Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

리파제 및 포스 후보자에 대한 기질 특이성을 정의

doi: 10.3791/54613 Published: November 23, 2016

Abstract

미생물 유기체의 외부 기판을 사용할 수 있도록하기 위해 분비된다 (포스) 리파제의 넓은 스펙트럼을 생산하고 있습니다. 또한, 다른 (포스) 리파제는 물리적으로 생산 유기체가 고유 지질의 매출을 일으키는 원인이 자주 세포막의 리모델링에 상승을 제공과 연관 될 수있다. 전위 (포스)은 리파제 유전자 / 단백질 서열 사용할 알고리즘의 번호와 예측 될 수 있지만, 효소 활성, 기질 특이성, 잠재적 생리 기능의 실험적 증거는 종종 수득되지 않았다. 이 원고는 알 수없는 기질 특이성하는 방법과 각각의 (포스) 리파제의 자연 기판에 대한 검색이 최적의 조건을 사용하는 방법과 미래 (포스) 리파제에 대한 분석 조건의 최적화에 대해 설명합니다. 미성년자를 감지하는 데 도움이, 같은 페이지의 -nitrophenyl 유도체 인공 발색 기판을, 수 사용표준 조건에서 예측 (포스) 리파제에 대한 효소 활성. 이러한 보조 효소 활성을 발생하는 데, 효소 분석의 고유 파라미터는 인공 기판의보다 효율적인 가수 분해를 얻기 위해 변화 될 수있다. 효소가 잘 작동되는 조건을 판정 한 후, 자연 전위 다양한 기판은 그들의 열화 구별 크로마토 그래피 방법을 이용 하였다 될 수있는 프로세스를 분석한다. 새로운 효소 기질 특이성의 정의는 종종 후 실험적으로 테스트 될 수있는 이러한 효소의 전위 생리적 역할에 대한 가설을 제공한다. 이 가이드 라인에 따라, 우리는 성장의 인 제한 조건에 따라 세균 Sinorhizobium의 meliloti에서 세포막의 리모델링을위한 중요한 단계에서, 포스 포 콜린과 디아 실 글리세롤하는 포스파티딜콜린을 저하 포스 포 리파제 C (SMc00171)을 식별 할 수 있었다. 두 patatin- 예측을 위해같은 유기체의 포스 포 (SMc00930 및 SMc01003)처럼, 우리는 그들의 기질 특이성을 재정의하고 SMc01003은 디아 실 글리세롤 리파제 있음을 명확히 할 수있다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

이러한 트리 아실 글리세롤과 (글리세) 인지질 등의 글리세롤 기반의 지질이 중요한 구성하고 아마 가장 잘 알려진 지질 클래스 1. 트리 아실 글리세롤 (태그) 지방 또는 일반적으로 저장 지질의 기능 오일, 따라서 에너지 및 탄소 소스로합니다. 태그는 자주 외부 태그를 소화하고 탄소 소스로이를 사용할 수 있도록 생산 미생물에 의해 분비되는 리파제에 의해 저하 될 수 있습니다. 또한, 리파제 널리 그들의 중요한 생명 공학 응용 프로그램을 2 년 동안 연구되어왔다.

때문에 자신의 양친 매성 자연과 가까운 원통 모양, (글리세) 인지질 전시 막 형성 특성과 일반적으로 이중 층 막 3의 주요 지질 구성 요소를 구성합니다. 이러한 박테리아, 대장균, 세 개의 주요 그룹 헤드 변형, 포스파티딜 글리세롤 (PG), 카디오 리핀 (CL) 및 phosphatid 간단한 미생물에서하나는 그들 각자가 서로 다른 분자 종 (4)를 다수로 상기 SN의 다른 지방산 아실 사슬의 상당수 -1 SN -2 위치주는 증가로 치환 될 수 있음을 알아야하지만 ylethanolamine (PE)가 발생하는 . 다른 박테리아는 다른 인지질 외에 또는 대신이있을 수 있습니다. 예를 들어, Sinorhizobium의 meliloti은, 콩과 식물 알팔파 (Medicago 사티)와 질소 고정 뿌리혹 공생 관계를 형성 할 수있는 토양 박테리아, 제 양쪽이 온성 인지질, 포스파티딜콜린 (PC)를 PE 이외에 포함 오. 또한, 지질이 포함되지 인 또는 글리세롤은 세포막의 양친과 형태의 일부가 될 수 있습니다. 예를 들어, 인 - 제한 성장 조건에 따라, S.의 meliloti, (글리세) 인지질은 크게, 즉, sulfolipids, 오르니 틴 지질 및 diacylglyceryl의 trimethylho 인을 포함하지 않는 막 지질로 대체moserine (DGTS) 6. 박테리아, DGTS은 두 단계 경로 7에서 디아 실 글리세롤 (DAG)로 형성되지만 DAG 생성하기위한 소스는 명확하지 않았다된다. 펄스 - 체이스 실험은 PC가 인 제한 조건에서 형성된다 및 DAG 및 포스 포 콜린에 PC를 변환 할 수있는 DGTS 8 전구체하고 우리는 포스 포 리파제 C (PLCP, SMc00171)을 식별 할 수있는이 원고에 기술 된 방법을 사용하여 수 있다는 제안 8.

별도의 연구에서 우리는 발견이 아 닐 -CoA 합성 효소 (FADD) S.의 결핍 돌연변이 성장 9 정지상 들어갈 때 meliloti 또는 대장균 유리 지방산 축적. 이들 지방산은 세포막의 지질로부터 유도 될 듯하지만, 유리 지방산 또는이를 유리화하는 효소 (들)에 대한 정확한 소스는 공지되지 않았다. 다시 말하지만, 전략을 사용하는 것은이 원고에 설명 된 두 파타 틴과 같은 10 (포스) 리파제 (S.에서 유리 지방산의 형성에 기여하고 SMc00930 SMc01003) meliloti (11)는 예측했다. 놀랍게도 SMc01003는 글리세롤 및 유리 지방산 및 모노 아실 글리세롤 마지막 11로 변환 기판으로서 DAG를 이용했다. 따라서, SMc01003는 DAG 리파제 (DGLA)입니다.

알고리즘의 숫자가 전위 (포스)를 예측하는 존재하지만 12, 13는, 리파제 자신의 정확한 기능과 생리 학적 역할은 일반적으로 알려져 있지 않다. 여기에서 우리는 복제, 프로토콜 개요 및 예측 또는 전위 (포스) 리파제를 과발현. 이 원고 효소 분석법 개발 인공 발색 기질을 사용하여 과발현 (포스) 리파제에 최적화 할 수있는 방법을 설명한다. 우리는이 연구 결과는 미생물 생리학에 대한 우리의 이해를 풍부하게하는 방법을 최적화 효소 분석과 실제 (포스) 리파제 기판이 발생할 수있는 방법과 예제를 제공합니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

예상 리파제 1. 복제 및 과발현 구조 유전자

  1. 중합 효소 연쇄 반응 (PCR) (14) 및 특정 올리고 뉴클레오티드 (표 1 참조) (15)를 사용하여, 관심 (smc01003, smc00930 또는 smc00171)의 유전자를 증폭 숙주 생물체의 게놈 DNA로부터, 리파아제에 대한 코드 또는 트리스 포스페이트 예측 (즉, , S. meliloti).
    1. (올리고 뉴클레오티드의 설계 순서에) 특정 제한 사이트를 소개합니다. 상응하는 제한 효소로 증폭 된 DNA 단편을 소화 등의 PET 시리즈 16 플라스미드와 같은 발현 벡터로 복제.
    2. 클로닝 된 유전자에 대한 정확한 DNA 서열을 확인한 후, 같은 대장균 BL21 (DE3) pLysS를 16 발현 균주로 변환 벡터.
  2. 식 호스트 E.의 하룻밤 사전 문화를 준비 대장균 BL21 (DE3) PLYSS 100 ml의 문화 루리아 베르 타니 액체 배지 (LB) (17) 20 ㎖를 포함하는 플라스크 플러스 필요한 항생제에, 복제 된 유전자 또는 빈 벡터와 각각의 애완 동물 벡터를 은닉. 배양 30 ° C에서 세포 (또는 리파아제가 유래되는 세균의 일반적인 성장 온도에서).
    1. 밤새 예비 배양하여, 620 나노 미터 (OD 620) = 0.05에서 초기 광학 밀도를 얻기 위해 2 L 배양 플라스크에서 500 데워진 LB 배지 ㎖ (플러스 필요한 항생제)을 접종한다. , 문화 및 OD 620 = 0.3에서의 성장을 따라 100 μM의 최종 농도 이소 프로필 β-D-티오 갈 락토 시드 (IPTG)를 추가하고 4 시간 동안 30 ℃에서 교반하면서 배양한다.
    2. 인큐베이션 기간의 마지막에, 30 분 동안 4 ℃에서 5,000 XG에 500㎖의 원심 분리 튜브에서 원심 분리에 각 배양 옮긴다. 정지 완충액 5 ㎖ (예 : S에서 박테리아 세포 펠렛을 재현 탁Mc00930- 50 mM의 디 에탄올 아민 - 염산 pH를 9.8)에 50 mM 트리스 - 염산 pH를 8.0 SMc00171 발현 세포에서 세포가 발현 SMc01003. 사용할 때까지 -80 ° C에서 세포 현탁액을 저장합니다.

2. 무 세포 단백질 추출물을 준비하고 단백질 농도를 결정

  1. 박테리아 세포 현탁액을 해동 얼음에 저장합니다. 2 당 20,000 파운드에서 세포 현탁액에게 차가운 압력 셀을 통해 세 번 전달합니다. 4 ° C에서 30 분 동안 5,000 XG에서 원심 분리하여 손상 세포와 세포 파편을 제거합니다.
  2. 원심 분리 후, 후속 분석을 위해 뜨는에서 100, 500 μL의 분취 량을 준비하고 사용할 때까지 -80 ° C에 저장합니다.
  3. 선택의 방법에 의해 18 바와 같이 별개의 무 세포 추출물의 단백질 농도를 결정하기 위해 100 ㎕의 분취 량 중 하나를 사용한다.

최적화 효소에 대한 3. 인공 기판(포스) 리파제의 활동

  1. 별개의 효소 활성의 초기 커버리지를 들어, P는 니트로 페놀 (P는 -NP)로 가수 분해에 컬러 제품을 얻을 인공 기판을 사용합니다.
    1. 인공 피의 -nitrophenyl 에스테르 기판 이미 최적화 효소 분석법 (포스 포 리파제 C PLCP (SMc00171)에 대한 설명뿐 아니라 예측 파타 틴과 같은 포스 포 SMc00930 및 SMc01003 위해) 사용 피펫 팅 방식은 표 2에 기재된.
    2. 새로운 전위 (포스) 리파제를 탐색하는 경우에 50 mM Tris-HCl, pH 8.5, 100 mM의 염화나트륨, 0.05 % 트리톤 X-100, 0.5 mM의 P는 -nitrophenyl 함유 화합물 (p의 -nitrophenyl 포스페이트를 함유하는 제 표준 효소 분석을 준비 , 비스 피의 -nitrophenyl, 인산 (P)의 -nitrophenyl 카노 에이트, 또는 P -nitrophenyl 팔미 테이트) 및 무 세포 단백질 추출물 (검사 1, 3, 10, 30, 100, 300 및 (1)의 총 부피 1,000 μg의) 용액에 1 ml의 플라스틱 cuvettes.
      참고 : 연속 분석에서 P는 -nitrophenyl 에스테르 가수 분해 다음 사용 알칼리성의 pH (그림 1). 대안 적으로, 효소 반응을 정지하고, 모든 P의 -NP가 페놀 형태로 존재하는 것을 보장하기 위해 배양 기간의 끝에서의 NaOH를 첨가, pH 값의 범위에 대해 하나의 시간 점 분석을 사용한다.
    3. 5 분 동안 30 ° C에서 분광 광도계 피의 -NP의 형성 때문에 405 nm에서의 흡광도의 증가를위한 시간 과정을 따른다. 시간 당 흡광도의 상승의 초기 기울기를 결정함으로써 피의 -NP의 초기 선형 형성을 정량화.
    4. 램버트 - 비어의 법칙 (ΔA = ε ΔC의 d)를 1 사용하여 페이지의 -NP에 대한 농도 (ΔC)의 변화를 계산합니다.
      주 : ΔA 결정 흡광도의 선형 변화이고, ε은 M 단위의 각 파장에서의 몰 흡광 계수는 (-1 -1), d는 광 경로 (1 cm)의 길이이며, ΔC가 결정되는 단위 M 농도의 변화 ()는 최대.
      1. 분석 부피가 1 mL로하다는 점을 감안하면, P의 형성 -NP의 양을 계산한다.
        참고 : 양 = 농도 X 볼륨.
      2. 이 형성되는 시간에 의해 형성된 P의 -NP 량을 분할하여 효소 활성을 계산한다. 이 작업을 생성하는 책임이 마그네슘 (Mg)에서 단백질의 양에 의해 효소 활성을 나누어 특정 효소 활성을 측정.
    5. 후보 유전자 (smc00171, smc00930, 또는 smc01003)가 단지 빈 벡터를 항구 추출물로 표현했다있는 단백질 추출물로 자극 흡광도의 변화를 비교.
      주 : 다음 단계를 계속하기 위해, 후보 유전자 발현되었다 된 단백질 추출물에 의해 야기되는 특정 활동, 적어도 두번 또는 m이어야단지 빈 벡터를 항구 단백질 추출물에 의한 특정 활동에 대해 얻어진 값보다 광석.
    6. 추가 실험의 경우, P는 -nitrophenyl 함유 화합물의 가수 분해는 무 세포 추출물 (즉, 빈 벡터)와 대한 피의 -NP의 가장 두드러 형성과 p의 -nitrophenolate 음이온 (그림으로 최소 인 그 조건을 선택 단백질 추출물 후보 유전자 발현되었다되는 채용되는 경우 1)을 관찰 할 수있다.
  2. 3.1 초기 효소 활성을 측정 한 후, 염화나트륨의 농도, 산도, 버퍼의 종류를 변화시킴으로써, 각각의 효소를 분석 조건을 최적화 강도 버퍼, 예컨대 트리톤 X-100 세제, 상기 부재 또는 다른 가의 양이온의 존재.
    1. 각 변수의 상이한 농도를 들어, (3.1.4.2 참조) 특정 효소 활성을 측정 (얻어진 가장 많은 상태를 정의최대 효소 활성). 각 변수는 최적의 농도로 존재하는 최적화 된 효소 분석을 정의하는 각 변수 발생 최적 조건의 조합을 사용한다.

그림 1
그림 1. P는 -Nitrophenyl 에스테르 분광 분석에서 (포스) 리파제를위한 인공 기판은. P는 -nitrophenyl 에스테르의 가수 분해시, 산 (R-OH) 및 P는 니트로 페놀 (P는 -NP)이 형성된다. 때문에 약동학에 p의 -NP에서 페놀 H의 +의 해리에 대한 = 7.2에> 9.2 99 % 이상은 밝은 노란색 페이지의 -nitrophenolate 양식과 18,000 M -1 cm의 몰 흡광 계수에의 pH에서 - (1)은 파장으로 사용될 수있다 무료 P는 -nitrophenolate (22)의 정량 405 nm 인. 8.5의 pH와 버퍼를 사용했을 때, 흡광도 -1 400 nm의 14,500 M -1 cm의 몰 흡광 계수로 측정 하였다 (23)을 사용 하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

참고 : 관심있는 효소의 활성을위한 최적의 조건을 규정 한 후,이 리파제의 생리 / 실제 기판에 대한 검색에 착수. 원칙적으로, 종종 상보적인 두 취할 이러한 목표, 생체 내 방법 또는 시험 관내 방법을 달성하기 위해 접근한다.

리파제의 생리 기판의 4 생체 식별

"ove_content> 주 : 다른 생체 내 방법에서는, 생성 생체 내 방법에서는, 리파제의 발현이 host's 지질 프로파일을 변경할지 여부를 시간이 지남에 따라 등록하기 위해 숙주 생물 8,11 관심의 리파제를 표현한다. 관심 8,11 유전자의 결실 돌연변이 체 및 지질의 야생형 버전 6,8,11 구별 여부를 연구한다. 유기체의 지질 프로파일의 정량 평가를 얻기 위해서는 간단한 방법은 셀룰러 화합물을 방사성 표지로 이루어져 , 지질 추출 크로마토 그래피로 분리하고, 분리 된 방사성 표지 된 지질 정량.

  1. 지질의 방사성 표지.
    1. 원하는 배지 (복합 매체 또는 정의 된 최소 배지) 5 ㎖에 관심 (대장균이나 S. meliloti)의 유기체의 하룻밤 예비 배양을 준비하고 30 ° C에서 성장한다.
    2. 예비 - 배양에서, SA 20 ㎖에 접종100 ml의 배양 플라스크 나 신선한 매체는 초기 OD 620 = 문화 0.3을 얻었다.
    3. 무균 조건 하에서 문화의 나누어지는 (1 ㎖) 타고 14 ml의 멸균 폴리스티렌 둥근 바닥 튜브에 전송할 수 있습니다.
    4. 1 ml의 문화에 [1- (14) C] 아세테이트 (밀리몰 60 MCI)의 1 μCi를 추가합니다.
    5. 24 시간 동안 30 ℃에서 교반하면서 배양액을 부화.
    6. 인큐베이션 기간의 마지막 5 분 동안 실온에서 12,000 XG에 1.5 ml의 마이크로 원심 튜브를 원심 분리에 배양 옮긴다.
    7. 물 100 μL에 펠렛을 재현 탁. 이 시점에서, -20 ° C에서 세포 현탁액을 저장하거나 바로 극성 지질 (4.2 절)의 추출을 계속합니다.
  2. 극성 지질의 추출.
    주 : 본질적으로 여기에 설명 된 방법 및 후 Bligh 다이어 (19)에 의해보고 된 절차에 따른다.
    1. 수성 세포 펜던트의 100 μL에(:; 권 / 1 권 2) 클로로포름 용액 : ension는, 메탄올 375 μl를 추가합니다.
    2. 30 초 동안 와동과 실온에서 5 분 동안 배양한다.
    3. 원심 분리기 5 분 실온에서 12,000 XG에.
    4. 새로운 1.5 ML의 microcentrifuge 관에 뜨는을 전송합니다.
    5. 클로로포름 125 μL 및 물 125 μL, 소용돌이 30 초를 추가합니다.
    6. 원심 분리기 1 분 실온에서 12,000 XG에.
    7. 질소 가스의 흐름과 함께 신선한 튜브 및 건조에 낮은 클로로포름 단계를 전송합니다.
    8. (:; 권 / 1 권 1) 메탄올 용액 : 건조 클로로포름 100 ㎕의 지질을 녹여.
      주 :이 시점에서, 지질 용액 5 μL의 분취 량을 액체 섬광 계수에 의해 정량화 될 수있다.
    9. 박층 크로마토 그래피 (TLC) 분석을 위해, 질소 가스의 흐름과 함께, 나머지 95 μL를 건조하고 20 ㎕의 클로로포름 건조 지질 재용 : 메탄올 용액 (1 : 1, 부피 / 부피). 3 μL 나누어지는을 사용하여TLC 분석.
  3. 박층 크로마토 그래피 (TLC)에 의해 극성 지질의 분리.
    참고 : 지질 클래스에 따라하면 분석 할, 고체 및 모바일 단계의 서로 다른 조합의 분리에 이용 될 수 있습니다. 여기서 고체상으로 고성능 박층 크로마토 그래피 (HPTLC) 실리카겔 알루미늄 시트를 사용하여 중성 극성 지질 더 적합 대전 극성 지질 및 서로에 대한 전형적인 분리가 설명된다.
    1. 두 차원 TLC (2D-TLC)에 의해 충전 극성 지질의 분리.
      1. HPTLC 실리카겔 알루미늄 판 (10 × 10cm), 플레이트의 가장자리에서 2cm의 한 모서리에있는 지질 샘플 3 μL 분취를 적용한다.
      2. 준비 및 제 차원 분리를위한 이동상 (140 ㎖의 클로로포름 60 ml의 메탄올, 10 ml의 물)를 혼합한다.
      3. 코트 크로마토 그래피 종이 내부적으로 TLC 현상 실.
        주 :이 보장된다는 챔버의 기상제 차원 이동상 후 (30 분 이내) 빠르게 포화된다 챔버에 추가 된 상기 챔버는 유리판으로 폐쇄되었다.
      4. 준비하고 이동상 믹스 (130 ㎖의 클로로포름 50 ㎖의 메탄올과 아세트산 20 ㎖ 빙) 내부 크로마토 종이 코팅 된 초 TLC 현상 챔버 번째 차원의 분리 및 전송을위한 상기 챔버 포화하자.
      5. 조심스럽게 제 5 차원 밀폐 챔버 내에서 60 분 동안 (예를 들어, 크로마토 그래피를 수행) 판을 상기 제 1 챔버로 건조 된 지질 샘플로 HPTLC 실리카겔 알루미늄 시트를 전송하고 개발한다.
      6. 챔버에서 접시를 제거하고 용매를 30 분 동안 흐름 후드에서 떨어져 건조 할 수 있습니다.
      7. 이전 크로마토 그래피에 대해서는 90 ° 판을 켜면 SECON로 지질은 하나의 차원에서 분리 된 된 HPTLC 실리카겔 알루미늄 시트를 전송할D 챔버 및 상기 제 5 치수 60 분 동안 플레이트를 개발한다.
      8. 챔버로부터 시트를 제거하고, 용매는 적어도 2 시간 동안 흐름 후드에서 마를하자.
    2. 중성 극성 지질의 분리.
      1. 플레이트의 가장자리에서 2cm를 시작하는 HPTLC 실리카겔 알루미늄 시트 지질 샘플 3 μL 분취 액을 적용한다. 여러 샘플들은 일차원 크로마토 그래피로 분석하는 경우, 다른 샘플 애플리케이션 스폿 간의 적어도 1.5 cm의 거리를 유지한다.
      2. 모바일 단계를 준비하고 믹스 (140 ml의 헥산 60 ml의 디 에틸 에테르, 8 ml의 아세트산) 내부 크로마토 그래피 종이 코팅 챔버 포화 (30 분)을 할 수있는 유리판으로 덮여 TLC 개발 챔버 및 전송.
      3. 챔버에 건조 된 지질 샘플로 HPTLC 실리카겔 알루미늄 시트를 이동 및 밀폐 챔버에서 30 분 동안 플레이트를 개발한다.
      4. 챔버에서 플레이트를 제거상기 용매는 2 시간 동안 흐름 후드에서 마를하자.
  4. 정량 분리 극성 지질의 시각화.
    1. 개발 된 TLC 시트가 건조되면, 3 일간 폐쇄 카세트에 photostimulable 발광 (PSL) 화면을 품어.
    2. PSL 스캐너로 배양 화면을 노출하고 분리 된 방사성 표지 지질의 가상 이미지를 획득.
    3. PSL 소프트웨어 (20)를 사용하여 정량을 수행합니다.
  5. 시각화 및 개별 극성 지질 클래스의 격리.
    1. 요오드 결정 1g의 존재 크로마토 실에서 10 분 동안 개발 TLC 시트 인큐베이션.
      참고 : 분리 된 지질 화합물은 요오드를 용해 갈색 반점으로 표시됩니다.
    2. 원 연필로 관광 명소, 표준 화합물 (즉, 1,2- dipalmitoyl- SN 글리세롤, 디 팔미 토일-L-α-진료 기관 연합의 상대적인 이동 (R f를)로 비교phatidylcholine, DL-α-monopalmitin, 또는 팔 미트 산), 그들이 속할 수있는 지질 클래스를 식별합니다.
    3. 흄 후드에서 요오드가 TLC 시트에서 증발 할 수 있습니다.
    4. 클로로포름 용액 (2 : 주걱의 도움으로, 시트로부터 관심있는 화합물을 함유하는 실리카 겔을 긁어 및 물 100 ㎕과 메탄올 375 μL의 혼합물로 실리카 겔에서 화합물을 추출하는 1; 권 / 부피).
    5. (이후 4.2.2) 명시된 후 Bligh와 다이어에 따라 추출 계속합니다.
    6. 사용할 때까지 -20 ° C에서, (권 / 1 권 1) 메탄올 용액 : 클로로포름 100 ㎕에 보관 정제 지질 클래스입니다.

리파제의 생리 기판 5. 체외 확인

참고 : 체외 접근 방식에 관심 리파아제가 해당 가수 분해성에 고립 된 지질 또는 개별 순수한 지질의 혼합물을 변환 할 수 있는지 여부를 연구3.2에서 최적으로 정의 된 조건이 Analysis 제품.

  1. PC 관련 포스 포 리파제 C SMc00171 (5.2 참조), 포스 포 리파제 A (5.3 참조), DAG 리파제 SMc01003 표 3에 따라 효소 분석을위한 피펫 팅 방식을 사용하여 활동 (5.4 참조).
  2. PC 관련 포스 포 리파제 C 활동 (표 3)의 결정.
    1. 1.5 ml의 마이크로 원심 튜브로 분당 5000 카운트 총 14 C 표지의 PC (CPM) 및 트리톤 X-100 용액을 추가한다.
    2. 질소의 흐름에 따라 혼합 및 건조.
    3. 99.5 ㎕의 최종 부피를 얻기 위해 디 에탄올 아민 - 염산, pH가 9.8 완충액뿐만 아니라 염화나트륨 및 MnCl 2 용액 및 증류수에 추가. 5 초 동안 소용돌이.
    4. 효소 (5 μg의 단백질) 0.5 μl를 추가하여 반응을 개시하기 위해 (즉, 무 세포 추출액되는 SMc00171가 존재 과발현). 간략하게 섞는다.
    5. 4 시간 동안 30 ° C에서 품어.
    6. 바이 반응을 정지메탄올 250 μL 및 클로로포름 125 μL 첨가.
    7. 전술 한 바와 같이 지질 (4.2 참조)의 압축을 풉니 다.
    8. 하나의 차원 (1D) -TLC로 구분 지질 (4.3.2 및 4.4 참조), PSL 영상으로 그것들을 분석 할 수 있습니다.
  3. 포스 A는 활성의 측정 (표 3).
    1. 1.5 ml의 microcentrifuge 관에, 5,000 총 14 C 표지 인지질의 CPM 및 트리톤 X-100 용액을 추가 할 수 있습니다.
    2. 질소의 흐름에 따라 혼합 및 건조.
    3. 최종 100 ㎕의 분석을 위해, 트리스 - 염산, pH가 8.5 버퍼, NaCl 용액과 물을 추가 할 수 있습니다. 5 초 동안 소용돌이.
    4. 효소의 5 μL (50 μg의 단백질)을 추가 (즉, 무 세포 추출액되는 SMc00930 또는 SMc01003가 존재 과발현).
    5. 5 시간 동안 30 ° C에서 품어.
    6. 메탄올 250 μL 및 클로로포름 125 μL를 첨가하여 반응을 정지.
    7. 별도 전술 한 바와 같이 지질 (4.2 참조) 추출1D-TLC 130 ㎖의 클로로포름 50 ㎖의 메탄올과 이동상으로서 20 ml의 빙초산을 사용하고, PSL 촬상하여이를 분석하여 이들.
  4. 디아 실 글리세롤 (DAG) 리파제 활성의 결정.
    1. 14 C 표지 DAG의 준비.
      1. 방사성 표지 S. meliloti 문화 (4.1 참조) 한 바와 같이 (4.2 참조) 극성 지질의 압축을 풉니 다. 분리 된 S. 메탄올 : 클로로포름 1D-TLC에 의해 meliloti 총 지질 추출물을 아세트산 (130 : 50 : 20; 부피 / 부피) 4.3.1에서 두 번째 차원의 분리에 설명 된 조건을 사용하여.
      2. 요오드 염색으로 PC를 시각화하고 포스파티딜콜린 (PC)의 현지화를 표시하기 위해 연필을 사용합니다.
      3. 4.5에 기재된 방사성 표지 된 PC를 분리.
      4. 섬광 계수에 의해 추출 된 PC를 정량화.
        참고 : 약 320,000 CPM의 PC가 예상된다.
      5. 50 mM 트리스 - 염산, pH가 7.2, 0.5에서 클로스 트리 디움 퍼프 린 젠스에서 포스 포 리파제 C의 0.1 U와 PC (25 만 CPM)을 치료% 트리톤 X-100 100 ㎕의 총 부피에서 2 시간 동안 10 mM의 CaCl2를 메탄올 250 μL 및 클로로포름 125 μL를 첨가하여 반응을 정지.
      6. 1D-TLC (4.3.2 참조) 그들에 의해 이전에 별도의 설명에 따라 지질의 압축을 풉니 다.
      7. 실리카 플레이트로부터 디아 실 글리세롤을 분리하고 (4.2에 기재된 바와 같이), 섬광 계수에 의해 정량화
    2. 디아 실 글리세롤 리파제 분석 (표 3).
      1. 1.5 ml의 microcentrifuge 관에, 5000 14 C 표지 DAG의 CPM 및 트리톤 X-100 용액을 추가 할 수 있습니다.
      2. 질소의 흐름에 따라 혼합 및 건조.
      3. 최종 100 ㎕의 분석을 위해, 트리스 - 염산 (산도 9.0) 버퍼하는 NaCl 용액과 증류수에 추가합니다. 5 초 동안 소용돌이.
      4. 효소의 5 μL (무 세포 추출물 50 μg의 단백질)를 첨가하여 반응을 개시.
      5. 4 시간 동안 30 ° C에서 품어.
      6. 메탄올 250 μL를 첨가하여 반응을 정지전술 한 바와 같이 클로로포름 추출물 지질 D 125 μL (4.2 참조).
      7. 1D-TLC (4.1.3.2 참조) 이후 PSL 이미지로 중성 극성 지질을 분석합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

비스 P는 -nitrophenyl 인산와 PC 고유의 포스 C SMc00171의 활동

E. 얻은 무 세포 추출물 대장균 BL21 (DE3)는 smc00171가 형성된 P는 -NP을 측정하는 분광 효소 분석을 이용하여, 비스 페이지 -nitrophenyl 인산 에스테르를 가수 분해하는 능력에 대해 연구 하였다 표현했다 pLysS 균주를, X. 어떤 가수 활동은 E.에서 얻은 무 세포 추출물에 존재하지 않는 P의 -nitrophenyl 인산 기판으로서 사용 하였다 비스 -시 (데이터는 도시하지 않음)에 대장균 BL21 (DE3) pLysS를 X 빈 pET9a 벡터를 형질.

형성된 P는 -NP 시간 코스 SM했다 pLysS 균주를 X 대장균 BL21 (DE3)에서 무 세포 추출물의 양에 강한 의존성이 (가 발생한 것을 나타 내기c00171)의 표현 분석 (그림 2A)에 추가됩니다. 형성 P는 -NP 제품의 양이 효소의 농도에만 의존 할 경우, 일정 시간 후에 형성 효소 (단백질) 사이에 선형 상관 관계 농도 채용 및 제품을 준수해야합니다. 분명히, 이는 E. 얻은 무 세포 추출물이 아니다 대장균 BL21 (DE3)는 smc00171 표현했다 pLysS를 (그림 2B)를 X. 단백질 농도 (21)에 효소 활동의 지수 의존성에 대한 몇 가지 이유가있을 수 있지만, 빈번한 이유는 효소 함유 단백질 추출물의 희석에, 추출물의 다른 구성 요소가 효소 활성, 즉, 잠재적 보조 인자에 대한 제한 될 수 있다는 것입니다 뿐만 아니라 희석된다. 이러한 경우에, 예상치 못한 낮은 효소 활성 묽은 무 세포 추출물과 함께 등록된다. 효소 분석에서 MnCl 2 3 mm의 포화 농도를 포함함으로써, P 일정 시간에만 효소의 양에 따라 달라 후에 형성 -NP 생성물 MnCl 2 E.의 무 세포 추출물 SMc00171 활동에 대한 제한 요소임을 나타낸다 (데이타는 도시되지 않음)를 첨가 대장균.

그림 2
인공 기판 비스 피의 -nitrophenyl 포스페이트를 사용 SMc00171 (포스)의 활동도 2 결정. 피의 -NP 형성 시간 코스는 15 ㎍ / mL로 ■ 10 ㎍ / ml의 ● (무 세포 단백질 추출물을 이용하는 것으로 도시되어 ▲ SMc00171는 (표현했다있는 A). SMc00171 표현했다되는 무 세포 단백질 추출물 서로 다른 양의 (B)와 배양의 40 분 후에 형성 P는 -NP 20 μg의 / ㎖). 오차 막대는 표준 편차를 나타냅니다..jove.com / 파일 / ftp_upload / 54613 / 54613fig2large.jpg "대상 ="_ 빈 ">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

다른 체인 길이의 P는 -Nitrophenyl 아실 에스테르와 포스 포 SMc00930 및 SMc01003 예측 파타 틴-등의 활동

E.에서 smc00930 또는 smc01003의 발현 후 대장균 BL21 (DE3)은 pLysS 균주는 무 세포 추출물을 수득하고, P의 -nitrophenyl 지방산 아실 에스테르를 가수 분해하는 능력에 대해 연구 하였다 X. 효소 분석 중에 형성된 P 개의 -NP 분광 광도계로 측정 하였다. 마이너 가수 활동은 E.에서 얻은 무 세포 추출물에 존재 differe의 대장균 BL21 (DE3)는 빈 pET17b 벡터로 pLysS 균주를 X (표 4) P는 -nitrophenyl 아실 에스테르NT 사슬 길이를 기판으로 사용 하였다. smc01003 표현했을 때, 수득 된 추출물을 다른 사슬 길이의 피의 -nitrophenyl 에스테르 가수 분해의 증가를 보였다. SMc01003는 중쇄 피의 -nitrophenyl 카노 에이트뿐만 아니라, 장쇄 피의 -nitrophenyl 팔미 테이트 및 P -nitrophenyl 스테아르 산 (표 4)를 분해. SMc01003는 S.에서 장쇄 유리 지방산의 형성에 중요한 기여자이므로 meliloti 정지상 (11) 동안, SMc01003가 긴 사슬 P는 -nitrophenyl 아실 에스테르 (표 4)보다 중간 체인에 동일하게 행동하는 것처럼 보였다 것은 놀라운 일이었다. 예기치 않게, SMc01003는 또한 P의 -nitrophenyl 부티레이트 또는 P -nitrophenyl 옥 탄산 등의 단쇄 기판에 작용한다 (데이터는 보이지 않음). 그러나, 이러한 후자의 기판은 E.의 무 세포 추출물에 존재하는 활동에 의해 분해되어 대장균 (즉, 빈 VECT을 숨겨또는 여분의 유전자 단쇄 기질 (C4)를 발현하지 pET17b) 기판의 절반 이미 E. 의해 분해되어 콜라이 극한 효소 (데이터 미도시). 분명히 SMc01003는 SMc01003은 단기 중기 및 장쇄 기판 상에 동일하게 잘 작동하는지 규명하기 위하여 정제 할 필요가있다. 일반적으로, P는 -nitrophenyl 아실 에스테르 SMc01003 현실 DAG의 리파제 (11)에 있음을 알고 이해할 수 있습니다 SMc01003 좋은 기판 수없는 것 같다. smc00930 표현했다되는 무 세포 추출물, P는 -nitrophenyl 에스테르 (표 4)와 더 높은 효소 활성을 보여줍니다. (- 1 mg의 단백질 1 - 특이 활성 5.5 밀리몰 NP 최소) 분명하다 피의 -nitrophenyl 팔미 비록 또한 SMc00930가 상이한 사슬 길이 (C10, C12, C14, C16 및 C18)의 P는 -nitrophenyl 아실 에스테르를 가수 분해 할 수있다 SMc00930에 가장 기판. 현재까지 physioloSMc00930에 대한 학적 기판은 알려져 있지 않다.

여부 폴라 지질을 탐구하는 것은 예측 (포스) 리파제에 대한 기질로서 기능 할 수있다

A (포스) 리파제 효소 분석은 인공 기질, 방사성 표지 된 지질의 혼합물 또는 순수 지질 최적화되면 잠재적 기질로서 시험 할 수있다.

최적의 조건에서 14 C 표지 PC와 무 세포 추출물을 SMc00171이 함유 시금 때, 우리는 SMc00171가 DAG, 질량 분석 연구 (8)에 의해 확인 된 결과에 PC를 저하 것을 보여 수 있습니다. SMc00171는 또한이 성장 인 제한 조건 하에서 유도하는 PC 관련 포스 포 리파제 C (PLCP) 8 역할을 따라서 포스 포 콜린하는 32 P - 라벨 PC를 분해합니다.

언제시금 SMc00930- 또는 SMc01003이 함유 최적화 된 조건에서 14 C-32 P-표시된 총 극성 지질과 무 세포 추출물을, 우리는 인지질 중 어느 것도 P는 -nitrophenyl 아실 에스테르가 작용 조건에서 SMc00930 또는 SMc01003에 의해 분해되지 않았 음을 보여줄 수 로 (11)를 기판들. 반대로, 뱀 독으로부터 상업적 포스로 2 인지질 (11)의 이러한 혼합물을 분해 할 수 있었다. 이러한 결과는 놀라운 일이 모두 같은 예기치 않은 있었다 SMc00930 및 SMc01003는 포스 포-등을 파타 틴 될 것으로 예측했다.

SMc00930- 또는 SMc01003이 함유 최적화 된 조건에서 14 C- 표지 디아 실 글리세롤 (DAG)와 무 세포 추출물을, 우리가 DAG가 SMc00930 또는 E.의 무 세포 추출물에 의해 분해되지 않는다는 것을 보여줄 수를 분석하는 경우 대장균, SMc01003는 DAG 저하 및 유리 지방산과 같은 마이그레이션 화합물을 형성하는 반면 (그림 3). 최근에 우리는 SMc01003가 DAG 저하 또는 글리세롤과 유리 지방산 (11) (그림 4)에 모노 아실 글리세롤 수있는 DAG 리파제의 역할을 보여 수 있습니다.

그림 3
그림 3. SMc01003은 디아 실 글리세롤을 저하시킨다. E.의 무 세포 추출물 pLysS 균주가 SMc01003, SMc00930을 표현하거나 빈 pET17b 벡터를 포함, 또는 버퍼 × 대장균 BL21 (DE3)을 24 시간 동안 (S.의 meliloti에서 얻은) (14) C-DAG와 함께 배양 하였다. 각 인큐베이션 기간의 끝에서, 방사성 표지 된 지질을 추출하고, 중성 극성 지질을 분리하기위한 이동상 (4.3.2 참조)를 사용 1D-TLC로 분리. FA, 지방산; DAG, 디아 실 글리세롤. 이 수치는 [Sahonero-Canavesi 등. 2015] (11)에서 수정되었습니다.3large.jpg "대상 ="_ 빈 ">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
그림 4. 효소 디아 실 글리세롤 리파제 DGLA (SMc01003)의 기능. 디아 실 글리세롤 (DAG) 리파제 SMc01003는 모노 아실 글리세롤과 하나 지방산에 DAG를 저하하고 글리세롤과 다른 지방산에 더 모노 아실 글리세롤을 저하시킨다. 이의 더 큰 버전을 보려면 여기를 클릭하십시오 그림.

올리고 뉴클레오티드
이름
순서
(5'-3 ')
유전자
관심
효소 제한
사이트 추가
벡터
표현
oLOP149 AGGAATA CATATG CTGAACTGGACATTCACG smc01003 이니까 I pET17b
oLOP150 ACGG CTCGAG TCAACGGGACAGCGGTTC smc01003 을 XhoI pET17b
oLOP151 AGGAATA CATATG ACGGAGGTGGCGATGG smc00930 이니까 I pET17b
oLOP152 AAA GGATCC TTATATCCCTTTCCTCCACC smc00930 HI pET17b
cgpho171u AGCT CATATG GCGGCGGCATCGGCACCCCACAG smc00171 이니까 I pET9a
cgpho171d ACGT GGATCC TCAGGCGGCCTGCGGTGCGAACC smc00171 HI pET9a
굵은 글자 제한 부위를 나타냅니다.

증폭 복제하는 데 사용되는 표 1. 올리고 뉴클레오티드는 pET17b 또는 pET9a 벡터로 포스 (지방 분해 효소) 유전자를 예측했다. 프라이머 올리고 뉴클레오티드는 설명 소프트웨어 (15)를 사용하여 설계되었다.

SMc00171에 대한 분석 SMc01003에 대한 분석 SMc00930에 대한 분석
스톡 구성 요소
트리스 -HCl, pH가 8.5 25 μL
2 M 트리스 -HCl, pH가 9.0 25 μL
1 M 디 에탄올 아민 염산, pH가 9.8 50 μL
1 M 염화나트륨 40 μL 150 μL 150 μL
1% 트리톤 X-100 200 μL 200 μL
50 mM의 P- 니트로 페닐 팔미 테이트 12.5 μL 12.5 μL
200 밀리미터 비스 P- 니트로 페닐 인산 2.5 μL
무 세포 추출물 (1 mg을 PROTEIN 후보 유전자 / ml)를 나타낼 20 μL 100 μL 1 μL
증류수에 887.5 μL 512.5 μL 611.5 μL
최종 권 1 ml의 1 ml의 1 ml의

인공 페이지 -nitrophenyl 에스테르 기판에 최적화 된 효소 분석 표 2. 피펫 방식.

smc00171 인코딩 된 포스 C에 대한 분석 smc01003에 대한 분석 - 인코딩 된 DAG의 리파제 포스 A 활동에 최적화 분석
스톡 구성 요소
2 M 트리스 - 염산 pH를 8.5 2.5 μL
2 M 트리스 - 염산 pH를 9.0 2.5 μL
100 밀리미터 MnCl 2 3 μL
1 M 디 에탄올 아민 - 염산 pH를 9.8 5 μL
1 M 염화나트륨 4 μL 15 μL 15 μL
1% 트리톤 X-100 2 μL 20 μL 20 μL 14 C 표지 지질 (인지질) 20 μL (5,000 CPM)
14 C - 표지 된 지질 (PC) 20 μL (5,000 CPM)
14 C 표지 지질 (DAG) 20 μL (5,000 CPM)
10 ㎎ / ㎖ 발현 후보 유전자 단백질 추출물 0.5 μL 5 μL 5 μL
증류수에 87.5 μL 77.5 μL 77.5 μL
최종 볼륨 100 μL 100 μL 100 μL

탁자최적화 된 효소 분석 (포스) 3. 피펫 방식은 방사성 표지 지질 기판과 리파제.

활성 (μmol의 니트로 페놀 / mg의 단백질 X의 분) 단위로 주어진다
굵은 숫자 P -nitrophenyl 에스테르 기판 아실 사슬 길이를 나타낼 (10) (12) (14) (16) (18)
E. 콜라이 추출물 (배경) 16 ± 0.3 10 ± 1.1 13 ± 0.3 11 ± 0.8 10 ± 0.6
SMc00930는 E. 표현 대장균 추출물 1839 ± 283 2873 ± 117 5517 ± 394 3402 ± 65
SMc01003는 E. 표현 대장균 추출물 43 ± 2.1 29 ± 2 20 ± 0.7 25 ± 1.5 22 ± 0.9
SMc00930 마이너스 배경 1823 ± 283 1829 ± 283 2860 ± 117 5506 ± 394 3392 ± 65
SMc01003 마이너스 배경 27 ± 2.1 18 ± 2 7 ± 0.7 14 ± 1.5 12 ± 0.9

파타 틴 같은 리파제 SMc00930 및 SMc01003 용 기판으로 표 4 페이지 -Nitrophenyl 아실 에스테르.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

지난 20 년 동안, 많은 생물의 게놈은 서열화되었다 및 게놈 시퀀스 데이터의 재산이 생성되었지만, 기능 해석은 뒤쳐 따라서 게놈 기능에 대한 우리의 이해를 방해한다. 게놈에서 유전자의 기능은 종종 알려진 기능 또는 보존 모티브의 발생 유전자의 유사성을 기준으로 할당됩니다. 그러나, 특정 유전자의 정확한 기능은 대개 알려져 있지 않다. 특히, 효소 구조 유전자를 쉽게 인해 대부분의 효소 및 기질이 두 제품을 포함하는 복잡한 반응을 촉진한다는 사실 오믹 기술에 의해 탐색 할 수없는 예측. 현재, 적어도 하나의 기판이 고정되고, 다른 어디에 변화시킬 수있는 효소의 그룹에 대한 기질 특이성을 탐구 더 실현 가능한 것으로 보인다. 예를 들어, 진핵 생물의 단백질에있는 대부분의 인산화 모티브는 알려진 키나제에 대한 합의 펩타이드는 펩타이드 AR을 생성하기 위해 고체 지지체에 발견되어있다광선입니다. kinome 프로파일의 확립을 가능하게 결정될 수있다 이러한 배열 및 방사성 표지 된 ATP 기질 특이성 및 유기체의 서로 키나제의 활성 수준을 사용하여 기판을 형성하는 24 특이성. 가수 분해 효소는 하나의 기판, 물, 고정되어 있지만, 어떤의 (다른) 기판의 정확한 성격은 종종 알 수없는 가수 분해 할 수있는 효소의 또 다른 큰 그룹을 구성한다. 새로운 효소에 대한 최적의 분석 조건은 어느 공지되지 않는다는 사실은, 다 변수 문제에 새로운 효소 활성의 검출을 변환한다. 따라서, 효소는 가장 적합한 조건으로 정의하기 위해 가수 분해 될 수있는 기판을 고정 할 수 있도록 도울 수도있다.

본 논문에서는 잠재 (포스)에 대한 분석 조건의 최적화를 설명 알 기질 특이성 리파아제 및 재 자연 기판에 대한 검색이 최적의 조건을 채용하는 방법을 상세히spective (포스) 리파제. 본 기술의 중요성은 어느 정도의 천연 기질을 모방, 형광 또는 발색 인공 기질의 가수 분해는 분광 광도법 25 따라야 할 수 있다는 사실에있다 이러한 분석이 대규모로 용이하게 적용 가능하다는 26 연구. 때문에 이러한 분석법의 민감성, 반응을 모니터링 단순함, 그들은 용이하게 특정 효소에 대해 최적화 될 수있다. 물론, 인공 기판 하나는 불리 운동 상수를 기대할 수 (즉, 높은 K M, 낮은 k 고양이) 자연 기판 1,21보다 특정 효소. 그러나 실제로, 인공 기판의 용이 한 이용 가능성 및 검출이 단점을 보완보다 종종 더 많은 효소들의 전체 그룹 (불량) 기판 인 것을 특징으로한다. (인공 기판과) 일할 수있는 효소의 조건을 발견 한 후,이 NATUR으로 그렇게 할 것입니다뿐만 아니라 알은 / 생리 기판. 잠재적 인 지질 기판의 제조 및 분리가 힘들고 시간 소모적 수있는 바와 같이, 효소가 결합하고 유용한 기판으로 배양 될 때 작동 할 준비가되어 있음을 보증하는 것이 중요하다. 중요한 것은, 제 효소가 작동하는 조건을 최적화하는 과정은, 새로운 (포스) 리파제 생리 기판의보다 신속한 식별을 허용한다. 개념의 증거로서, 우리는 성공적으로 리파제 SMc00171, SMc00930 및 SMc01003 8,11의 기질 특이성의 특성에 대해이 방법을 사용하고있다. 대조적으로, (포스) 리파아제 활동 분석을 확립 많은 전통적인 대체 방법은 기판과 제품이 이미 공지되어 반응을 수반한다.

물론, 분석의 변형이 표시 인공 기질을 발색 또는 그렇지 않으면 변화를 다른 형광의 사용을 포함 할 수있는 최적의 효소 활성을 검출하는효소 농도, 종류 및 버퍼의 농도 또는 기타 첨가제 (즉, 세제 또는 가의 양이온)의. 어떤 효소 활성이 인공 기판 검출되지 않는 경우, 각각의 효소는 단순히이 기판에 작동하지 않을 수도 있지만, 이러한 경우 문제 해결은 확실히 효소 활성을 그대로 유지하는 것이 필요되었을 수 있습니다 모든 예방 조치가 취해 있었다 확신을 가지고이 포함되어야 27 (필요한 경우 즉, 4 ° C에서 무 세포 추출물 또는 사용할 때까지 낮은 온도 및 저장, 위해 무 세포 추출물에 단백 분해 효소 억제제의 칵테일을 추가하면 관심있는 효소의 단백질 분해 저하를 방지하기 위해).

이 논문에 제시된 기술의 제한은 촉매 반응뿐만 아니라 1 일 것이기 인공 기판과 천연 기질은 생체 에너지 및 서로 다른 결과는 사실에 기인한다. 다양한 파효소 활성의 최적 조건 ameters 자연 기판에도 확립한다 (강도 버퍼, 버퍼의 종류의 pH를 변화시킴으로써, 예컨대 트리톤 X-100, 부재 또는 다른 가의 양이온의 존재와 같은 NaCl을 세제 농도) 그들이 끌 수로 인공 기판에 대해 발생하는 최적의 조건에서 다소 차이가있을 수 있습니다. 또 다른 중요한 제한은 아마 모든 (포스) 리파제 인공 발색 기판의 사용에 의해 검출 점이다. 예를 들어, 에스테르 기판의 인공 피의 -nitrophenyl 잔기 단순히 너무 부피, 또는 그러한 기재는 효소의 활성 부위에 접근 할 수있는 다른 방지의 화학적 특성을 나타낼 수있다. 그것은 DAG 리파아제 SMc01003 다른 사슬 길이 11의 모든 페이지의 -nitrophenyl 에스테르 기판과 낮은 활동을 표시하는 것이 관찰되었다. DAG는 SMc01003과 그 자연 기판 인 지식 DAG는 REL이글리세롤로 이루어진 atively 작은 극성 헤드 그룹은 11 만, 상기 벌키 피의 -nitrophenyl 잔기 단순히 SMc01003의 활성 사이트에 쉽게 액세스 너무 큰 것을 쉽게 상상할 수있다. 그러나 SMc01003에 대한 P는 -nitrophenyl 에스테르 좋은 기판하지 않은 이유를 분자 세부 사항은이 시점에서 알려져 있지 않다.

프로토콜 내에서 중요한 단계 연구 효소가 각각의 기판에 액세스 할 수 있는지 확인하는 데 걸리는 모든 조항을 포함한다. 예를 들어, 생리 지질 기재의 검색에서, 상기 지질 기판은 가용화 형태로 제공하는 것이 중요하다. 효소 분석법을 설정할 때 따라서, (프로토콜 5에 기재되어 있음), 일반적으로 메탄올의 혼합물에 용해 된 지질 기질 : 클로로포름, 세제의 물 용액과 혼합한다, 트리톤 X-100, 다운 전에 건조 질소 가스 혼합물. 이 절차 보장, 그 나머지 Ingre의를 추가 한 후분석 용 또는 성분들은 잠재적 지질 기재 세제 미셀 및 분석 중에 효소 이러한 접근으로 매립된다.

원칙적으로, 여기에서 제시된 기술은 새로운 (포스) 리파제의 발견 및 자연 기판의 정의는 미래에 널리 적용 할 수 있어야한다. 이 기술은 가수 분해 효소의 다른 클래스를 쉽게 확장 할 수 있지만, 자신의 촉매 사이클을 완료하는 데이 일반적으로 알 수없는, 기판을 요구하는 새로운 효소 인공 기판과 분석을 개발하는 것이 더 복잡 할 수 있습니다.

예측 (포스) 리파제 또는 올바른 기판이 모두 알려져 포스 파타 아제 나 효소가 잘 작동하는 분석 조건. 따라서, 공부에 유용 할 수 있습니다와 같은 별개의 P는 -nitrophenyl 함유 화합물 (P는 -nitrophenyl 인산, 비스 P는 -nitrophenyl 인산 인공 화합물의 배터리에서 일부 화합물 여부, 또는 P -nitrophenyl 팔미 테이트)는 기판 역할을 할 수 있습니다. 인공 기판과 초기 효소 활성의 발견은 SMc01003는 DAG 리파제 (11)이다, SMc00171는 PC 전용 포스 포 리파제 C (8) 것을 해결하기 위해 도로를 포장하고, SMc00930가 가수 분해 효소 (11)의 역할을하는 조건을 정의하는 데 도움이되었습니다. 물론, SMc00930의 자연 기판은 현재 여전히 알 수없는 및 SMc00930 및 SMc01003의 생리적 상황은 여전히 ​​해결해야한다. 따라서, 예측 리파제의 생리 기능을 제안하는 작업은 도전하고 항상 즉시 성공을 충족하지. 예측 리파아제 유전자가 결핍 된 돌연변이 체를 사용하고, 각각의 야생형 균주로 비교하는 리파아제가 프로토콜의 일부 4)에서 가정 된 네이티브 변형 배경의 특이성과 역할을한다는 실험적 증거를 제공 할 수 있습니다. 분명히, 새로운 리파아제 활성 SH의 제특정 기판이 정의 된 제품으로 가수 분해에 의해 변환 된 시험 관내 증거에 의해 지원 될 울드. 때로는 가정 생리 기능이 대사 경로에 차이를 보충 또는 생산 유기체의 생리적 행동을 설명하지만, 다른 경우에이 단순히 여전히 활동을 이해하기에 충분한 생화학 적 지식을하지 않을 수 있습니다. 우리의 연구의 과정에서, 우리는보다 복잡한 지질 사이클 플레이어로 변환 어떤 경우에는이를 분해 세균의 극한 극성 지질 막에 작용하는 여러 효소를 식별. 예를 들어, 새로운 기술을 조합하면 SMc00171는 기존 데이터를, 성장 인 제한 조건 하에서 유도되는 PC 관련 포스 포 리파제 C (PLCP) (8) 즉, 하나는 많은 환경 프로 테오 박테리아에 존재할 수있는 신규 DAG 사이클을 가정하고 수 이는 인 성장 제한적인 경우 인 프리 막 지질의 형성을 일으킨다. 제어 방식에서인 공급이 풍부 할 때 AST, DAG는 포스 산함으로써이 지질주기를 폐쇄, 드 노보 인지질의 생합성을 입력하고 주로 (글리세) 인지질이 막 8,28에 존재하는 것을 보장에 rephosphorylated된다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 아무것도 없어.

Acknowledgments

이 작품은 (Investigación 엉 Fronteras 드 라 Ciencia에서 Investigación Científica BASICA에서 82614, 153998, 253549 및 178359뿐만 아니라 118) 및 Dirección 일반 드에서 Consejo 나시 오날 드를 CIENCIAS Y TECNOLOGIA - 멕시코 (CONACYT 멕시코)에서 보조금에 의해 지원되었다 (DGAPA - UNAM, PAPIIT IN202616, IN203612) Asuntos 드 개인 Académico-대학교 나시 오날 자치시 드 멕시코.

Materials

Name Company Catalog Number Comments
Chloroform JT Baker 9180-03 TLC analysis & Lipid extraction
Methanol JT Baker 9070-03 TLC analysis & Lipid extraction
Acetic Acid JT Baker 9507-05 TLC analysis & Lipid extraction
Hexanes JT Baker 9309-02 TLC analysis & Lipid extraction
Diethylether Sigma 32203 Enzymatic assays
bidistilled water  ANY  NA Enzymatic assays
Tris Base Sigma T-1503 Enzymatic assays
HCl Baker 9535-02 Enzymatic assays
NaCl Baker 3624-01 Enzymatic assays
Triton X-100 Sigma X-100 Enzymatic assays
LB broth ANY NA Bacterial growth, 10 g tryptone + 5 g yeast extract + 10 g NaCl per liter of bidistilled water
tryptone Becton Dickinson and Company 211705 Bacterial growth
yeast extract Becton Dickinson and Company 212750 Bacterial growth
TY broth ANY NA Bacterial growth, 8 g tryptone + 3 g yeast extract + 66 mg CaCl2·2H2O per liter of bidistilled water
CaCl2·2H2O Baker 1332-01 Enzymatic assays
isopropyl-β-D-thiogalactoside (IPTG) Invitrogen 15529-019 Bacterial growth
Diethanolamine Sigma D-8885 Enzymatic assays
MnCl2 Sigma 221279 Enzymatic assays
Phospholipase A2 snake venom Sigma P0790 Enzymatic assays
Phospholipase C Clostridium perfringens Sigma P7633 Enzymatic assays
Bis-p-nitrophenyl phosphate Sigma 07422AH Enzymatic assays
p-nitrophenyl stearate Sigma N3627 Enzymatic assays
p-nitrophenyl dodecanoate Sigma 61716 Enzymatic assays
p-nitrophenyl decanoate Sigma N0252 Enzymatic assays
p-nitrophenyl palmitate Sigma N2752 Enzymatic assays
p-nitrophenyl butyrate Sigma N9876 Enzymatic assays
p-nitrophenyl octanoate Sigma 21742 Enzymatic assays
Acetic Acid, sodium salt [1-14C] Perkin Elmer NEC084 Bacterial growth
dimethylsulfoxide (DMSO) JT Baker 9224-01 Enzymatic assays
Aluminium HPTLC silica gel 60 plates. Silica gel HPTLC plates size 20 x 20 cm, 25 sheets. Merck 105547 TLC analysis & Lipid extraction
Spectrometer UV/VIS Lambda 35 Perkin Elmer NA Enzymatic assays
Storm 820 Phosphorimager Molecular Dynamics NA Photostimulable Luminescence scanner 
Multipurpose Scintillation Counter Beckman Coulter NA Radioactivity Quantification
French Pressure Cell ThermoSpectronic NA  Breakage of cells
chromatography paper 3MM Chr Whatman 3030917 TLC analysis
Sinorhizobium meliloti 1021our reference 11 studied strain
Escherichia coli BL21 (DE3) pLysS Competent cells Novagen 69451 protein expression strain
pET9a vector Novagen 69431 protein expression vector
pET17b vector Novagen 69663 protein expression vector
sterile polystyrene round-bottom tube (14 ml) Falcon Becton Dickinson 352057 radiolabeling of bacterial cultures
polypropylene microcentrifuge tubes (1.5 ml) Eppendorf 30125.15 Enzymatic assays
1,2-dipalmitoyl-sn-glycerol Sigma D9135 lipid standard
L-α-phosphatidylcholine, dipalmitoyl Sigma P6267 lipid standard
DL-α-monopalmitin Sigma M1640 lipid standard
palmitic acid Sigma P0500 lipid standard

DOWNLOAD MATERIALS LIST

References

  1. Nelson, D. L., Cox, M. M. Lehninger, Principles of Biochemistry. W. H. Freeman and Company. New York. (2013).
  2. Jaeger, K. E., Eggert, T. Lipases for biotechnology. Curr. Opin. Biotechnol. 13, (4), 390-397 (2002).
  3. Dowhan, W., Bogdanov, M., Mileykovskaya, E. Functional roles of lipids in membranes. Biochemistry of Lipids, Lipoproteins and Membranes. 5th, Elsevier. Amsterdam, The Netherlands. 1-37 (2008).
  4. Dowhan, W. Molecular basis for membrane phospholipid diversity: why are there so many lipids? Annu. Rev. Biochem. 66, 199-232 (1997).
  5. De Rudder, K. E. E., Thomas-Oates, J. E., Geiger, O. Rhizobium meliloti mutants deficient in phospholipid N-methyltransferase still contain phosphatidylcholine. J. Bacteriol. 179, 6921-6928 (1997).
  6. Geiger, O., Röhrs, V., Weissenmayer, B., Finan, T. M., Thomas-Oates, J. E. The regulator gene phoB mediates phosphate stress-controlled synthesis of the membrane lipid diacylglyceryl-N,N,N-trimethylhomoserine in Rhizobium (Sinorhizobium) meliloti. Mol. Microbiol. 32, (1), 63-73 (1999).
  7. Klug, R. M., Benning, C. Two enzymes of diacylglyceryl-O-4'-(N,N,N,-trimethyl)homoserine biosynthesis are encoded by btaA and btaB in the purple bacterium Rhodobacter sphaeroides. Proc. Natl. Acad. Sci. USA. 98, (10), 5910-5915 (2001).
  8. Zavaleta-Pastor, M., et al. Sinorhizobium meliloti phospholipase C required for lipid remodeling duringphosphorus limitation. Proc. Natl. Acad. Sci. USA. 107, (1), 302-307 (2010).
  9. Pech-Canul, A., et al. FadD is required for utilization of endogenous fatty acids released from membrane lipids. J. Bacteriol. 193, (22), 6295-6304 (2011).
  10. Banerji, S., Flieger, A. Patatin-like proteins: a new family of lipolytic enzymes present in bacteria? Microbiology. 150, (Pt 3), 522-525 (2004).
  11. Sahonero-Canavesi, D. X., et al. Fatty acid-releasing activities in Sinorhizobium meliloti include unusual diacylglycerol lipase. Environ. Microbiol. 17, (9), 3391-3406 (2015).
  12. Fischer, M., Pleiss, J. The Lipase Engineering Database: a navigation and analysis tool for protein families. Nucl. Acid. Res. 31, (1), 319-321 (2003).
  13. Sigrist, C. J. A., et al. New and continuing developments at PROSITE. Nucleic Acids Res. 41, (Database issue), D344-D347 (2013).
  14. Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998 (2012).
  15. Untergasser, A., et al. Primer3 - new capabilities and interfaces. Nucl. Acids Res. 40, (15), e115 (2012).
  16. Studier, F. W., Rosenberg, A. H., Dunn, J. J., Dubendorff, J. W. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89 (1990).
  17. Miller, J. H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press. Plainview, NY, USA. (1972).
  18. Desjardins, P., Hansen, J. B., Allen, M. Microvolume Protein Concentration Determination using the NanoDrop 2000c Spectrophotometer. J. Vis. Exp. (33), e1610 (2009).
  19. Bligh, E. G., Dyer, W. J. A rapid method for total lipid extraction and purification. Can. J. Biochem. Physiol. 37, (8), 911-917 (1959).
  20. Molecular Dynamics. Phosphorimager SI User´s Guide. http://www.camd.lsu.edu/SAXS/Files/PIManual.pdf (1994).
  21. Dixon, M., Webb, E. Enzymes: Third Edition. Longman, USA. (1979).
  22. Rudolph, A. E., et al. Expression, characterization, and mutagenesis of the Yersinia pestis murine toxin, a phospholipase D superfamily member. J. Biol. Chem. 274, (17), 11824-11831 (1999).
  23. Kato, S., Yoshimura, T., Hemmi, H., Moriyama, R. Biochemical analysis of a novel lipolytic enzyme YvdO from Bacillus subtilis. Biosci. Biotechnol. Biochem. 74, (4), 701-706 (2010).
  24. Peppelenbosch, M. P. Kinome profiling. Scientifica (Cairo). Article ID 306798 (2012).
  25. Manafi, M., Kneifel, W., Bascomb, S. Fluorogenic and chromogenic substrates used in bacterial diagnostics. Microbiol. Rev. 55, (3), 335-348 (1991).
  26. Kuznetsova, E., et al. Enzyme genomics: Application of general enzymatic screens to discover new enzymes. FEMS Microbiol. Rev. 29, (2), 263-279 (2005).
  27. Scopes, R. K. Protein Purification, Principles and Practice. Springer. New York. (2010).
  28. Geiger, O., Lopez-Lara, I. M., Sohlenkamp, C. Phosphatidylcholine biosynthesis and function in bacteria. Biochim. Biophys. Acta. 1831, (3), 503-513 (2013).
리파제 및 포스 후보자에 대한 기질 특이성을 정의
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).More

Sahonero-Canavesi, D. X., Zavaleta-Pastor, M., Martínez-Aguilar, L., López-Lara, I. M., Geiger, O. Defining Substrate Specificities for Lipase and Phospholipase Candidates. J. Vis. Exp. (117), e54613, doi:10.3791/54613 (2016).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter