Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Epizomal vektörlerin kullanılması insan periferik kan mononükleer hücrelerinden entegrasyon içermeyen uyarılmış pluripotent kök hücrelerin üretilmesi

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Uyarılmış pluripotent kök hücrelerin (iPSCs) hastalığı modelleme ve rejeneratif tedaviler için büyük umut tutun. Daha önce periferal kan tek-çekirdekli hücreleri (PB MNC) Entegrasyon içermeyen iPSCs oluşturmak için epizomal vektörlerin (EV) kullanımını bildirdiler. Kullanılan epizomal vektör, sırasıyla, memeli hücrelerinde plazmid replikasyonu ve uzun süreli tutuculuk izin Epstein-Barr (EB) virüs oriP ve EBNA1 serisi elemanları ile dahil, DNA plasmidleri bulunmaktadır. Daha fazla optimizasyonu ile, iPSC koloni binlerce periferal kan 1 mL elde edilebilir. yüksek yeniden programlama verimi elde etmek için iki kritik faktörler şunlardır: 1) 2A kullanımı "öz-bölünme" peptid böylece iki faktörün ekimolar ifadesini elde, Oct4 ve Sox2 bağlamak; 2) İki vektörün kullanımı myc ve Klf4 ayrı ayrı ifade etmek. Burada entegrasyon-Free IP üretmek için bir adım-adım protokolü açıklamakErişkin periferik kan örneklerinden SC'ler. artık epizomal plazmidler beş pasajlar sonra saptanamaz olarak üretilen iPSCs entegrasyon içermez. yeniden programlama verimliliği Sendai virüsü (SV) vektörler ile karşılaştırılabilir olduğu, ancak, EV plasmidleri çok daha ekonomik bir ticari olarak temin edilebilir SV vektörler daha vardır. Bu uygun fiyatlı EV yeniden programlama sistemi rejeneratif tıp klinik uygulamalar için potansiyel tutar vb entegrasyon serbest mezenkimal kök hücrelerin, nöral kök hücreler, PB çokuluslu şirketlerin doğrudan yeniden programlama için bir yaklaşım sağlar.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

birkaç transkripsiyon faktörlerinin zorla ifade sonra (Yani Oct4, Sox2, MYC ve Klf4), somatik hücre yenileyici tıp ve hücre replasman tedavisinde 1-3 uygulamalar için büyük umut tutun kaynaklı pluripotent Kök Hücre (iPSCs), için yeniden olabilir. Bugüne kadar, çeşitli yöntemler 4-7 yeniden programlama başarı oranını arttırmak için geliştirilmiştir. Viral entegrasyon yeniden programlama faktörleri, yüksek düzeyde stabil ekspresyon yol açtığı için viral vektörler kaynaklı yeniden programlama yaygın iPSCs verimli üretimi için kullanılır. Ancak, hücre genomuna vektör DNA kalıcı entegrasyon sokma mutagenezi 5 indükleyebilir. Buna ek olarak, yeniden programlama faktörleri yetersiz inaktivasyon iPSCs farklılaşmayı 8 rahatsız edebilir. Bu nedenle, yeniden programlama faktörleri katılımı olmadan iPSCs kullanımı, özellikle, hücre terapisi uygulamalarında kullanımı için zorunludur.

9 iki elemanları, viral replikasyon (oriP) EB Nükleer Antijen 1 (EBNA1 serisi) kökeni içeren bir plazmiddir. EBNA1 serisi elemanı konakçı hücrenin bölünmesi sırasında epizom bölünmesi sağlar kromozomal DNA'ya oriP içeren plazmid DNA tethers ise oriP elemanı, memeli hücrelerinde plazmid replikasyonunu teşvik eder. Sendai virüsü (SV) ve RNA transfeksiyonu da dahil olmak üzere diğer entegrasyon içermeyen yaklaşımlar ile kıyaslandığında EVS çok sayıdaki avantajları, 5,6,10 sahiptirler. Onları son derece uygun hale plazmid DNA olarak, AGH kolayca üretilebilir ve evde güncellenmiştir. Buna ek olarak, EV yeniden programlama çeşitli RNA transfeksiyon başarı yeniden programlama için gerekli olan ise EVs tek bir transfeksiyon, iPSC üretimi için yeterli olan daha az olan bir emek-yoğun bir işlemdir.

DErmal fibroblastlar birçok yeniden programlama çalışmalarında kullanılmıştır. Ancak, deri biyopsisi invaziv ve ağrılı bir süreç değil, aynı zamanda yeniden programlama için yeterli miktarlarda hücreleri genişletmek için zaman alıcı değil sadece. Daha büyük bir endişe, yetişkin donörlerin deri hücreleri genellikle böylece deri fibroblastları 11,12 türetilen iPSCs başvurularını sınırlayıcı, tümörlerle ilişkili mutasyonlara yol açabilir uzun süreli UV ışık radyasyon, maruz kalmıştır. Son zamanlarda, normal insan derisi hücreleri somatik mutasyonlara ve deri skuamöz hücreli karsinom anahtar sürücülerin çoğu dahil olmak üzere birçok kanser genleri, birikir olduğu bildirilmiştir, güçlü pozitif seleksiyon 13 altındadır.

1) kan hücreleri kolayca minimal invaziv bir proses ile elde edilebilir, çünkü deri fibroblastları tersine, periferik kan (PB) hücreleri yeniden programlama için bir hücre tercih kaynağıdır, 2) periferal kan hücreleri, hematopoetik kök hücre soyu olanKemik iliğinde bulunan, böylece zararlı ışınlarından korunmalıdır. Periferal kan tek-çekirdekli hücreleri (PB MNC) Ficoll-Hypaque (1.077 gr / ml) ile basit bir gradyan santrifüj aşağıdaki ince beyaz tabaka katmandan bir saat içinde toplanabilir. Elde edilen PB uluslu şirketlerin lenfositler, monositler ve birkaç hematopötik projenitör hücrelerin (HPC) 14 oluşur. Insan T lenfositleri, PB büyük hücre tipleri bulunmaktadır olgun karşın T hücreleri, T hücre reseptörünün (TCR) genlerinin yeniden düzenlemeleri içerir ve bu nedenle uygulama 15,16 için potansiyellerini sınırlayıcı sağlam bir genom yoksundur. Ancak, iPSC nesil yoluyla T hücrelerinin gençleştirme Kimerik Antijen Reseptör (SYR) T-hücre tedavisi 17-19 potansiyel uygulamalar olabilir. Buna karşılık, HPC sağlam bir genom ve kolaylıkla yeniden programlanabilir bulunmaktadır. Sadece 0.01 olmasına rağmen - periferik dolaşımda% 0.1 hücreleri HPC bulunmakta, bu hücreler genişletilebilir ex vivo eritroid ortamda kızarıklara çoğalmasını yana olduğunuoid progenitör hücreler 14.

Daha önceki çalışmamızda, biz PB yeniden programlama verime 20 10x artışa neden Yamanaka faktörleri (Oct4, Sox2, MYC ve Klf4), ek faktör BCL-XL kullanılır. Ayrıca BCL2L1 şekilde bilinmektedir BCL-XL, kaspaz 21,22 aktivasyonunu inhibe ederek hücre ölümüne güçlü bir inhibitörüdür. Fakat, BCL-XL ayrıca pluripotensini 21,22 sürdürülmesinde önemli bir rol oynayabilir. Son zamanlarda, biz daha fazla ayrı ayrı yeniden programlama verimliliği 23 yaklaşık 100x artışa yol açar iki vektörleri ile MYC ve Klf4 ifade ederek bizim EV yeniden programlama sistemi optimize ettik. Sağlıklı vericilerden 0.5% - Bu yöntem kullanılarak, transfeksiyon hücre sayısını başlangıç ​​bölünmesiyle koloni sayısı ile tanımlanan yeniden programlama etkinliği, 0.2'dir. aşağıdaki gibi biz PB entegrasyonu ücretsiz iPSCs üretmek için detaylı deneysel prosedürü açıklar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

insan PB örneklerin tüm yerel araştırma etik kurul onayı ile Tianjin Kan Merkezi'nden edinilebilir hiçbir kimlik bilgileri ile anonim yetişkin vericilerden elde edilmiştir.

1. Endo içermeyen plazmid hazırlama

  1. Üreticinin protokolüne uygun olarak E. coli'nin epizomal vektör elde etmek için ticari bir Plazmid Saflaştırma Maxi Kiti kullanın. Nihai adım için, endotoksin içermeyen steril su ile yerine TE tamponu DNA pelet çözülmesi için.
  2. Ticari bir UV / Vis spektrofotometre kullanılarak DNA konsantrasyonu ölçün. konsantrasyonu genellikle A260 / A280 sırasıyla 1.8 ve 2.0, daha fazla A260 / A230 oranları daha büyük 1 ug / ml, bir.

2. Kültür Medya

  1. eritroid orta hazırlayın: hematopoetik kök hücre genleşme maddesi, 100 ng / ml insan kök hücresi faktörü (SCF), 10 ng / ml Interleukin-3 (IL3), 2 U / mL Eritropoietin ile desteklenmiş (EPO), 20 ng / ml insülin benzeri büyüme faktörü-1 (IGF-1), 1 uM deksametazon ve 0.2 mM 1-tiogliserol. 0.22 mikron şırınga filtre ile sterilize filtre. Eritroid ortamı bir aya kadar 4 ° C 'de muhafaza edilebilir.
  2. iPSC orta hazırlayın: DMEM / F12 ortamı 1x L-glutamin, 1 x penisilin / streptomisin, 1 x esansiyel olmayan amino asitler, çözelti, 50 ng / ml Fibroblast Büyüme Faktörü 2 (FGF2 ile desteklenmiş (Dulbecco Değiştirilmiş Eagle ortamı / Besin Karışımı, F-12) ), 1x İnsülin-Transferrin-selenit takviyesi (ITS), ve 50 mg / ml askorbik asit. 0.22 mikron şırınga filtre ile sterilize filtre. iPSC ortamı bir aya kadar 4 ° C 'de muhafaza edilebilir.
  3. , 1 x penisilin / streptomisin ve% 10 cenin sığır serumu (FBS) ile desteklenmiş Dulbecco'nun Modifiye Edilmiş Eagle Ortamı (yüksek glukoz DMEM): MEF orta hazırlayın. 0.22 mikron şırınga filtre ile sterilize filtre. MEF ortamı en fazla bir ay boyunca 4 ° C'de saklandı veya yeni kullanımdan önce 1 x L-glutamin ilave edilebilir.
  4. Ponarılması iPSC Soğukta saklama ortamı (2x): 37 ° C su banyosu içinde, steril 30 mL su içinde D-trehaloz 5 g çözündürülür. 4 ° C'ye sıcaklığına getirmek ve daha sonra FBS ve 10 mL dimetilsülfoksit 10 mL (DMSO) ekleyin. 0.22 mikron şırınga filtre ile sterilize filtre. 3 aya kadar 24 için 4 ° C'de saklayın.

Periferal Kan Tek Çekirdekli Hücreleri 3. izolasyonu (PB MNC)

  1. 50 ml tüp içine 10 ml taze PB numunesi ve 10 ml PBS tamponu birleştirin ve iyice karıştırın. Oda sıcaklığına PBS getirmek ya da 37 ° C, kullanımdan önce.
    Not: Yaklaşık 1-3 x 10 6 uluslu şirketler (taze veya dondurularak saklanmış) PB 1 mL elde edilebilir. Kültür sırasında olgun hücrelerin ölümü nedeniyle 1 x 10 6 toplam hücre - kültürü 6 gün sonra, 0.5 olmasını bekliyoruz. Yaklaşık 1 x 10 7 hücre taze PB 10 mL elde edilebilir.
  2. uzun bir iğne takılı bir 10 ml şırınga kullanılarak tüpün dibine 10 ml Ficoll ekleyin. bu prori Ficoll katman PB ile karıştırmak olmadığından emin olmak için yavaş yavaş yapılmalıdır.
  3. düşük hızlanma ve yavaşlama oranında, 30 dakika boyunca 400 x g'de santrifüjleyin. Santrifüj işleminden sonra, PB ÇUŞ'ları PB plazması ve Ficoll arasında yer alan beyaz bir tabaka (buffy coat) bulunmaktadır.
  4. Yavaş yavaş aspire ~ buffy coat katmanı bozmadan 10 ml PB plazma. Dikkatle yeni 50 ml tüp için 1 ml pipet kullanarak beyaz bir tabaka hasat. 6 ml - beyaz tabaka toplanan hücrelerin toplam hacmi 3 arasında olacaktır.
  5. 30 mL toplam hacim getirmek ve 10 ml bir pipet ile iyice karıştırın PBS ekleyin. 10 dakika boyunca 400 x g'de santrifüjleyin.
  6. 20 ml kültür ortamı (yani, Iscove Modifiye Dulbecco Ortamı, IMDM) supernatant ve tekrar süspansiyon hücre pelletini çıkarın ve iyice karıştırın. 10 dakika boyunca 400 x g'de santrifüj trombositlerin büyük bir kısmı bertaraf.
  7. Süpernatantı ve 1 hücre pelletini - 2 ml IMDM. Hücreler f kullanılabilirya da acil bir kültür ya da daha sonra kullanılmak üzere dondurulabilir aşağı. dondurarak saklama için kriyoprezervasyon orta eşit miktarda ekleyin. hemen ° C derin dondurucuda bir -80 - (şişe başına 1 ml 0.5) ve transfer cryovials cryovials içinde Kısım hücreleri. PB uluslu şirketlerin birkaç hafta -80 ° C'de derin dondurucuda saklanabilir ya da uzun süreli depolama için bir sıvı azot tankına transfer edilebilir.
    NOT: donmuş hücreleri çözülme zaman bizim dondurma orta hücre canlılığı sürdürmek olsa, hücre sayısı çözdürme işlemi sırasında hücre ölümüne bağlı olarak azalabilir. 10 x 10 7 hücre Her flakon donmuş olacak 1 - tavsiye edilir.

Eritroid Ortamda PB ÇUŞ'larının 4. Genişleme

  1. 15 ml bir tüp içinde 5 ml IMDM ortamı hazırlar. Hızlı bir şekilde 37 ° C su banyosu içinde dondurulmuş PB ÇUŞ'larına çözülmesi ve daha sonra IMDM ortamı tüp aktarın.
    Not: su banyosunda süre dondurulan hücre ve cryovial u bağlıdırsed. Genellikle, dondurulmuş hücre 1 dakika içinde çözülme olacak.
  2. 10 dakika - 5 için 400 xg'de santrifüj. Süpernatantı ve eritroid ortamda hücre pelletini. 10 ul hücre süspansiyonu, 10 ul Tripan mavi solüsyon ilave edin ve iyice karıştırın. 3 dakika - Tripan Mavi 1 içinde ölü hücreleri boyar. hemasitometre kullanarak mikroskop altında hücreleri saymak.
  3. Olmayan bir doku kültüründe Kültür PB uluslu şirketlerin (non-TC) 'in bir hücre yoğunluğunda, oyuk başına 2 ml ortam ile 6-çukurlu plaka muamele ~ 5 x 10 6 hücre / mL, 37 ° C de% 5 CO2 içinde nemlendirilmiş bir kuluçka cihazı.
  4. D 3 ve 5 de ortam değiştirilmeden her bir oyuğa, doğrudan 1 ml taze eritroid orta ekleyin.
  5. D 6, nucleofection için PB ÇUŞ'larına hasat.

5. PB MNC Nucleofection ve yeniden programlanması

  1. nucleofection bir gün önce, ön-kaplama, 20 dakika boyunca 37 ° C 'de,% 0.1 jelatin ile 6 oyuklu plakalar TC-işlemden geçirildi. Çözülme inaktive Fare Embriyonik FibroBlast (MEF) besleyici 37 ° C su banyosu içinde hücreleri hemen MEF ortam 5 ml ihtiva eden bir 15 ml tüp aktarın.
  2. 5 dakika boyunca 400 x g'de santrifüj ve süpernatant kaldırmak. , 6-çukurlu plaka jelatin kaldırma MEF ortamda hücre pelletini, ve jelatin önceden muamele edilmiş 6-çukurlu plaka aktarın. Her bir tohum 2'de - 4 X 10 5 etkisizleştirilmiş MEF hücreleri 2 ml MEF ortamı içinde askıya alınmıştır.
  3. Kültür, bir% 5 CO2 nemlendirilmiş inkübatör içinde 37 ° C'de MEF besleyici hücreleri.
  4. nucleofection gününde, MEF orta aspire ve 1 mL eritroid ortamı ile değiştirin. % 5 CO2 nemlendirilmiş inkübatör içinde 37 ° C sıcaklıkta 30 dakika için 10 - kültürü plakası önceden dengeye.
  5. 2 ug Maksimum boyanma-OCT4-2A-Sox2; 1 ug pEV-myc, 1 ug pEV-Klf4 ve 1.5 ml steril bir Eppendorf tüpü içinde 0.5 ug pEV-BCL-XL. 5 dakika kirlenmesini önlemek ve oda sıcaklığına kadar soğuması için 50 ° C'de tüp ısıtın. Eklemek57 ul tampon, 13 ul ilave nucleofection.
  6. Hasat, 7 dakika boyunca 200 x g 'de santrifüj ile 5 ml tüp 2 x 10 6 kültürlenmiş PB uluslu şirketlerin. Süpernatantı ve hücre pelet plazmid ve nucleofection tampon karışımı ekleyin. parmağınızla tüp hafifçe vurarak iyice karıştırın.
    Not 2 x 10 5 hücre olduğunca düşük nucleofection kullanılabilir, ama daha düşük bir yeniden programlama verimlilik ve beklenmelidir.
  7. kitte sağlanan küvete DNA ve hücre süspansiyonu aktarın ve küvet kap. nucleofection cihazda Program U-008 seçin. tutucu içine küvet yerleştirin ve U-008 programı uygulamak için OK tuşuna basın.
  8. hemen önceden dengelenmiş MEF plaka 1 ml önceden ısıtılmış eritroid her küvet içinde orta ve aktarım hücrelerini - tutucudan küvet alın, 0.5 ekleyin. Nedeniyle değişen hücrelerin farklı sayıda tohumlu yüksek yeniden programlama verimliliği ve donör değişimi, 1-10 x 10 5 hücrelerinden per de son derece teşvik edilmektedir.
  9. Hipoksiyaya odasına plaka aktarın ve 1,% 92 N2,% 5 CO2 ve% 3 O 2 oluşan karışık bir gaz ile bölme yıkayın - 20 L / dakikalık bir hızda 2 dk. 37 ° C'de odası, kültür hücreleri sızdırmazlık sonra.
  10. D2 sonrası nucleofection, her kuyuya doğrudan 2 mL iPSC orta ekleyin.
  11. D 4 sonrası nucleofection anda, orta 3 mL kaldırmak ve 2 ml taze iPSC orta ekleyin. D 4 sonrası nucleofection, canlı hücrelerin en besleyici katmanına eklenmiş olacaktır.
  12. 18 - D 6 post-nucleofection sonra uL orta geçirdi 500 bırakarak ve D 14 kadar 0.25 mM sodyum bütirat ile desteklenmiş 2 ml taze E8 orta ekleyerek ORTA her 2 günde bir değiştirin.
    Not: Ek besleme hücreleri besleyici hücreler müstakil edilmiştir gözlemleyerek her kültür çukurlarına ilave edilebilir. MEFS (5.1 ve 5.2) çözündükten sonra, (E8 orta küçük bir hacim içinde tekrar süspansiyon hücre pelletini, yani ~ 0.daha sonra bir 6-yuvalı plaka oyuk) ve 2 mL kültür oyuklarına MEFS ekleyin. Yaklaşık% 2 FBS hücre eki geliştirmek için ilave edilebilir. Seçenek olarak ise, MEF-koşullandınlmış madde de kullanılabilir, ancak bu daha zahmetli olabilir.

iPSCs 6. Genişleme

NOT: - 10 sonrası nucleofection Çoğu durumda, iPSC kolonilerin sayıda D 8 görünür. D 14 sonra büyük iPSC kolonileri genellikle toplamak için hazır.

  1. koloniler çekme önce, besleyici ya da Matrigel kaplı 24 oyuklu plakanın bir kuyuda, ROCK inhibitörü, Y27632 (10 uM) ile takviye edilmiş 500 uL E8 orta ekleyin. çizilmeye ve mikroskop altında koloniler almak için 10 ya da 20 uL pipet kullanın. Kültür ortamı içeren çukurlara, her koloninin parçaları aktarın.
    Not: Matrigel konsantrasyonu bir partiden diğerine farklılık göstermektedir. Matrigel 100 seyreltme: Genellikle, biz 1 kullanın.
    1. Çapraz bulaşmayı önlemek için, çekmebüyük ve iyi diğerlerinden ayrılır olan koloniler. % 5 CO2 ile nemlendirilmiş inkübatörde 37 ° C'de kültür iPSCs.
      Not: Bu, 6 gözlü bir plakanın her bir düzinelerce veya koloniler yüzlerce olduğunda iPSC nüfusu bağlı hücre göçü poliklonal olabilir dikkat gerekir.
  2. İlk 2 gün boyunca orta değiştirmeyin. ROCK inhibitörü küçük koloniler 25 hayatta kalmasını teşvik edebilir.
  3. itibaren D 2, harcanan orta kaldırarak ve de her 500 uL taze E8 orta ekleyerek her gün orta değiştirin.
  4. koloniler yeterince büyük olduğunda yaklaşık 1 hafta sonra, orta kaldırmak ve 1 37 ° C'de, 300 ul hücre ayrılma çözeltisi (PBS içinde 0.5 mM EDTA) ile hücrelerin tedavi - 3 dk. Hücre dekolmanı çözüm çıkarın ve iPSCs askıya ROCK inhibitörü (10 uM) içeren E8 orta ekleyin. aşırı hücre ölümüne yol açabilir tek hücre içine kolonileri yıkmak yok. 50 hücre - 5, hücre kümeleris iPSC geçişi için uygundur.
  5. besleyiciler ve Matrigel ile kaplanmış olan bir 12 ya da 6-çukurlu bir levhanın her çukuruna hücre süspansiyonu% 100 - başına 50.
  6. Matrigel kaplı plakalar uzun süreli kültür (6.1 nota bakın), her gün orta değiştirin. Hücre konflüansa 40 ulaştığında -% 60, ~ 3 dakika için 37 ° C 'de 1 ml hücre kopması çözeltisi (PBS içinde 0.5 mM EDTA) ile hücrelerin tedavisi. koloniler kıvrılıp başladığınızda, hücre dekolmanı çözüm kaldırmak ve iPSCs askıya E8 orta içeren ROCK inhibitörü (10 uM) ekleyin. Passage 4 bir yarma faktörü ile hücreleri - 8'e hayatta artırmak için hücrelerin pasaj zaman ROCK inhibitörü ilave edilmeli ve farklılaşma önlemek için 1 d sonradan kaldırıldı.
  7. üreticinin protokolüne uygun olarak 5 dakika - dondurularak aşağı iPSCs, 3, 37 ° C'de hücre kopması çözeltisi ile hücre tedavisi. iPSC kolonileri kıvrılıp başladığınızda, tampon aspire ve 0.5 eklemek - 1 ml E8 orta.
  8. <li> hücre süspansiyonu için dondurarak saklama ortamına ait eşit bir hacmi ilave edin ve iyice karıştırın. Dondurulmuş iPSCs birkaç hafta ya da uzun süreli depolama için sıvı azot içinde bir -80 ° C dondurucu içinde saklanabilir.

Artık Epizomal Plazmidler olmadan iPSCs 7. Seçimi

  1. geçit 5, hasat iPSCs sonra ve genomik DNA ayıklayın.
    Not: Genellikle kültür 5 geçiş sonrası, artık epizomal plasmidleri saptanamaz. Böylece, neredeyse tüm 5 (yani geçidin 10) Yukarıdaki pasajlar da iPSC kolonilerinin kalan epizomal plasmidleri eksiktir.
  2. Bir negatif kontrol olarak transfekte edilmemiş PB çok uluslu genomik DNA testi. hücre başına PEV plazmid bir kopyası ile hücreleri taklit etmek için 1 mcg negatif kontrol DNA'ya 1.6 pg PEV-OCT4-2A-Sox2 plazmid ekleyin.
  3. (Ileri 10 mcM her ve geri primerler) 100 ng genomik DNA ve 1 uL spesifik primerler dahil 9 ul PCR sınıf su ekleyin 10 uL Yüksek Sadakat PCR Master Mix içine. am normaleGAPDH tarafından DNA'nın Miktarı. EBNA1 serisi-F TTTAATACGATTGAGGGCGTCT, EBNA1 serisi R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH R GACTGTGGTCATGAGTCCTTC: PCR için, aşağıdaki primerler kullanın.
  4. 60 saniye için 98 ° C 'de reaksiyon karışımının inkübe; 10 s, 30 s, 60 ° C'de ve 30 saniye 72 ° C'de 98 ° C eklenmiştir. 30 döngü sonrasında, 5 dakika boyunca 72 ° C'de reaksiyonu uzanır.
  5. Yük bir% 1 agaroz jeli her çukuruna 5 uL PCR ürünleri. V. ileri kültür ve aşağı analiz için EBNA1 serisi ve WPRE için saptanamayan bantları ile iPSC klonlar seçin 100 ° C'de 30 dakika - 20 jel çalıştırın.

8. Akım Sitometri

  1. tek bir hücre süspansiyonu elde etmek için 5 dakika - 3, 37 ° C'de Accutase ile muamele etmek suretiyle hasat iPSCs. Ekle 1 uL PE-konjuge anti-TRA-1-60 ya da anti-SSEA4 ya İzotipik antikoru hücre süspansiyonunun 100 uL (1 eFluor 570 konjuge - 5 x 10 5 hücre) 5 ml tüplerinde. 20 dakika boyunca oda sıcaklığında karanlık bir yerde inkübe edin.
  2. Oda sıcaklığında 20 dakika boyunca boyama sonra, 5 dakika boyunca 400 x g'de ml PBS ve santrifüj 2 ekleyin. Hücre analizörü sitometri akışı ile floresan-aktive edilmiş hücre sıralama (FACS) analizi için, 300 ul PBS içinde yeniden süspanse hücreleri. 23,26

9. Konfokal Görüntüleme

  1. Matrigel kaplı oda slaytlar Tohum iPSCs.
  2. Sonra 3 - kültür 4 gün büyüme ortamı çıkarın ve 30 dakika boyunca oda sıcaklığında% 4 paraformaldehit (PFA) ile tespit edin. PBS ile iki kez hücreleri yıkayın.
    Not: PFA toksik ve zararlı.
  3. 30 dakika boyunca oda sıcaklığında PBS içinde% 0.1 Triton X-100 (PBS-T) ile hücrelerin tedavi edin. PBS ile iki kez hücreleri yıkayın.
  4. 1 saat boyunca oda sıcaklığında: bloke edici tampon (V PBS içerisinde% 5 keçi serumu, V) hücreleri bloke.
  5. bloke adımı sırasında, bloke edici tampon içinde birincil antikor (100x) seyreltin.
    NOT: Antikorlar bilgi Malzemelerin Tablo listelenir / Ekipman.
  6. 4 ° de CO / N seyreltilmiş antikor ile inkübe hücreleri.
  7. 15 dakika boyunca PBS ile iki kez, ardından 15 dakika boyunca PBS-T ile iki kez yıkanır.
  8. 2 saat boyunca oda sıcaklığında seyreltilmiş bir florofor-konjuge sekonder antikor ile inkübe hücreleri.
  9. 15 dakika boyunca PBS ile iki kez, ardından 15 dakika boyunca PBS-T ile hücreler iki kez yıkanır.
  10. 10 dakika boyunca oda sıcaklığında PBS içinde DAPI (1 ug / mL) ile çekirdeği leke.
  11. 15 dakika boyunca PBS ile iki kez hücreleri yıkayın.
  12. konfokal mikroskop görüntüleri yakalayın. 23,27

10. Teratom Deneyi

Seyreltilmiş 200 uL DMEM / F12 hücre ayrılma çözeltisi (PBS içinde 0.5 mM EDTA) ile tekrar süspansiyon hücreleri ile hasat 1 x 10 6 iPSCs (1: 1) Matrigel.

  1. Subkutan NOD / SCID bağışık yetmezliği olan farelere arka haunch içine hücreleri enjekte edilir.
  2. 8 at - iPSC enjeksiyonundan sonra 12 hafta, incelemek ve% 10 formalin teratom düzeltin. 28
  3. microsectioning sonrahematoksilen ve eozin (H & E) ile boyama, örnekleri analiz eder. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Bu protokolü kullanarak, 1 x 10 5 nucleofected PB ÇUŞ'ları gelen kolonilerin yüzlerce elde edebilirsiniz (Şekil 1A ve 1B). % 0.5 ve koloniler Pluripotency belirteçleri (Şekil 1C ve 1D) ifade - yeniden programlama verimi yaklaşık 0.2 olduğunu. açıklanan protokol kullanılarak oluşturulan iPSCs entegrasyon içermez ve teratom 3 germ tabakalarını (Şekil 1E ve 1F) beste oluşturmak için yeteneği var.

Şekil 1
Şekil 1: Periferal Kan Tek Çekirdekli Hücreleri Entegrasyon içermeyen iPSCs üretilmesi. (A): Çevresel kan hücrelerindeki yeniden programlanması için prosedürün şematik. (B) (sol) toplu olarak AP lekelenmesi ve tipik ESC benzeri iPSC kolonisi (sağ)60; PB ÇUŞ'ları nucleofection sonra 14 d. Ölçek çubuğu: 100 mikron. (C): geçit 5'de iPSCs temsili FACS diyagramları TRA-1-60 ya SSEA4 eksprese. (D): Nanog ve Oct4 ifade iPSC kolonilerinin Temsilcisi konfokal görüntüler. Ölçek çubuğu: 100 mikron. (E): toplam resim ve her üç germ tabakalarını içeren teratom H & E boyama Temsilcisi görüntü. Ölçek çubuğu: 100 mikron. (F): Beş geçişten sonra iPSCs kalan EV plazmid sayıları kopyalayın. EBNA1 serisi ve WPRE için özel primerler epizomal vektörlerin amplifiye etmek için kullanılmıştır. GAPDH bir DNA yükleme kontrolü olarak kullanıldı. UD, saptanamayan. Pozitif şeritli tek kopya kontrolünü gösterir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Sağlıklı donörlerden veya hastalardan alınan kan örnekleri Kazanılması temel araştırma ve klinik hücre terapisi için çekici bir hücre kaynağı yapma, rahat ve non-invaziv olduğunu. Burada periferik kan örneklerinden entegrasyon serbest iPSCs yüksek verimli üretimi için bir protokol tanımlanmıştır. Bu tekrarlanabilir ve uygun fiyatlı bir yaklaşım iPSC alanını yararına olmalıdır.

Biz yüksek verimli PB yeniden programlama 30 sorumlu iki kritik faktörler olduğunu bildirdi. Biri 2A bağlayıcı 31 ile eş molar Oct4 ifadesini ve Sox2 olduğunu. Bunu başarmak için, PEV-OCT4-2A-Sox2 bu protokol kullanılır. Diğer daha önce 30 kullandık yerine PEV-myc-2A-Klf4 ve myc ve Klf4 ifade iki plazmid PEV-myc ve PEV-Klf4 kullanılmasıdır. görünüşte basit bir değişiklik MYC kademeli ve daha fazla artış büyük ölçüde kaynaklanmaktadır PB yeniden programlama verimleri yaklaşık 100X artışa yol açar: KLişlem sırasında F4 oranı.

Çeşitli noktaları PB yüksek verimli iPSC nesil elde etmek için dikkate alınmalıdır. PB uluslu şirketlerin çoğalmasını ve eritroid progenitör hücrelerinin büyümesini teşvik eritroid ortamı içinde, yaklaşık 1 hafta kültürlendi ve böylece yeniden programlama verimi 20 artar. Bununla birlikte, özellikle, lösemili hastalardan alınan kan hücreleri için bazı örnekler için, hücrelerin, eritroid ortamında kültürlendi zayıf hayatta. Bu durumda, kültür süresini azaltmak için yararlı olacaktır. % 50'den fazla olmalıdır nucleofection verimliliği, doğrulamak için 2 ug pmaxGFP vektör - Ayrıca 1 kullanmaya teşvik edilmektedir. Buna ek olarak, plazmid kalitesi çok önemlidir. (Örneğin plazmidler elde etmek Endo içermeyen Plazmid Maxi Seti kullanılarak) endotoksin kirlenme olmadan plasmidlerin kullanımı tavsiye edilir. Kötü plazmid kalitesi önemli bir hücre ölümüne yol açabilir ve bu nedenle yeniden programlama etkinliğini azaltabilir. Biz ve diğerleri o hipoksi promot göstermiştiriPSC nesil 14,32 es. Bu% 92 N2,% 5 CO2 ve% 3 O 2 oluşan karışık bir gaz ile hipoksi odasını yıkayın. normoksi yerine kullanılırsa, yeniden programlama verim% 80 azalma için kadar gözlenebilir. Yeniden programlama işlemi tamamlandıktan sonra, iPSCs düzenli nemlendirilmiş bir% 5 CO2 inkübatörü içinde kültürlenebilir. Orta değiştirirken, harcanan ortamın bir miktar (6 çukurlu bir levha içinde çukur başına, yani 500 uL) bırakın ve daha sonra taze aracı eklemek kullanışlıdır. IPSCs nesil 33 azaltabilir çok sık orta değişiklik olarak, yeniden programlama sırasında orta sadece her gün değiştirin.

Geliştirdiğimiz yeni protokol SV yeniden programlama sistemi ile karşılaştırılabilir bir üst düzey PB yeniden programlanması elde etti. EV sistemi birçok belirgin avantajları vardır. Biri için, EV SV daha uygun fiyatlı. EV sistemi daha da ek faktörler ya da farklı combina içeren değiştirilebilirAdet SV vektörleri ise birçok faktörün leri, araştırmacılar tarafından değiştirilemez, ticari bir ürünüdür. Mevcut protokolü klinik uygulamalarını sınırlandırır, ancak kolayca ayrıca protokol geliştirilmesi 34,35 çıkarılabilir MEF besleyici hücreleri ve hayvan kaynaklı ürünler kullanımını kapsamaktadır.

GMP düzeyinde EV plazmid kolay üretilebilir, bu sistem ile üretilen iPSCs, hastalık modelleme ve ilaç taraması için değil, aynı zamanda, klinik tedavi için sadece kullanılabilir ve önemli EV entegrasyonu ile bir iPSCs saptanmıştır. Klinik uygulamalar, hasta hücreler genellikle tedavi için fonksiyonel hücrelere farklılaşma önce iPSCs düzeltilmesi gereken bir hastalığa neden olan gen, barındırır. Yeni bir rapor EV yeniden programlama sistemi, basit bir nucleofection 36 sonra eşzamanlı yeniden programlama ve genom düzenleme ulaşmak için CRISPR / Cas9 sistemi ile entegre edilebilir olduğunu gösterdi. Bu birSV sistemi üzerinden EV nother bir avantaj. Bizim yayınlanmamış veriler EV yeniden programlama üzerine genom düzenleme piggybacking zaman elde edilebilir% 20 genom düzenleme verimliliği o kadar göstermiştir. CRISP / Cas9R genom düzenleme ile PB reprogramming entegrasyonu önümüzdeki yıllarda Şifasız birden çok hastalıkların tedavisinde potansiyel uygulamalara sahip olabilir, bizim umudumuz.

Özetle, bizim geliştirilmiş periferik kan hücresi yeniden programlama protokolü, temel araştırma ve klinik uygulamalarda araştırmacılar geniş spektrum için yararlı olacaktır. Bu verimli EV yeniden programlama sistemi de bir iPSC sahneye geçmeden doğrudan yetişkin periferik kan hücrelerinden entegrasyonu ücretsiz Mezenkimal Kök Hücreler (MKH) 37 veya Nöral Kök Hücreler (NSC'lerde) 38, üretmek için, değişiklikler sonrasında, istihdam edilebilir.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Epizomal vektörlerin kullanılması insan periferik kan mononükleer hücrelerinden entegrasyon içermeyen uyarılmış pluripotent kök hücrelerin üretilmesi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter