Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Generazione di integrazione-liberi cellule staminali pluripotenti indotte dalle cellule mononucleari di sangue periferico umano Utilizzando episomiale Vettori

doi: 10.3791/55091 Published: January 1, 2017

Abstract

Cellule staminali pluripotenti indotte (iPSCs) molto promettenti per la modellazione della malattia e terapie rigenerative. Abbiamo precedentemente riportato l'uso di episomiale Vettori (EV) per generare iPSCs senza integrazione da cellule mononucleate del sangue periferico (PB MNC). I vettori episomiale utilizzati sono plasmidi di DNA incorporati con oriP e EBNA1 elementi dal virus di Epstein-Barr (EB), che permettono per la replica e lungo termine retainment di plasmidi in cellule di mammifero, rispettivamente. Con ulteriore ottimizzazione, migliaia di colonie IPSC possono essere ottenuti da 1 mL di sangue periferico. Due fattori critici per ottenere l'efficienza alta riprogrammazione sono: 1) l'uso di una 2A "auto-scissione" peptide per collegare OCT4 e SOX2, ottenendo così espressione equimolare dei due fattori; 2) l'uso di due vettori per esprimere MYC e Klf4 singolarmente. Qui si descrive un protocollo step-by-step per la generazione di IP libero-integrazioneSC da adulti campioni di sangue periferico. I iPSCs generati sono privi di integrazione come plasmidi episomiale residui sono rilevabili dopo cinque passaggi. Sebbene l'efficienza riprogrammazione è paragonabile a quella di Sendai Virus (SV) vettori, plasmidi EV sono notevolmente più economico rispetto ai vettori disponibili in commercio SV. Questo sistema EV riprogrammazione accessibile rappresenta un potenziale per le applicazioni cliniche in medicina rigenerativa e fornisce un approccio per la riprogrammazione diretta delle multinazionali PB alle cellule senza integrazione mesenchimali staminali, cellule staminali neurali, ecc.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dopo forzata espressione di diversi fattori di trascrizione (Cioè OCT4, SOX2, MYC e Klf4), cellule somatiche possono essere riprogrammate a cellule staminali pluripotenti indotte (iPSCs), che detengono una grande promessa per applicazioni in medicina rigenerativa e terapia di sostituzione cellulare 1-3. Fino ad oggi, diversi metodi sono stati sviluppati per aumentare il tasso di successo della riprogrammazione 4-7. Vettori virali indotta riprogrammazione è ampiamente utilizzato per la generazione efficiente di iPSCs, perché l'integrazione virale porta ad un alto livello, espressione stabile dei fattori di riprogrammazione. Tuttavia, l'integrazione permanente del DNA del vettore nel genoma della cellula può indurre mutagenesi inserzionale 5. Inoltre, insufficiente inattivazione dei fattori di riprogrammazione può disturbare iPSCs differenziazione 8. Come tale, l'uso di iPSCs senza integrazione dei fattori di riprogrammazione è indispensabile, in particolare per l'uso in applicazioni di terapia cellulare.

9 (EB). L'elemento oriP promuove la replicazione del plasmide in cellule di mammifero, mentre l'elemento EBNA1 Tethers plasmide DNA oriP contenente il DNA cromosomico che consente la compartimentazione del episoma durante la divisione della cellula ospite. In confronto ad altri approcci privi di integrazione, tra cui Sendai Virus (SV) e RNA trasfezione, i veicoli elettrici in possesso di molteplici vantaggi 5,6,10. Come il DNA plasmide, i veicoli elettrici possono essere facilmente realizzati e modificati in casa, che li rende estremamente conveniente. Inoltre, riprogrammando con EV è un processo meno alta intensità di lavoro da un unico trasfezione con veicoli elettrici è sufficiente per la generazione di IPSC, che sono necessarie per la riprogrammazione di successo diversi trasfezioni RNA.

Dfibroblasti ermal sono stati utilizzati in molti studi di riprogrammazione. Tuttavia, la biopsia della pelle non è solo un processo invasivo e doloroso, ma anche in termini di tempo per l'espansione delle cellule a quantità sufficienti per la riprogrammazione. Di maggiore preoccupazione, le cellule della pelle di donatori adulti sono stati spesso esposti a radiazioni UV-lungo termine, che può portare a mutazioni associate a tumori, limitando così le domande di iPSCs derivate da fibroblasti cutanei 11,12. Recentemente, è stato riportato che le normali cellule della pelle umana si accumulano mutazioni somatiche e molteplici geni del cancro, tra cui la maggior parte dei fattori chiave della cutanee carcinomi a cellule squamose, sono sotto forte selezione positiva 13.

In contrasto con i fibroblasti della pelle, sangue periferico (PB), le cellule sono una fonte di cellule preferibili per la riprogrammazione perché 1) le cellule del sangue possono essere facilmente ottenute attraverso un processo minimamente invasiva, 2), le cellule del sangue periferico sono la progenie di cellule staminali ematopoieticheresidente nel midollo osseo, quindi protetto dalle radiazioni nocive. cellule mononucleate del sangue periferico (PB MNC) possono essere raccolti in un'ora dallo strato buffy coat a seguito di una semplice centrifugazione in gradiente utilizzando Ficoll-Hypaque (1.077 g / mL). Le multinazionali PB ottenuti sono composti da linfociti, monociti e un paio di cellule progenitrici ematopoietiche (HPC) 14. Sebbene linfociti T umani sono uno dei principali tipi di cellule in PB, maturo cellule T contengono riarrangiamenti del recettore delle cellule T (TCR) geni e mancano di un genoma intatto limitando così il loro potenziale per applicazioni 15,16. Tuttavia, il ringiovanimento delle cellule T attraverso generazione iPSC può avere potenziali applicazioni in chimerico Antigen Receptor (CAR) Terapia cellule T 17-19. In confronto, HPC hanno un genoma intatto e sono facilmente riprogrammabile. Anche se solo 0,01-0,1% in cellule circolazione periferica sono HPC, queste cellule possono essere espanse ex vivo in media eritroide che favorisce la proliferazione di erythrcellule progenitrici OID 14.

Nel nostro studio precedente, abbiamo usato il fattore BCL-XL in aggiunta ai fattori di Yamanaka (OCT4, SOX2, MYC e Klf4), che ha provocato un aumento di 10 volte in PB riprogrammazione efficienza 20. BCL-XL, noto anche come BCL2L1, è un potente inibitore di morte cellulare, inibendo l'attivazione delle caspasi 21,22. Ma, BCL-XL può anche svolgere un ruolo importante nel mantenimento della pluripotenza 21,22. Recentemente, abbiamo ulteriormente ottimizzato il nostro sistema EV riprogrammazione esprimendo separatamente MYC e Klf4 con due vettori, che porta a un aumento di circa 100x in efficienza riprogrammazione 23. Utilizzando questo metodo, l'efficienza riprogrammazione, definito dal numero di colonie diviso per numero iniziale di cellule a transfezione, è di 0,2 - 0,5% da donatori sani. Come segue, si descrive la procedura sperimentale dettagliato per la generazione di iPSCs senza integrazione da PB.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tutti i campioni PB umani sono stati ottenuti da donatori adulti anonimi senza informazioni di identificazione disponibili da Tianjin Blood Center con l'approvazione del comitato etico di ricerca locale.

1. Endo-libera plasmidi Preparazione

  1. Utilizzare un kit commerciale plasmidi Purificazione Maxi per estrarre i vettori episomiale da E. coli secondo il protocollo del produttore. Per il passo finale, sostituire tampone TE con acqua sterile priva di endotossine per sciogliere il pellet di DNA.
  2. Misurare la concentrazione di DNA utilizzando un commerciale UV / Vis spettrofotometro. La concentrazione è di solito superiore a 1 mg / mL, con A260 / A280 e A260 rapporti / A230 superiori, rispettivamente, 1,8 e 2,0,.

2. Culture Media

  1. Preparare medio eritroide: ematopoietiche cellule staminali di espansione medio integrato con 100 ng / mL staminali umane Cell Factor (SCF), 10 ng / mL interleuchina-3 (IL3), 2 U / mL Eritropoietina (EPO), 20 ng / mL di insulina Growth Factor-1 (IGF1), 1 micron desametasone e 0,2 mm 1-thioglycerol. Filtro sterilizzare con un filtro siringa da 0,22 micron. medio eritroide può essere conservato a 4 ° C per un massimo di un mese.
  2. Preparare media iPSC: terreno DMEM / F12 (Modified Eagle Medium / Nutrient Mixture Dulbecco F-12) integrato con 1x L-glutammina, 1x penicillina / streptomicina, 1x non essenziali soluzione aminoacidi, 50 ng / mL Fibroblast Growth Factor 2 (FGF2 ), supplemento 1x insulino-transferrina-selenite (ITS), e 50 mg / mL di acido ascorbico. Filtro sterilizzare con un filtro siringa da 0,22 micron. medio iPSC può essere conservato a 4 ° C per un massimo di un mese.
  3. Preparare MEF media: Modified Eagle Medium di Dulbecco (DMEM; alta di glucosio) integrata con 1x penicillina / streptomicina e 10% siero fetale bovino (FBS). Filtro sterilizzare con un filtro siringa da 0,22 micron. medio MEF può essere conservato a 4 ° C fino a un mese o appena aggiungere 1x L-glutammina prima dell'uso.
  4. Pmedio repare COPSI crioconservazione (2x): Sciogliere 5 g di D-trealosio in 30 mL di acqua sterile in un bagno d'acqua 37 ° C. Portare la temperatura a 4 ° C e quindi aggiungere 10 ml di FBS e 10 ml di dimetilsolfossido (DMSO). Filtro sterilizzare con un filtro siringa da 0,22 micron. Conservare a 4 ° C per un massimo di 3 mesi 24.

3. Isolamento di cellule mononucleate del sangue periferico (PB MNC)

  1. Unire 10 ml di campione PB fresco e 10 mL di tampone PBS in un tubo da 50 ml e mescolare bene. Portare PBS per RT o 37 ° C prima dell'uso.
    NOTA: circa 1 - 3 x 10 6 multinazionali (freschi o crioconservati) può essere ottenuto da 1 ml di PB. Dopo 6 d della cultura, si aspettano di avere 0,5 - 1 x 10 6 cellule totali a causa della morte di cellule mature durante la coltura. Circa 1 x 10 7 cellule possono essere ottenute da 10 mL di PB fresco.
  2. Aggiungere 10 mL Ficoll al fondo della provetta utilizzando una siringa da 10 ml collegata ad un lungo ago. Questo proprocesso dovrebbe essere fatto lentamente per garantire che lo strato Ficoll non si mescola con il PB.
  3. Centrifugare a 400 xg per 30 minuti a una bassa velocità di accelerazione e decelerazione. Dopo la centrifugazione, le multinazionali PB sono nello strato bianco (buffy coat) che si trova tra il plasma PB e il Ficoll.
  4. Lentamente aspirato ~ 10 mL PB plasma senza disturbare lo strato di buffy coat. raccogliere accuratamente lo strato bianco utilizzando un puntale 1 ml a un nuovo tubo da 50 ml. Il volume totale di cellule raccolte dallo strato bianco sarà fra i 3 - 6 mL.
  5. Aggiungere PBS per portare il volume totale di 30 ml e mescolare bene con una pipetta 10 ml. Centrifugare a 400 xg per 10 min.
  6. Rimuovere il surnatante e risospendere pellet cellulare in 20 ml di terreno di coltura (IE Iscove Modified medio di Dulbecco, IMDM) e mescolare bene. Centrifugare a 400 xg per 10 minuti per rimuovere la maggior parte delle piastrine.
  7. Rimuovere il surnatante e risospendere il pellet cellulare in 1 - 2 ml IMDM. Le cellule possono essere usate fo la cultura immediato, o congelati-down per un uso successivo. Per crioconservazione, aggiungere una quantità equivalente di mezzo di crioconservazione. cellule aliquota in cryovials (0,5 - 1 ml per fiala) e cryovials trasferimento ad un -80 ° C freezer immediatamente. MNC PB possono essere conservati in -80 ° C freezer per diverse settimane o trasferiti ad un serbatoio di azoto liquido per la conservazione a lungo termine.
    NOTA: Per scongelare le cellule congelate, anche se il nostro mezzo di crioconservazione può sostenere la vitalità delle cellule, il numero di cellulare può diminuire a causa di morte delle cellule durante il processo di scongelamento. Si raccomanda di 1 - 10 x 10 7 cellule saranno congelati in ogni fiala.

4. L'espansione delle multinazionali PB in eritroide Media

  1. Preparare 5 ml IMDM media in un tubo da 15 ml. scongelare rapidamente le multinazionali PB congelati in un bagno d'acqua C 37 ° e poi trasferirli al tubo con il mezzo IMDM.
    NOTA: La lunghezza del tempo in bagno d'acqua dipende dal volume delle cellule crioconservati e l'u esageratamentesed. Di solito, la cella congelati si scongelano in 1 min.
  2. Centrifugare a 400 xg per 5 - 10 minuti. Rimuovere il surnatante e risospendere il pellet cellulare in media eritroide. Aggiungere 10 ml soluzione Trypan Blue di sospensione cellulare 10 ml e mescolare bene. Trypan blu colora le cellule morte entro 1 - 3 min. Contare le cellule sotto il microscopio con un emocitometro.
  3. PTM Culture PB in una coltura non-tessuto (non-TC) trattati 6 pozzetti con 2 ml di mezzo per pozzetto, ad una densità cellulare di ~ 5 x 10 6 cellule / ml, a 37 ° C in 5% CO 2 incubatore umidificato.
  4. Aggiungere 1 ml di mezzo fresco eritroide direttamente a ciascun pozzetto senza cambiare il mezzo a D 3 e 5.
  5. A D 6, raccogliere le multinazionali PB per nucleofection.

5. PB MNC Nucleofection e riprogrammazione

  1. Un giorno prima nucleofection, pre-coat TC-trattata 6 pozzetti con 0,1% di gelatina a 37 ° C per 20 min. Scongelare inattivato murino embrionale Fibroesplosione (MEF), le cellule di alimentazione in un bagno d'acqua C 37 ° e subito trasferirli in una provetta da 15 ml contenente 5 ml di terreno MEF.
  2. Centrifugare a 400 xg per 5 minuti e rimuovere il surnatante. Rimuovere la gelatina dal 6 pozzetti, risospendere il pellet di cellule in medium MEF, e trasferirli gelatina pretrattata 6 pozzetti. In ogni pozzetto, semi di 2 - 4 x 10 5 inattivati cellule MEF sospese in 2 ml di mezzo MEF.
  3. Coltivare le cellule di alimentazione MEF a 37 ° C in un incubatore umidificato CO 2 5%.
  4. Il giorno della nucleofection, aspirare il terreno MEF e sostituirlo con 1 medium eritroide mL. Pre-equilibrare la piastra di coltura per 10 - 30 min a 37 ° C in un incubatore umidificato CO 2 5%.
  5. Aggiungere 2 mg PEV-OCT4-2A-SOX2, 1 mg PEV-MYC, 1 mg PEV-Klf4, e 0,5 mg PEV-BCL-XL in una provetta da 1,5 ml Eppendorf sterili. Riscaldare il tubo a 50 ° C per 5 min a prevenire la contaminazione, e si raffreddano a RT. Aggiungere57 microlitri nucleofection buffer e 13 microlitri supplemento.
  6. Harvest 2 x 10 6 coltivate multinazionali PB in una provetta da 5 ml per centrifugazione a 200 xg per 7 minuti. Rimuovere il surnatante e aggiungere il plasmide e nucleofection mix buffer per il pellet. Mescolare bene muovendo il tubo con il dito.
    NOTA: A partire da 2 x 10 5 cellule può essere utilizzato per nucleofection, ma un rendimento riprogrammazione inferiore dovrebbe essere previsto pure.
  7. Trasferire il DNA e sospensione cellulare alla cuvetta fornito nel kit e tappare la cuvetta. Selezionare il programma U-008 sul dispositivo nucleofection. Inserire la cuvetta nel supporto e premere OK per applicare il programma U-008.
  8. Prendere la cuvetta dal supporto, aggiungere 0,5 - media eritroide 1 ml di pre-riscaldato in ogni provetta, e le cellule di trasferimento alla piastra MEF pre-equilibrata immediatamente. Grazie all'elevata efficienza riprogrammazione e variazione donatore, semina diverso numero di cellule che vanno da 1-10 x 10 5 cellule per bene è fortemente incoraggiata.
  9. Trasferire la lastra ad una camera di ipossia, e lavare la camera con un gas misto costituito da 92% N 2, 5% CO 2 e 3% O 2 per 1 - 2 min ad una velocità di 20 L / min. Dopo la sigillatura della camera, coltura le cellule a 37 ° C.
  10. A D 2 post-nucleofection, aggiungere 2 ml di mezzo iPSC direttamente a ciascun bene.
  11. A D 4 post-nucleofection, rimuovere 3 ml di terreno e aggiungere 2 ml di media iPSC fresco. A D 4 post-nucleofection, la maggior parte delle cellule vive avranno attaccato allo strato alimentatore.
  12. Dopo 6 D post-nucleofection, cambiare il medium ogni 2 d lasciando 500 microlitri speso medio e l'aggiunta di 2 ml di media E8 fresco integrato con 0,25 mm di sodio butirrato fino a D 14 - 18.
    NOTA: Altre cellule di alimentazione possono essere aggiunti nei pozzetti di coltura ogni volta osservando che le cellule di alimentazione sono stati staccati. Dopo lo scongelamento MEF (vedi 5.1 e 5.2), risospendere il pellet cellulare in un piccolo volume di terreno E8 (cioè ~ 0.2 ml per un pozzetto di un 6-pozzetti) e quindi aggiungere MEF nei pozzetti di coltura. Circa 2% FBS può essere aggiunto per aumentare l'adesione cellulare. In alternativa, medio MEF condizionata può essere usata, ma è più laboriosa.

6. Ampliamento della iPSCs

NOTA: Nella maggior parte dei casi, un gran numero di colonie IPSC appaiono in D 8 - 10 dopo nucleofection. Dopo 14 D, grandi colonie IPSC sono di solito pronti per la raccolta.

  1. Prima di scegliere le colonie, aggiungere 500 microlitri di media E8 integrato con inibitore ROCK, Y27632 (10 micron), in un pozzetto di un alimentatore o di Matrigel rivestito 24-pozzetti. Utilizzare un 10 o 20 microlitri pipetta di graffiare e scegliere colonie sotto il microscopio. Trasferire i pezzi di ogni colonia ai pozzetti contenenti il ​​terreno di coltura.
    NOTA: La concentrazione di Matrigel differisce da un lotto all'altro. Di solito, usiamo diluizione 1: 100 di Matrigel.
    1. Al fine di evitare la contaminazione incrociata, sceglierecolonie che sono grandi e ben separati dagli altri. IPSCs Culture a 37 ° C in un incubatore umidificato CO 2 5%.
      NOTA: Dovrebbe essere notare che la popolazione iPSC può essere policlonale a causa della migrazione cellulare quando ci sono decine o centinaia di colonie in ciascun pozzetto di una piastra da 6 pozzetti.
  2. Non cambiare mezzo per la prima 2 d. Inibitore ROCK può promuovere la sopravvivenza delle piccole colonie 25.
  3. Da D 2 in poi, cambiare media ogni giorno, eliminando medio speso e l'aggiunta di medie E8 500 microlitri fresca in ogni pozzetto.
  4. Circa 1 settimana più tardi, quando le colonie sono abbastanza grandi, rimuovere il terreno e trattare le cellule con 300 soluzione distacco cellulare microlitri (0,5 mM EDTA in PBS) a 37 ° C per 1 - 3 min. Rimuovere la soluzione di distacco delle cellule e aggiungere medie E8 contenente inibitore ROCK (10 micron) di sospendere iPSCs. Non abbattere le colonie in cellule singole, che possono portare alla morte delle cellule eccessivo. I grumi di cellule con 5-50 cellules sono adatti per iPSC passaggio.
  5. Trasferimento 50 - 100% della sospensione cellulare in ciascun pozzetto di una 12 o 6 pozzetti che è stato prerivestito con alimentatori o Matrigel.
  6. Per la cultura a lungo termine in piastre Matrigel rivestite (vedi nota in 6.1), cambiare il mezzo di ogni giorno. Quando la confluenza cella raggiunge 40 - 60%, trattare le cellule con 1 soluzione distacco cellulare mL (0,5 mM EDTA in PBS) a 37 ° C per ~ 3 min. Quando le colonie cominciano a rannicchiarsi, rimuovere la soluzione di distacco delle cellule e aggiungere E8 mezzo contenente inibitore ROCK (10 micron) di sospendere i iPSCs. cellule Passaggio con un fattore di divisione di 4 - 8. l'inibitore ROCK deve essere aggiunto quando passaging cellule per aumentare la sopravvivenza, e rimossi 1 d tardi per evitare la differenziazione.
  7. Per congelare-down iPSCs, il trattamento di cellule con una soluzione di distacco delle cellule a 37 ° C per 3-5 minuti secondo il protocollo del produttore. Quando le colonie IPSC iniziano a rannicchiarsi, aspirare il tampone e aggiungere 0,5-1 ml E8 media.
  8. <li> Aggiungere un volume equivalente di mezzo crioconservazione alla sospensione cellulare e mescolare bene. Congelato iPSCs può essere conservato in un congelatore C -80 ° per diverse settimane o in azoto liquido per la conservazione a lungo termine.

7. La selezione di iPSCs senza residuo episomiale Plasmidi

  1. Dopo il passaggio 5, iPSCs raccolto ed estrarre DNA genomico.
    NOTA: Di solito dopo 5 passaggi della cultura, plasmidi episomiale residui sono rilevabili. Così, quasi tutte le colonie IPSC a passaggi sopra 5 (cioè di passaggio 10) mancano plasmidi episomiale residue.
  2. Utilizzare DNA genomico da untransfected multinazionali PB come controllo negativo. Aggiungere 1,6 pg PEV-OCT4-2A-SOX2 plasmide in 1 mg DNA controllo negativo per imitare le cellule con una sola copia del PEV plasmide per cellula.
  3. Aggiungere 9 ml di acqua PCR-grade di cui 100 ng di DNA genomico e 1 ml primer specifici (10 micron ciascuno di avanti e primer reverse) in 10 microlitri ad alta fedeltà PCR Master Mix. Normalizzare l'amount del DNA da parte GAPDH. Utilizzare i seguenti primer per PCR: EBNA1-F TTTAATACGATTGAGGGCGTCT, EBNA1-R GGTTTTGAAGGATGCGATTAAG, WPRE-F GGTTTAAACGCGTCGACAAT, WPRE-R GTTGCGTCAGCAAACACAGT, GAPDH-F GAGTCCACTGGCGTCTTC, GAPDH-R GACTGTGGTCATGAGTCCTTC.
  4. Incubare la miscela di reazione a 98 ° C per 60 s; seguita da 98 ° C per 10 s, 60 ° C per 30 s, e 72 ° C per 30 s. Dopo 30 cicli; estendere la reazione a 72 ° C per 5 min.
  5. Carico 5 microlitri prodotti di PCR in ciascun pozzetto di un gel di agarosio all'1%. Eseguire il gel per 20 - 30 min a 100 V. Scegliere i cloni IPSC con fasce non rilevabili per EBNA1 e WPRE per ulteriori cultura e l'analisi a valle.

8. Citometria a Flusso

  1. Harvest iPSCs di trattarli con Accutase a 37 ° C per 3-5 minuti per ottenere una sospensione singola cella. Aggiungere 1 ml PE-coniugato anti-TRA-1-60 o eFluor 570-coniugato anti-SSEA4 o anticorpo isotipico 100 l di sospensione cellulare (1 - 5 x 10 5 cellule) In 5 mL. Incubare le provette in un luogo buio a temperatura ambiente per 20 min.
  2. Dopo la colorazione per 20 minuti a temperatura ambiente, aggiungere 2 ml di PBS e centrifugare a 400 xg per 5 min. Risospendere le cellule in 300 microlitri di PBS per Cell Fluorescence-attivato ordinamento (FACS) analisi utilizzando un analizzatore di citometria a flusso delle cellule. 23,26

9. confocale Imaging

  1. iPSCs seme nella camera di diapositive Matrigel rivestite.
  2. Dopo 3 - 4 d della cultura, rimuovere il mezzo di crescita e fissare con 4% paraformaldeide (PFA) a temperatura ambiente per 30 min. Lavare le cellule due volte con PBS.
    Nota: PFA è tossico e nocivo.
  3. Trattare le cellule con 0,1% Triton X-100 in PBS (PBS-T) a temperatura ambiente per 30 min. Lavare le cellule due volte con PBS.
  4. Bloccare le cellule con un tampone di bloccaggio (siero di capra 5% in PBS, V: V) a temperatura ambiente per 1 h.
  5. Durante la fase di blocco, diluire l'anticorpo primario (100x) in tampone di bloccaggio.
    NOTA: Le informazioni anticorpi è elencato nella tabella dei materiali / attrezzature.
  6. Incubare le cellule con l'anticorpo diluito a 4 ° CO / N.
  7. Lavare due volte con PBS-T per 15 minuti, seguito da due volte con PBS per 15 min.
  8. Incubare le cellule con un anticorpo secondario fluoroforo coniugato diluito a temperatura ambiente per 2 ore.
  9. Lavare le cellule due volte con PBS-T per 15 minuti, seguito da due volte con PBS per 15 min.
  10. Macchia il nucleo con DAPI (1 mg / ml) in PBS a temperatura ambiente per 10 min.
  11. Lavare le cellule due volte con PBS per 15 min.
  12. Catturare immagini con un microscopio confocale. 23,27

10. Teratoma Assay

Harvest 1 x 10 6 iPSCs con la soluzione di distacco delle cellule (0,5 mm EDTA in PBS) e risospendere le cellule in 200 microlitri DMEM / F12 diluito (1: 1) Matrigel.

  1. Per via sottocutanea iniettare le cellule nella coscia posteriore di topi immunodeficienti NOD / SCID.
  2. Alle 8 - 12 settimana dopo l'iniezione IPSC, sezionare e correggere teratomi in formalina al 10%. 28
  3. Dopo microsectioning ecolorazione con ematossilina e eosina (H & E), analizzare i campioni. 29

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Usando questo protocollo, si possono ottenere centinaia di colonie da 1 x 10 5 nucleofected PB multinazionali (Figure 1A e 1B). L'efficienza riprogrammazione è circa 0,2 - 0,5% e le colonie esprimono marcatori pluripotenza (Figure 1C e 1D). iPSCs generati utilizzando il protocollo descritto sono privi di integrazione e hanno la capacità di formare teratoma comporre i 3 strati germinali (figure 1E e 1F).

Figura 1
Figura 1: Generazione di iPSCs senza integrazione dalle cellule mononucleate del sangue periferico. (A): Uno schema del protocollo per riprogrammare cellule del sangue periferico. (B): AP colorazione in massa (a sinistra) e un tipico ESC-come iPSC colonia (a destra)60; 14 d dopo PB multinazionali nucleofection. barra della scala: 100 micron. (C): FACS Rappresentante diagrammi di iPSCs al passaggio 5 esprimendo TRA-1-60 o SSEA4. (D): le immagini confocale rappresentativi di colonie IPSC che esprimono Nanog e OCT4. barra della scala: 100 micron. (E): immagine rappresentativa del quadro complessivo e colorazione H & E di teratoma che comprende tutti e tre i foglietti embrionali. barra della scala: 100 micron. (F): copiare i numeri di plasmidi EV residue in iPSCs dopo cinque passaggi. primer specifici per EBNA1 e WPRE sono stati usati per amplificare i vettori episomiale. GAPDH è stato utilizzato come controllo DNA carico. UD, non rilevabile. La corsia positiva indica un controllo one-copia. Clicca qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'acquisizione di campioni di sangue da donatori sani o pazienti è conveniente e non invasivo, che lo rende una fonte di cellule interessante per la ricerca di base e clinica di terapia cellulare. Qui abbiamo descritto un protocollo per altamente efficiente generazione di iPSCs privo di integrazione da campioni di sangue periferico. Questo approccio riproducibile e accessibile dovrebbe beneficiare il campo IPSC.

Abbiamo riportato che ci sono due fattori critici responsabili altamente efficiente riprogrammazione PB 30. Uno è espressione equimolare di OCT4 e SOX2 utilizzando un linker 2A 31. Per raggiungere questo obiettivo, PEV-OCT4-2A-SOX2 viene utilizzato in questo protocollo. L'altro è l'uso di due plasmidi PEV-myc e PEV-Klf4 per esprimere MYC e Klf4 invece di PEV-MYC-2A-Klf4 che abbiamo precedentemente usato 30. L'apparentemente semplice cambiamento porta ad un aumento di circa 100X in PB efficienze di riprogrammazione, che è in gran parte a causa di un aumento graduale e maggiore nel MYC: KLRapporto F4 durante il corso del processo.

Diversi punti devono essere presi in considerazione per il raggiungimento di alta efficienza di generazione iPSC da PB. MNC PB sono coltivate per ~ 1 settimana in media eritroide, che promuove la proliferazione e l'espansione delle cellule progenitrici eritroidi e aumenta l'efficienza riprogrammazione 20. Tuttavia, per alcuni campioni, in particolare per le cellule del sangue da pazienti affetti da leucemia, cellule sopravvivono poco quando coltivate in terreno eritroide. In questo caso, sarebbe utile per ridurre il tempo di coltura. È inoltre incoraggiato utilizzare 1 - 2 ug pmaxGFP vettoriale per verificare l'efficienza nucleofection, che dovrebbe essere superiore al 50%. Inoltre, la qualità plasmide è importante. Si consiglia di usare i plasmidi senza contaminazione endotossine (vale a dire utilizzando Endo-libero Kit plasmidi Maxi per estrarre plasmidi). Scarsa qualità plasmide può portare a significativi morte cellulare e, quindi, ridurre l'efficienza riprogrammazione. Noi e altri hanno dimostrato che l'ipossia promotes generazione iPSC 14,32. Abbiamo Lavare la camera di ipossia con un gas misto composto da 92% di N 2, 5% di CO 2 e il 3% O 2. Se normossia è usato invece, si può osservare una riduzione fino al 80% in termini di efficienza riprogrammazione. Una volta che la riprogrammazione è completo, iPSCs possono essere coltivate in un normale umidificata al 5% CO 2 incubatore. Quando si cambia mezzo, è utile lasciare una piccola quantità di mezzo di spesa (ad esempio 500 ml per pozzetto in una piastra da 6 pozzetti), e quindi aggiungere mezzo fresco. Modificare media solo a giorni alterni durante la riprogrammazione, come troppo frequente cambio medio può ridurre iPSCs generazione 33.

Il nuovo protocollo abbiamo sviluppato ha raggiunto un PB riprogrammazione di alto livello che è paragonabile al sistema SV riprogrammazione. Il sistema EV ha diversi vantaggi evidenti. Per uno, EV è più conveniente rispetto SV. Il sistema EV può essere ulteriormente modificata includendo fattori aggiuntivi o diversi combinazionizioni di molteplici fattori, mentre i vettori SVS sono un prodotto commerciale che non può essere modificato da investigatori. Il nostro attuale protocollo prevede l'uso di cellule di alimentazione del MEF e di prodotti di origine animale, che possono limitare le applicazioni cliniche, ma può essere facilmente rimosso dallo sviluppo ulteriore protocollo 34,35.

iPSCs generati con questo sistema può essere utilizzato non solo per la modellazione della malattia e lo screening di stupefacenti, ma anche per la terapia clinica, perché plasmidi GMP-livello di EV possono essere facilmente generati e non sono state individuate iPSCs con notevole integrazione EV. Nelle applicazioni cliniche, le cellule dei pazienti di solito porto un gene malattia che induce, che deve essere corretto nei iPSCs prima differenziazione in cellule funzionali per la terapia. Un recente rapporto ha mostrato che il sistema EV riprogrammazione può essere facilmente integrato con il sistema / Cas9 CRISPR per raggiungere riprogrammazione simultanea e la modifica del genoma dopo una semplice nucleofection 36. Questo è unnother vantaggio di EV rispetto al sistema SV. I nostri dati non pubblicati hanno dimostrato che fino ad un rendimento di modifica del genoma del 20% può essere raggiunto quando bagarinaggio modifica del genoma su EV riprogrammazione. La nostra speranza è che l'integrazione di PB riprogrammazione con CRISP / Cas9R genoma modifica può avere potenziali applicazioni nel trattamento di diverse malattie che sono altrimenti incurabili nei prossimi decenni.

In sintesi, la nostra migliore periferico protocollo riprogrammazione delle cellule del sangue dovrebbe essere utile per un ampio spettro di ricercatori nel campo della ricerca di base e applicazioni cliniche. Questo efficiente sistema di EV riprogrammazione può anche essere impiegato, dopo le modifiche, per generare cellule senza integrazione staminali mesenchimali (MSC) 37, o le cellule staminali neurali (NSC) 38, direttamente dalle cellule del sangue periferico adulte senza passare attraverso una fase IPSC.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Hematopoietic Stem Cell Expansion Medium Sigma S0192 Store at 4 °C
Human Stem Cell Factor (SCF) Peprotech 300-07 Store at -20 or -80 °C
Interleukin-3 (IL-3) Peprotech AF-200-03 Store at -20 or -80 °C
Erythropoietin (EPO) Peprotech 100-64 Store at -20 or -80 °C
Insulin Growth Factor-1 (IGF-1) Peprotech 100-11 Store at -20 or -80 °C
Dexamethasone Sigma D4902 Store at -20 or -80 °C
1-thioglycerol (MTG) Sigma M6145 Store at -20 or -80 °C
DMEM/F12 medium Gibco 112660-012 Store at 4 °C
L-glutamine (100x) Gibco 25030-081 Store at -20 °C
Penicillin/Streptomycin (100x) Gibco 15140-122 Store at -20 °C
Non-essential Amino Acids solution (100x) Gibco 11140-050 Store at 4 °C
Fibroblast Growth Factor 2 (FGF2) Peprotech 100-18B Store at -20 or -80 °C
Insulin-Transferrin-Selenium (ITS, 100x) Gibco 41400-045 Store at 4 °C
Ascorbic acid Sigma 49752 Store at -20 °C
DMEM (high glucose) medium Thermo SH30243.01B Store at 4 °C
Fetal Bovine Serum (FBS) Hyclone SV30087.01 Store at -20 °C
Ficoll GE Healthcare, SIGMA 17-5442-02 Store at RT
Trehalose Sigma T9531 Store at 4 °C
Dimethylsulfoxide (DMSO) Sigma D2650 Store at RT, protect from light
Endofree Plasmid Maxi Kit (10) Qiagen 12362 Store at RT
IMDM Gibco 21056-023 Store at 4 °C
Human CD34+ Cell Nucleofection Kit Lonza VPA-1003 Store at RT, nucleofection buffer and supplement should be stored at 4 °C
Sodium Butyrate Sigma B5887 Store at -20 or -80 °C
ROCK inhibitor - Y27632 STEMGENT 04-0012-10 Store at -20 °C
Essential 8 basal medium (E8) Gibco A15169-01 Store at 4 °C, the supplement should be stored at -20 or -80 °C
Matrigel BD 354277 Store at -20 or -80 °C
2x EasyTaq PCR SuperMix (+dye) TransGen Biotech AS111 Store at -20 °C
Cell detachment solution STEMGENT 01-0006 Store at -20 °C, Accutase as a cell detachment solution to obtain a single-cell suspension
DAPI Sigma D9542-1MG Store at 4 or -20 °C
Anti-Nanog AF488 BD 560791 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
Anti-OCT4 abcam ab19857 Store at 4 °C, primary antibody used for Immunofluorescence, dilute 1/100 when used
AF488 donkey anti-mouse IgG Invitrogen A21202 Store at 4 °C, secondary antibody used for Immunofluorescence,  dilute 1/500 when used
PE anti-human TRA-1-60-R antibody Biolegend 330610 Store at 4 °C, antibody used for flow cytometry
eFluor 570-conjugated anti-SSEA4 eBioscience 41-8843 Store at 4 °C, antibody used for flow cytometry
Isotype antibody eBioscience 11-4011 Store at 4 °C, antibody used for flow cytometry
Alkaline Phosphatase Detection Kit SiDanSai 1102-100 Store at 4 °C
Genomic DNA Extraction Kit TIANGEN DP304-02 Store at RT
Trypan Blue solution Sigma T8154 Store at RT
Flow cytometry cell analyzer BD LSRII
Spinning Disk Confocal microscope (SDC) PerkinElmer UltraVIEW VOX for confocal imaging
Nucleofection device Lonza Nucleofector 2b for the nucleofection of PB MNC
ImageQuant LAS-4010 GE to take photos of AP staining in bulk

DOWNLOAD MATERIALS LIST

References

  1. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, 663-676 (2006).
  2. Takahashi, K., et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell. 131, 861-872 (2007).
  3. Trounson, A., McDonald, C. Stem Cell Therapies in Clinical Trials: Progress and Challenges. Cell Stem Cell. 17, 11-22 (2015).
  4. Hayes, M., Zavazava, N. Strategies to generate induced pluripotent stem cells. Methods Mol Biol. 1029, 77-92 (2013).
  5. Zhang, X. B. Cellular reprogramming of human peripheral blood cells. Genomics Proteomics Bioinformatics. 11, 264-274 (2013).
  6. Schlaeger, T. M., et al. A comparison of non-integrating reprogramming methods. Nat Biotechnol. 33, 58-63 (2015).
  7. Okita, K., et al. An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells. 31, 458-466 (2013).
  8. Carey, B. W., et al. Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells. Cell Stem Cell. 9, 588-598 (2011).
  9. Dorigo, O., et al. Development of a novel helper-dependent adenovirus-Epstein-Barr virus hybrid system for the stable transformation of mammalian cells. J Virol. 78, 6556-6566 (2004).
  10. Dowey, S. N., Huang, X., Chou, B. K., Ye, Z., Cheng, L. Generation of integration-free human induced pluripotent stem cells from postnatal blood mononuclear cells by plasmid vector expression. Nat Protoc. 7, 2013-2021 (2012).
  11. Harms, P. W., et al. Next generation sequencing of Cytokeratin 20-negative Merkel cell carcinoma reveals ultraviolet-signature mutations and recurrent TP53 and RB1 inactivation. Mod Pathol. 29, 240-248 (2016).
  12. Abyzov, A., et al. Somatic copy number mosaicism in human skin revealed by induced pluripotent stem cells. Nature. 492, 438-442 (2012).
  13. Martincorena, I., et al. Tumor evolution. High burden and pervasive positive selection of somatic mutations in normal human skin. Science. 348, 880-886 (2015).
  14. Su, R. J., Neises, A., Zhang, X. B. Generation of iPS Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. Methods Mol Biol. 1357, 57-69 (2016).
  15. Seki, T., et al. Generation of induced pluripotent stem cells from human terminally differentiated circulating T cells. Cell Stem Cell. 7, 11-14 (2010).
  16. Loh, Y. H., et al. Reprogramming of T cells from human peripheral blood. Cell Stem Cell. 7, 15-19 (2010).
  17. Kishino, Y., Seki, T., Yuasa, S., Fujita, J., Fukuda, K. Generation of Induced Pluripotent Stem Cells from Human Peripheral T Cells Using Sendai Virus in Feeder-free Conditions. J Vis Exp. (2015).
  18. Seki, T., Yuasa, S., Fukuda, K. Generation of induced pluripotent stem cells from a small amount of human peripheral blood using a combination of activated T cells and Sendai virus. Nat Protoc. 7, 718-728 (2012).
  19. Gill, S., June, C. H. Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies. Immunological reviews. 263, 68-89 (2015).
  20. Su, R. J., et al. Efficient generation of integration-free ips cells from human adult peripheral blood using BCL-XL together with Yamanaka factors. PLoS One. 8, e64496 (2013).
  21. Li, Y., et al. The p53-PUMA axis suppresses iPSC generation. Nat Commun. 4, 2174 (2013).
  22. Hardwick, J. M., Youle, R. J. SnapShot: BCL-2 proteins. Cell. 138, 404 (2009).
  23. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. 6, 873-884 (2016).
  24. Zhang, X. B., et al. Trehalose ameliorates the cryopreservation of cord blood in a preclinical system and increases the recovery of CFUs, long-term culture-initiating cells, and nonobese diabetic-SCID repopulating cells. Transfusion. 43, 265-272 (2003).
  25. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol. 25, 681-686 (2007).
  26. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of specific cell population by fluorescence activated cell sorting (FACS). J Vis Exp. (2010).
  27. Castiel, A., et al. Cell death associated with abnormal mitosis observed by confocal imaging in live cancer cells. J Vis Exp. e50568 (2013).
  28. Peterson, S. E., et al. Teratoma generation in the testis capsule. J Vis Exp. e3177 (2011).
  29. Ritner, C., Bernstein, H. S. Fate mapping of human embryonic stem cells by teratoma formation. J Vis Exp. (2010).
  30. Wen, W., et al. Enhanced Generation of Integration-free iPSCs from Human Adult Peripheral Blood Mononuclear Cells with an Optimal Combination of Episomal Vectors. Stem Cell Reports. (2016).
  31. Lo, C. A., et al. Quantification of Protein Levels in Single Living Cells. Cell Rep. 13, 2634-2644 (2015).
  32. Liu, S. P., et al. An improved method for generating integration-free human induced pluripotent stem cells. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 22, 580-587 (2014).
  33. Luni, C., et al. High-efficiency cellular reprogramming with microfluidics. Nat Methods. 13, 446-452 (2016).
  34. Chou, B. K., et al. A facile method to establish human induced pluripotent stem cells from adult blood cells under feeder-free and xeno-free culture conditions: a clinically compliant approach. Stem Cells Transl Med. 4, 320-332 (2015).
  35. Nakagawa, M., et al. A novel efficient feeder-free culture system for the derivation of human induced pluripotent stem cells. Sci Rep. 4, 3594 (2014).
  36. Howden, S. E., et al. Simultaneous Reprogramming and Gene Correction of Patient Fibroblasts. Stem Cell Reports. 5, 1109-1118 (2015).
  37. Meng, X., et al. Rapid and efficient reprogramming of human fetal and adult blood CD34+ cells into mesenchymal stem cells with a single factor. Cell research. 23, 658-672 (2013).
  38. Liao, W., et al. Direct Conversion of Cord Blood CD34+ Cells Into Neural Stem Cells by OCT4. Stem cells translational medicine. 4, 755-763 (2015).
Generazione di integrazione-liberi cellule staminali pluripotenti indotte dalle cellule mononucleari di sangue periferico umano Utilizzando episomiale Vettori
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).More

Wen, W., Zhang, J. P., Chen, W., Arakaki, C., Li, X., Baylink, D., Botimer, G. D., Xu, J., Yuan, W., Cheng, T., Zhang, X. B. Generation of Integration-free Induced Pluripotent Stem Cells from Human Peripheral Blood Mononuclear Cells Using Episomal Vectors. J. Vis. Exp. (119), e55091, doi:10.3791/55091 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter