ambiente per 5 min.
    7. Risospendere il pellet in 100 ml di acqua. A questo punto, conservare la sospensione cellulare a -20 ° C o immediatamente continuare con l'estrazione di lipidi polari (sezione 4.2).
  2. Estrazione di lipidi polari.
    NOTA: Il metodo descritto qui essenzialmente segue la procedura riportata da Bligh e Dyer 19.
    1. Per i 100 ml di sosp cellulare acquosaensione, aggiungere 375 ml di metanolo: soluzione in cloroformio (2: 1; vol / vol).
    2. Vortex per 30 sec e incubare per 5 min a temperatura ambiente.
    3. Centrifugare 5 min a 12.000 xg a temperatura ambiente.
    4. Trasferire il surnatante in un nuovo 1,5 ml provetta.
    5. Aggiungere 125 ml di cloroformio e 125 ml di acqua, vortice 30 sec.
    6. Centrifugare 1 min a 12.000 xg a temperatura ambiente.
    7. Trasferire la fase cloroformica inferiore per una nuova provetta e asciugare con un flusso di azoto gassoso.
    8. Sciogliere lipidi essiccati in 100 ml di cloroformio: soluzione di metanolo (1: 1; vol / vol).
      NOTA: A questo punto, un'aliquota di 5 microlitri della soluzione lipidica può essere quantificata mediante conteggio a scintillazione liquida.
    9. Per strato sottile analisi cromatografica (TLC), asciugare le restanti 95 microlitri con un flusso di azoto gassoso e ridisciogliere lipidi essiccati in 20 ml di cloroformio: soluzione di metanolo (1: 1; vol / vol). Utilizzare una aliquota di 3 mlper l'analisi TLC.
  3. Separazione dei lipidi polari mediante cromatografia su strato sottile (TLC).
    NOTA: A seconda delle classi di lipidi da analizzare, diverse combinazioni di fasi solide e mobili possono essere impiegati per la separazione. Ecco una separazione tipica di lipidi cariche polari e un altro, più adatti per i lipidi polari neutri, utilizzando ad alte prestazioni cromatografia su strato sottile (HPTLC) fogli di alluminio gel di silice come fase solida, sono delineati.
    1. La separazione dei lipidi polari praticati dalle bidimensionali TLC (2D-TLC).
      1. Applicare un'aliquota 3 microlitri di campione lipidi in un angolo di un foglio di alluminio HPTLC di silice gel (10 x 10 cm), 2 cm dal bordo della piastra.
      2. Preparare e miscelare la fase mobile (140 ml di cloroformio, 60 ml di metanolo e 10 ml di acqua) per la separazione nella prima dimensione.
      3. Coat un TLC in via di sviluppo da camera internamente con carta cromatografia.
        NOTA: Questo per garantire che la fase gas della camerasi satura rapidamente (entro 30 minuti) dopo la fase mobile per la prima dimensione è stato aggiunto alla camera e la camera è stata chiusa con una lastra di vetro.
      4. Preparare e miscelare la fase mobile (130 ml di cloroformio, 50 ml di metanolo e 20 ml di acido acetico glaciale) per la separazione nella seconda dimensione e trasferimento in una seconda camera di sviluppo TLC rivestite internamente con cromatografia su carta e lasciare la camera satura.
      5. Trasferire accuratamente il foglio di alluminio gel di silice HPTLC con il campione lipide essiccato alla prima camera e sviluppare (cioè, esegue cromatografia) la piastra per 60 min in camera chiusa nella prima dimensione 5.
      6. Rimuovere la placca dalla camera e lasciare asciugare solventi fuori in una cappa a flusso per 30 min.
      7. Dopo aver piastra di 90 gradi per quanto riguarda la cromatografia precedente, trasferire il foglio di alluminio gel di silice HPTLC, su cui i lipidi sono stati separati in una dimensione, alla secondacamera d e sviluppare la piastra per 60 minuti nella seconda dimensione 5.
      8. Rimuovere il foglio dalla camera e lasciare che i solventi asciugarsi in una cappa a flusso per almeno 2 ore.
    2. Separazione dei lipidi polari neutri.
      1. Applicare 3 aliquote microlitri di campioni lipidi su un foglio di alluminio di gel di silice HPTLC partendo 2 cm dai bordi della lastra. Se più campioni vengono analizzati in cromatografia unidimensionale, mantenere una distanza di almeno 1,5 cm tra i diversi punti di applicazione del campione.
      2. Preparare e mescolare la fase mobile (140 ml di esano, 60 ml di etere etilico, e 8 ml di acido acetico) e trasferire in una camera di sviluppo TLC rivestiti internamente con carta cromatografia e coperte con una lastra di vetro per lasciare che il satura camera (30 min).
      3. Trasferire il foglio di alluminio gel di silice HPTLC con i campioni lipidi essiccati nella camera e sviluppare la piastra per 30 min in camera chiusa.
      4. Rimuovere la placca dalla camerae lasciare che i solventi asciugare fuori in una cappa a flusso per 2 ore.
  4. La quantificazione e la visualizzazione dei lipidi polari separati.
    1. Una volta che la lastra TLC sviluppata è asciutto, incubare con uno schermo luminescenza fotostimolabile (PSL) in una cassetta chiusa per 3 giorni.
    2. Esporre lo schermo incubate a uno scanner PSL e acquisire un'immagine virtuale dei lipidi radiomarcati separati.
    3. Eseguire la quantificazione utilizzando il software PSL 20.
  5. La visualizzazione e l'isolamento di singole classi lipidi polari.
    1. Incubare foglio TLC sviluppata per 10 min in una camera cromatografia in presenza di 1 g di cristalli di iodio.
      NOTA: separata composti lipidici si dissolveranno lo iodio e appaiono come macchie brunastre.
    2. Circle le macchie con una matita, confrontarle con la mobilità relativa (R f) di composti standard (ad esempio, 1,2-dipalmitoyl- sn -glycerol, dipalmitoil-L-α-phosphatidylcholine, DL-α-monopalmitin, o acido palmitico), e di identificare a quale classe di lipidi potrebbero appartenere.
    3. In una cappa aspirante, lasciare che lo iodio evaporare dal foglio TLC.
    4. Con l'aiuto di una spatola, raschiare il gel di silice contenente il composto di interesse dal foglio, ed estrarre il composto dal gel di silice con una miscela di 100 ml di acqua e 375 ml di metanolo: soluzione in cloroformio (2: 1; vol / vol).
    5. Continuare con l'estrazione in base alla Bligh e Dyer, come indicato (4.2.2 in poi).
    6. Conservare classe di lipidi purificato in 100 ml di cloroformio: soluzione di metanolo (1: 1; vol / vol) a -20 ° C fino al momento dell'uso.

5. In Vitro Identificazione della fisiologica Substrato di un Lipasi

NOTA: In un approccio in vitro, lo studio se la lipasi di interesse in grado di convertire una miscela di lipidi isolate o singoli lipidi puri al Hydrol corrispondenteprodotti Ysis alle condizioni definite come ottimale in 3.2.

  1. Utilizzare sistemi di pipettaggio per saggi enzimatici come da Tabella 3 per specifiche PC fosfolipasi C SMc00171 (vedi 5.2), fosfolipasi A (vedi 5.3), e DAG lipasi SMc01003 (vedi 5.4) attività.
  2. Determinazione dell'attività fosfolipasi C specifica-PC (Tabella 3).
    1. Per una provetta da 1,5 ml microcentrifuga, aggiungere 5.000 conteggi per minuto (cpm) del totale 14 PC C-marcato e di una soluzione di Triton X-100.
    2. Mescolare e secco sotto corrente di azoto.
    3. Aggiungere dietanolammina-HCl, pH 9,8 tampone, nonché 2 soluzioni di NaCl e MnCl e acqua bidistillata per ottenere un volume finale di 99,5 ml. Vortex per 5 sec.
    4. Aggiungere 0,5 ml di enzima (5 mg proteina) (ossia, un estratto cellulare in cui overexpressed SMc00171 è presente) per iniziare la reazione. Mescolare brevemente.
    5. Incubare a 30 ° C per 4 ore.
    6. Arrestare la reazione da parte delaggiunta di 250 ml di metanolo e 125 ml di cloroformio.
    7. Estrarre i lipidi come descritto in precedenza (vedi 4.2).
    8. lipidi separate da unidimensionale (1D) -TLC (vedere 4.3.2 e 4.4), e li analizzano da immagini PSL.
  3. Determinazione dell'attività fosfolipasi A (Tabella 3).
    1. Per una provetta da 1,5 ml microcentrifuga, aggiungere 5.000 cpm del totale di 14 fosfolipidi C-marcato ed una soluzione di Triton X-100.
    2. Mescolare e secco sotto corrente di azoto.
    3. Per un saggio finale 100 microlitri, aggiungere Tris-HCl, pH 8,5 tampone, soluzione di NaCl e acqua. Vortex per 5 sec.
    4. Aggiungere 5 ml di enzima (50 mg di proteina) (vale a dire, un estratto cellulare in cui sovraespresso SMc00930 o SMc01003 è presente).
    5. Incubare a 30 ° C per 5 ore.
    6. Arrestare la reazione mediante aggiunta di 250 ml di metanolo e 125 ml di cloroformio.
    7. Estrarre i lipidi come descritto in precedenza (vedi 4.2), separatiloro da 1D-TLC usando 130 ml di cloroformio, 50 ml di metanolo e acido acetico glaciale a 20 ml come fase mobile, e analizzare con immagini PSL.
  4. Determinazione del diacilglicerolo (DAG) attività della lipasi.
    1. Preparazione di 14 C-marcato DAG.
      1. Radiomarcato S. culture meliloti (vedi 4.1) ed estrarre i lipidi polari (vedi 4.2), come descritto. Separato S. meliloti estratti totali lipidi di 1D-TLC in cloroformio: metanolo: acido acetico (130: 50: 20; vol / vol) utilizzando condizioni descritte per la separazione in seconda dimensione al punto 4.3.1.
      2. Visualizza PC mediante colorazione iodio e usare una matita per segnare la localizzazione di fosfatidilcolina (PC).
      3. Isolare PC radiomarcato come descritto al punto 4.5.
      4. Quantificare PC estratti per il conteggio a scintillazione.
        NOTA: circa 320.000 cpm PC è previsto.
      5. Trattare PC (250.000 cpm) con 0.1 U di fosfolipasi C da Clostridium perfringens in 50 mM Tris-HCl, pH 7,2, 0,5% Triton X-100 e 10 mM CaCl 2 per 2 ore in un volume totale di 100 microlitri e fermare la reazione aggiungendo 250 ml di metanolo e 125 ml di cloroformio.
      6. Estrarre i lipidi come descritto in precedenza e separata da loro da 1D-TLC (vedi 4.3.2).
      7. Isolare diacilglicerolo dalla piastra di silice e quantificare mediante conteggio a scintillazione (come descritto in 4.2)
    2. Saggio lipasi diacilglicerolo (Tabella 3).
      1. Per una provetta da 1,5 ml microcentrifuga, aggiungere 5.000 cpm di 14 C-marcato DAG e una soluzione di Triton X-100.
      2. Mescolare e secco sotto corrente di azoto.
      3. Per un saggio finale 100 microlitri, aggiungere Tris-HCl (pH 9,0) tampone, una soluzione di NaCl e acqua bidistillata. Vortex per 5 sec.
      4. Avviare la reazione aggiungendo 5 ml di enzima (50 mg di proteine ​​di estratto cellulare).
      5. Incubare a 30 ° C per 4 ore.
      6. Arrestare la reazione mediante aggiunta di 250 ml di metanolo und 125 ml di cloroformio e di estratto di lipidi, come descritto in precedenza (vedi 4.2).
      7. Analizzare lipidi polari neutri per 1D-TLC (vedi 4.1.3.2) e la successiva di imaging PSL.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Attività di specifici PC fosfolipasi C SMc00171 con Bis- p -nitrophenyl fosfato

Estratti privi di cellule ottenute da E. coli BL21 (DE3) pLysS x, che avevano smc00171 espressi, sono stati studiati per la loro capacità di idrolizzare bis- p esteri -nitrophenyl fosfato, utilizzando un saggio enzimatico spettrofotometrica, misurando la -NP p formata. Nessuna attività idrolitica era presente in estratti privi di cellule ottenute da E. coli BL21 (DE3) x pLysS ospitare un vettore vuoto pET9a (dati non riportati) quando bis- p -nitrophenyl fosfato è stato impiegato come substrato.

Corsi di tempo per la -NP p formata indicano che vi è una forte dipendenza dalla quantità di estratto cellulare (da E. coli BL21 (DE3) pLysS x, che aveva smc00171 espresso) aggiunto al test (Figura 2A). Se la quantità di prodotto P -NP formata dipenderebbe solo dalla concentrazione dell'enzima, va osservato una correlazione lineare tra enzima (proteina) concentrazione impiegato e prodotto formatosi dopo un certo tempo. Chiaramente, questo non è il caso per gli estratti privi di cellule ottenute da E. coli BL21 (DE3) pLysS x, che aveva smc00171 espresso (Figura 2B). Sebbene ci potrebbero essere diverse ragioni per una dipendenza esponenziale dell'attività enzimatica sulla concentrazione proteica 21, un motivo frequente è che al momento la diluizione di un estratto proteina enzimatica contenente, altri componenti estratto che possono essere limitanti per l'attività enzimatica, cioè potenziali cofattori , sono diluiti pure. In questi casi, attività enzimatiche inaspettatamente bassi sono registrati con estratti privi di cellule diluite. Includendo una concentrazione saturante di 3 mM MnCl 2 nel saggio enzimatico, il p Prodotto -NP formata dopo un certo tempo dipende esclusivamente dalla quantità di enzima aggiunto (dati non mostrati) che indica che MnCl 2 era un componente limitante per l'attività SMc00171 in estratti privi di cellule di E. coli.

figura 2
Figura 2. Determinazione della SMc00171 (fosfolipasi) l'attività utilizzando il substrato artificiale bis- p -nitrophenyl fosfato. Il corso di tempo per la formazione p -NP è dimostrato impiegando cell-free estratti di proteine (● 10 ug / ml, ■ 15 mg / ml, ▲ 20 ug / ml) in cui era stato espresso SMc00171 (a). p -NP formato dopo 40 min di incubazione con diverse quantità di proteine estratti privi di cellule in cui era stato SMc00171 espresse (B). Le barre di errore indicano la deviazione standard..jove.com / files / ftp_upload / 54613 / 54613fig2large.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

Attività del predetto Patatin simile fosfolipasi SMc00930 e SMc01003 con p -Nitrophenyl Acil Esteri di diverse lunghezze a catena

Dopo espressione di smc00930 o smc01003 in E. coli BL21 (DE3) x pLysS, estratti privi di cellule sono stati ottenuti e studiati per la loro capacità di idrolizzare p -nitrophenyl esteri grassi acile. Durante il saggio enzimatico, il -NP p formatosi è stato determinato in uno spettrofotometro. Attività idrolitici minori erano presenti in estratti privi di cellule ottenute da E. coli BL21 (DE3) x pLysS con un vettore vuoto pET17b (Tabella 4) quando esteri p -nitrophenyl acilici di differelunghezze della catena nt sono stati impiegati come substrati. Quando smc01003 è stato espresso, gli estratti ottenuti hanno mostrato un aumento di idrolisi di esteri p -nitrophenyl di diversa lunghezza di catena. SMc01003 degradato il decanoato -nitrophenyl catena p ambientale nonché la catena lunga p -nitrophenyl palmitato e p -nitrophenyl stearato (Tabella 4). Come SMc01003 è un contributo importante per la formazione di acidi grassi liberi a catena lunga in S. meliloti durante la fase stazionaria 11, era sorprendente che SMc01003 sembrava agire altrettanto bene su catena media che sulla catena lunga esteri p -nitrophenyl acil (Tabella 4). Inaspettatamente, SMc01003 agisce anche su substrati a catena corta, come butirrato p -nitrophenyl o p -nitrophenyl ottanoato (dati non riportati). Tuttavia, queste ultime substrati sono anche degradati da attività presenti negli estratti privi di cellule di E. coli (vale a dire, l'ospitare il vect vuotoo pET17b) senza esprimere alcun gene in più e con substrati a catena corta (C4), la metà del substrato è già degradato da E. enzimi intrinseci coli (dati non riportati). Chiaramente, SMc01003 ha bisogno di essere purificato, al fine di chiarire se SMc01003 funziona altrettanto bene su supporti breve, medio e lungo la catena. In generale, gli esteri p -nitrophenyl acilici non sembrano essere buoni substrati per SMc01003 che potrebbero essere comprensibile sapendo che SMc01003 è in realtà una lipasi DAG 11. Estratti privi di cellule, in cui era stato espresso smc00930, mostrano attività enzimatiche molto più elevati con gli esteri p -nitrophenyl (Tabella 4). Inoltre, SMc00930 è in grado di idrolizzare gli esteri p -nitrophenyl acile di diverse lunghezze di catena (C10, C12, C14, C16 e C18), anche se p -nitrophenyl palmitato (attività specifica 5.5 mmol NP min - 1 mg di proteina - 1) è chiaramente il migliore substrato per SMc00930. Ad oggi, il physiologico substrato per SMc00930 non è noto.

Esplorando se Polar Lipids può funzionare come substrati per prevista (fosfo) lipasi

Una volta che un (fosfo) saggio lipasi enzimatico è stato ottimizzato con substrati artificiali, miscele di lipidi radioattivi o lipidi puri possono essere testati come potenziali substrati.

Quando saggiare SMc00171 contenenti estratti privi di cellule con 14 PC C-marcato in condizioni ottimali, abbiamo potuto dimostrare che SMc00171 degrada PC a DAG, un risultato che è stato confermato da studi di spettrometria di massa 8. SMc00171 degrada anche 32 PC P-marcato per phosphocholine e quindi funge da fosfolipasi C specifica-PC (PLCP) 8, che è indotta in condizioni fosforo limitativo di crescita.

quandosaggiare SMc00930- o SMc01003 contenenti estratti privi di cellule con 14 C o 32 lipidi polari totali P-marcato in condizioni ottimali, abbiamo potuto dimostrare che nessuno dei fosfolipidi è degradata da SMc00930 o SMc01003 in condizioni in cui gli esteri p -nitrophenyl acilici funzionato come substrati 11. Al contrario, una fosfolipasi commerciale A 2 dal veleno di serpente era in grado di degradare una tale miscela di fosfolipidi 11. Questi risultati sono stati sorprendenti e inaspettati come sia, SMc00930 e SMc01003, sono stati previsti per essere Patatin-come fosfolipasi.

Quando saggiare SMc00930- o SMc01003 contenenti estratti privi di cellule con 14 C-diacilglicerolo etichettato (DAG) in condizioni ottimali, abbiamo potuto dimostrare che DAG non è degradata da SMc00930 o dagli estratti privi di cellule di E. coli, mentre SMc01003 degrada DAG e forma composti che migrano come gli acidi grassi liberi (Figura 3). Recentemente abbiamo potuto dimostrare che SMc01003 funge da lipasi DAG che possono degradare DAG o monoacilglicerolo a glicerolo e acidi grassi liberi 11 (figura 4).

Figura 3
Figura 3. SMc01003 degrada diacilglicerolo. Estratti privi di cellule di E. coli BL21 (DE3) pLysS × esprimere SMc01003, SMc00930 o contenenti il vettore vuoto pET17b, o di tampone sono stati incubati con 14 C-DAG (ottenuto da S. meliloti) per 24 ore. Alla fine dei rispettivi periodi di incubazione, lipidi radiomarcati sono stati estratti e separati da 1D-TLC usando la fase mobile per separare i lipidi polari neutri (vedi 4.3.2). FA, acidi grassi; DAG, diacilglicerolo. Questo dato è stato modificato da [Sahonero-Canavesi et al. 2015] 11.3large.jpg "target =" _ blank "> Clicca qui per vedere una versione più grande di questa figura.

Figura 4
Figura 4. enzimatica funzione del diacilglicerolo lipasi DGLA (SMc01003). Diacilglicerolo (DAG) lipasi SMc01003 degrada DAG a monoacilglicerolo e un acido grasso, e poi monoacilglicerolo degrada ulteriormente a glicerolo e un altro acido grasso. Cliccate qui per vedere una versione più grande di questa figura.

oligonucleotide
Nome
Sequenza
(5'-3 ')
Gene
di interesse
enzima di restrizione
sito aggiunto
Vettore
per l'espressione
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 Nde I pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 Xho I pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 Nde I pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 Bam HI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 Nde I pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 Bam HI pET9a
Le lettere in grassetto indicano siti di restrizione.

Tabella 1. Oligonucleotidi usato per amplificare e clone previsto fosfo (lipasi) geni in pET17b o pET9a vettoriale. Oligonucleotidi primer sono stati progettati utilizzando il software descritto 15.

Assay per SMc00171 Assay per SMc01003 Assay per SMc00930
Azione Componente
Tris-HCl, pH 8,5 25 ml
2 M Tris-HCl, pH 9,0 25 ml
1 M dietanolammina-HCl, pH 9.8 50 microlitri
1 M NaCl 40 ml 150 ml 150 ml
1% Triton X-100 200 ml 200 ml
50 mm p- nitrofenil palmitato 12,5 ml 12,5 ml
200 mM bis- fosfato nitrofenil p- 2,5 ml
cell-libero estratto (1 mg Protein / ml) con il gene candidato espresso 20 microlitri 100 pl 1 ml
acqua bidistillata 887.5 ml 512.5 ml 611.5 ml
volume finale 1 ml 1 ml 1 ml

Tabella 2. Sistemi di pipettaggio per saggi enzimatici ottimizzati con p artificiale substrati -nitrophenyl estere.

Saggio per smc00171 -encoded fosfolipasi C Assay per smc01003 - codificato DAG lipasi Saggio Ottimizzato per fosfolipasi Un'attività
Azione Componente
2 M Tris-HCl pH 8.5 2,5 ml
2 M Tris-HCl pH 9,0 2,5 ml
100 mM MnCl 2 3 ml
1 M Dietanolammina-HCl pH 9.8 5 ml
1 M NaCl 4 pl 15 ml 15 ml
1% Triton X-100 2 ml 20 microlitri 20 microlitri 14 C-marcato lipidi (fosfolipidi) 20 l (5000 cpm)
14 C-marcato lipidi (PC) 20 l (5000 cpm)
14 C-marcato lipidi (DAG) 20 l (5000 cpm)
10 mg / ml estratto proteico con geni candidati espressi 0,5 ml 5 ml 5 ml
acqua bidistillata 87,5 ml 77.5 ml 77.5 ml
Volume finale 100 pl 100 pl 100 pl

tavolo3. schemi di pipettaggio per saggi enzimatici (ottimizzate per fosfo) lipasi con substrati lipidici radioattivi.

l'attività è espressa in unità (mmol nitrofenolo / mg di proteina x min)
Numeri in grassetto indicano acile lunghezza della catena di p substrato -nitrophenyl estere 10 12 14 16 18
E. coli estratto (sullo sfondo) 16 ± 0.3 10 ± 1.1 13 ± 0.3 11 ± 0.8 10 ± 0,6
SMc00930 espresso in E. estratto coli 1.839 ± 283 2.873 ± 117 5.517 ± 394 3.402 ± 65
SMc01003 espresso in E. estratto coli 43 ± 2.1 29 ± 2 20 ± 0.7 25 ± 1.5 22 ± 0.9
SMc00930 meno sfondo 1.823 ± 283 1.829 ± 283 2.860 ± 117 5.506 ± 394 3.392 ± 65
SMc01003 meno sfondo 27 ± 2.1 18 ± 2 7 ± 0.7 14 ± 1.5 12 ± 0.9

Tabella 4. p esteri -Nitrophenyl acile come substrati per lipasi Patatin simile SMc00930 e SMc01003.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nel corso degli ultimi 20 anni, genomi di molti organismi sono stati sequenziati e anche se una ricchezza di dati sequenza del genoma è stato generato, interpretazione funzionale è in ritardo e ostacola quindi la nostra comprensione della funzione del genoma. funzioni geniche in genomi sono spesso assegnati in base alla somiglianza con geni di funzione nota o di insorgenza di motivi conservati. Tuttavia, la precisa funzione di un dato gene spesso non è noto. Soprattutto, previsto geni strutturali per enzimi non possono essere facilmente esplorato con tecniche omic dovuto al fatto che la maggior parte degli enzimi catalizzano reazioni complesse che coinvolgono due substrati e due prodotti. Attualmente, sembra più fattibile per esplorare specificità di substrato per gruppi di enzimi in cui almeno un substrato è fisso e dove l'altra può essere variata. Ad esempio, negli eucarioti maggior motivi fosforilazione di proteine ​​sono noti e peptidi consenso per chinasi sono stati avvistati su supporti solidi per generare peptide arRaggi. L'uso di tali array e ATP radioattivo, specificità di substrato e livelli di attività di chinasi distinti di un organismo può essere determinato che permette la creazione di un profilo kinome e definire le specificità del substrato 24. Idrolasi comporre un altro grande gruppo di enzimi per i quali un substrato, acqua, è fisso, ma per i quali la precisa natura della (altro) substrato da idrolizzati spesso non è conosciuta. Il fatto che per un nuovo enzima condizioni di analisi ottimali non sono noti né, converte il rilevamento di una nuova attività enzimatica in un problema multivariabile. Si può quindi contribuire a poter fissare il substrato essere idrolizzato per definire le condizioni in cui l'enzima funziona meglio.

Nel presente manoscritto, si descrive l'ottimizzazione delle condizioni di analisi per prospettico (fosfo) lipasi con specificità di substrato sconosciuti e elaboriamo come impiegare queste condizioni ottimali nella ricerca per il substrato naturale del reprospettiva (fosfo) lipasi. Il significato della presente tecnica consiste nel fatto che l'idrolisi dei substrati artificiali fluorogenici o cromogeni,, che imitano substrati naturali in una certa misura, può essere seguito mediante spettrofotometria 25 e che questi test sono facilmente applicabile a larga scala studi 26. A causa della sensibilità di tali dosaggi e la loro semplicità di monitorare la reazione, possono essere facilmente ottimizzate per un dato enzima. Ovviamente, per substrati artificiali ci si potrebbe aspettare costanti cinetiche meno favorevoli (vale a dire, ad alta K M, a basso k cat) per un enzima specifico che per substrati naturali 1,21. In pratica, tuttavia, la disponibilità facile e rilevabilità di substrati artificiali operare da substrati (cattivo) per interi gruppi di enzimi spesso più che compensare gli svantaggi. Una volta aver incontrato le condizioni per un enzima di lavorare (con il substrato artificiale), lo farà con la naturAl / substrato fisiologico pure. Poiché la preparazione e l'isolamento di potenziali substrati lipidici possono essere laborioso e richiede molto tempo, è importante avere la certezza che un enzima è pronto a lavorare quando si combinano e incubando con substrati preziosi. È importante sottolineare che la procedura di ottimizzare prima le condizioni per un enzima di lavorare, consentirà una più rapida identificazione del substrato fisiologico per un nuovo (fosfo) lipasi. Come prova di concetto, abbiamo impiegato con successo questo metodo per la caratterizzazione delle specificità di substrato di lipasi SMc00171, SMc00930 e SMc01003 8,11. Al contrario, molti metodi tradizionali, alternativi istituiscono saggi di attività (fosfo) lipasi coinvolgono reazioni in cui il substrato e di prodotto sono già noti.

Ovviamente, modifiche di metodi per la determinazione dell'attività enzimatica ottimale può includere l'uso di altri fluorogenico, cromogenica, o in altro modo substrati artificiali marcate, la variazionedi enzima concentrazione, tipo e concentrazione di buffer o altri additivi (ad esempio, detergenti o cationi bivalenti). Se nessuna attività enzimatica viene rilevata con substrati artificiali, il rispettivo enzima semplicemente non potrebbe funzionare con questo substrato, ma la risoluzione dei problemi in questi casi certamente dovrebbe includere per avere la certezza che fossero state adottate tutte le precauzioni che avrebbe potuto essere necessario per mantenere l'attività enzimatica intatto (vale a dire, la memorizzazione estratti privi di cellule a 4 ° C o temperature inferiori fino al momento dell'uso e, se necessario, l'aggiunta di un cocktail di inibitori delle proteasi ad estratti privi di cellule, al fine di evitare la degradazione proteolitica dell'enzima di interesse) 27.

Limiti della tecnica presentata in questo manoscritto sono dovuti al fatto che il substrato artificiale e il substrato naturale sono diversi l'uno dall'altro e di conseguenza bioenergetica per la reazione catalizzata sarà pure 1. I vari parameters per le condizioni ottimali di attività enzimatica dovrebbero essere stabiliti anche per il substrato naturale (variando pH, tipo di tampone, tampone forza, concentrazioni di NaCl e detergenti come Triton X-100, l'assenza o la presenza di diversi cationi bivalenti), come potrebbero rivelarsi un po 'diversa dalle condizioni ottimali riscontrate per il substrato artificiale. Un'altra limitazione importante è che probabilmente non tutti (fosfo) lipasi sono rilevabili mediante l'uso di substrati cromogeni artificiali. Ad esempio, l'artificiale p -nitrophenyl residui dei substrati esterei semplicemente potrebbe essere troppo ingombranti, o presentare altre proprietà chimiche che impediscono che un tale substrato può ottenere l'accesso al sito attivo di un enzima. È stato osservato che il DAG lipasi SMc01003 visualizzata attività bassi con tutti i substrati p -nitrophenyl esterei di diverse lunghezze di catena 11. Con la conoscenza che DAG è il substrato naturale per SMc01003 e che ha un DAG reltivamente piccolo gruppo testa polare, composto da glicerolo solo 11, è facilmente immaginabile che l'ingombrante residuo p -nitrophenyl è semplicemente troppo grande per un facile accesso al sito attivo della SMc01003. Tuttavia, i dettagli molecolari per cui p esteri -nitrophenyl non sono buoni substrati per SMc01003 non sono noti, a questo punto.

Passaggi critici all'interno del protocollo comprendono tutte le disposizioni adottate per garantire che l'enzima studiato ha accesso al rispettivo supporto. Ad esempio, nella ricerca per il substrato lipidico fisiologico, è fondamentale che il substrato lipidico è fornito in una forma solubilizzata. Pertanto, quando si imposta tali saggi enzimatici (descritto in 5 del protocollo), substrati lipidici, generalmente disciolti in miscele di metanolo: cloroformio, deve essere miscelato con una soluzione acquosa di un detergente, cioè, Triton X-100, prima dell'essiccazione giù la miscela con azoto gassoso. Questa procedura garantisce che, dopo aver aggiunto gli altri ingredienti per il saggio, il potenziale di substrato lipidico è incorporato in micelle detergenti e come tale accessibili per l'enzima durante il dosaggio.

Principalmente, la tecnica qui presentata dovrebbe essere ampiamente applicabile in futuro per la scoperta di nuovi (fosfo) lipasi e per la definizione dei loro substrati naturali. La tecnica è facilmente espandibile per altre classi di idrolasi, ma potrebbe essere più complicato per sviluppare saggi con substrati artificiali per nuovi enzimi che richiedono due, di solito sconosciuti, substrati per completare il loro ciclo catalitico.

Per lipasi previsti (fosfo) o fosfatasi né il substrato corretto è conosciuto né le condizioni di saggio in cui l'enzima funziona bene. Pertanto, potrebbe essere utile studiare se alcuni composti da una batteria di composti artificiali, quali i composti contenenti -nitrophenyl distinta p (p -nitrophenyl fosfato, bis- p -nitrophenyl fosfato, p -nitrophenyl palmitato), potrebbe funzionare come substrato. La scoperta di attività enzimatiche iniziali con substrati artificiali ha aperto la strada per risolvere tale SMc00171 è una specifica fosfolipasi C-PC 8, che SMc01003 è un lipasi DAG 11, e ha contribuito a definire le condizioni alle quali SMc00930 agisce come un idrolasi 11. Ovviamente, il substrato naturale di SMc00930 è al momento ancora sconosciuto e contesti fisiologici di SMc00930 e SMc01003 sono ancora da risolvere. Pertanto, il compito di proporre una funzione fisiologica per una lipasi previsto è impegnativo e non sempre immediatamente incontrato con successo. Utilizzando i mutanti carenti del gene della lipasi previsto e confrontandoli con il rispettivo ceppo wild-type potrebbe dare evidenza sperimentale che la lipasi agisce con la specificità nel suo sfondo nativo ceppo che è stato postulato in parte 4) del protocollo. Chiaramente, l'affermazione di una nuova sh attività della lipasiould essere supportato da prove in vitro che un certo substrato viene convertito mediante idrolisi in prodotti definiti. A volte la funzione fisiologica postulato potrebbe colmare le lacune in vie metaboliche o spiegare il comportamento fisiologico dell'organismo che produce, ma in altri casi non è sufficiente ancora potrebbe non essere sufficiente conoscenze biochimiche per dare un senso di alcune attività. Nel corso dei nostri studi, abbiamo identificato numerosi enzimi che agiscono sui lipidi di membrana intrinseche polari di batteri loro degradanti e, in alcuni casi, convertendoli in un giocatore in cicli lipidi complessi. Ad esempio, combinando la nuova conoscenza che SMc00171 è uno specifico PC fosfolipasi C (PLCP) 8 che è indotta in condizioni di fosforo di limitazione della crescita, con i dati preesistenti, si può postulare un romanzo ciclo DAG che potrebbero esistere in molti proteobacteria ambientale e che dà luogo alla formazione di lipidi di membrana privo di fosforo quando fosforo è crescita limitativo. in contrast, quando le forniture di fosforo sono abbondanti, DAG è rephosphorylated ad acido fosfatidico entrando de novo biosintesi dei fosfolipidi, chiudendo così il ciclo lipidico e garantendo che principalmente (glycero) fosfolipidi sono presenti nella membrana 8,28.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgments

Questo lavoro è stato sostenuto da sovvenzioni dal Consejo Nacional de Ciencias y Tecnología-Messico (CONACYT-Messico) (82614, 153998, 253549, e 178.359 in Investigación Científica Básica e 118 in Investigación en Fronteras de la Ciencia) e dalla Dirección General de Asuntos de Personal Académico-Universidad Nacional Autónoma de México (UNAM DGAPA-; PAPIIT IN202616, IN203612).

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
La definizione del substrato Specificità per lipasi e fosfolipasi candidati
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter