Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

تحليل مفيد آثار المكملات الغذائية على وظائف الأمعاء طلائي الحاجز أثناء التجريبية التهاب القولون

doi: 10.3791/55095 Published: January 5, 2017

Summary

العلاجات الحالية للأمراض الأمعاء الالتهابية (IBD) تهدف إلى التخفيف من حدة أعراض المرض ولكن قد تتسبب في آثار جانبية خطيرة. وهكذا، ويجري التحقيق في استراتيجيات بديلة في نماذج التهاب القولون الحيوانية. هنا، نحن شرح كيفية تحليل الآثار المفيدة للملاحق النظام الغذائي على علامات مرض التهاب الأمعاء السريرية في مثل هذا النموذج التهاب القولون.

Abstract

الأمراض الالتهابية الأمعاء (IBD)، بما في ذلك مرض كرون والتهاب القولون التقرحي، واضطرابات الانتكاس المزمنة للأمعاء. أنها تسبب مشاكل خطيرة، مثل تقلصات في البطن، والإسهال الدموي، وفقدان الوزن، في الأفراد المتضررين. للأسف، لا يوجد علاج حتى الآن، والعلاجات تهدف فقط لتخفيف الأعراض. وتشمل العلاجات الحالية العقاقير المضادة للالتهابات والمثبطة للمناعة التي قد تتسبب في آثار جانبية خطيرة. هذا يستدعي البحث عن خيارات العلاج البديلة، مثل المكملات الغذائية، التي لا تتسبب في آثار جانبية. قبل تطبيقها في الدراسات السريرية، مثل هذه المركبات يجب أن تكون اختبارات صارمة للفعالية والأمن في النماذج الحيوانية. نموذج تجريبي يمكن الاعتماد عليها هو النموذج التهاب القولون ديكستران سلفات الصوديوم (DSS) في الفئران، الذي يستنسخ العديد من العلامات السريرية لالتهاب القولون التقرحي في البشر. طبقنا مؤخرا هذا النموذج لاختبار الآثار المفيدة من المكملات الغذائية التي تحتوي علىالفيتامينات C و E، L-أرجينين، والأحماض الدهنية غير المشبعة ω3 (بوفا). قمنا بتحليل المعلمات أمراض مختلفة، ووجدت أن هذا الملحق كان قادرا على تحسين تشكيل ذمة، وتلف الأنسجة، وتسلل الكريات البيض، والإجهاد التأكسدي، وإنتاج السيتوكينات الموالية للالتهابات، مما يؤدي إلى حدوث تحسن عام في مؤشر نشاط المرض. في هذه المقالة، نحن يشرح بالتفصيل التطبيق الصحيح للالمكملات الغذائية باستخدام نموذج التهاب القولون مفاجآت صيف دبي في C57BL / 6 الفئران، وكذلك كيف يتم تقييم المعلمات المرض مثل الأنسجة، الاكسدة، والالتهابات. تحليل الآثار المفيدة للحمية مختلفة المكملات قد ثم في نهاية المطاف فتح آفاقا جديدة لتطوير استراتيجيات علاجية بديلة تخفف من أعراض مرض التهاب الأمعاء و / أو التي تطيل مراحل مغفرة من دون التسبب في آثار جانبية خطيرة.

Introduction

التهاب القولون هو حالة التهاب القولون التي يمكن أن تسبب الإسهال وآلام في البطن. التهاب القولون يمكن أن تكون حادة، وذلك استجابة للإصابة أو الإجهاد، أو أنها يمكن أن تتطور كمرض مزمن، مثل التهاب القولون التقرحي (UC)، الذي ينتمي إلى مجموعة من امراض التهابات الامعاء (IBD). على الرغم من أن علامات سريرية من جامعة كاليفورنيا قد تم وصفها بشكل جيد، والتسبب لا تزال غير مفهومة 1. ومن المتفق عليه بين الخبراء أن UC هو مرض متعدد العوامل، مع الطفرات الوراثية والاستجابات المناعية الشاذة لعب دورا رئيسيا 2. ومع ذلك، والعوامل البيئية، مثل أسلوب المعيشة والتغذية، وتسهم أيضا في تطور المرض وتقدم 3.

للأسف، IBD لا يمكن الشفاء منه، ولكن هناك العديد من خيارات العلاج التي تهدف إلى تخفيف الأعراض السريرية. وتشمل العلاجات الحالية العقاقير المضادة للالتهابات، مثل sulfasalazine ووالستيروئيدات القشرية. مناعة، مثل azathioprine. الاجسام المضادة التي التقاط الموالية للالتهابات السيتوكينات، مثل عامل نخر الورم α (TNF-α)، أو كتلة جزيئات الالتصاق، مثل integrins، للحد من تجنيد الكريات البيض المفرط. ومثبطات التي تستهدف تحركات التي تؤدي مسارات الموالية للالتهابات، مثل يانوس كيناز (JAK) 4. ليس كل المرضى يستجيبون لجميع العلاجات، لذلك يجب أن تكون فردية الاستراتيجيات العلاجية 5. وعلاوة على ذلك، فإن معظم هذه الأدوية العلاجية تتداخل مع عملية التمثيل الغذائي والاستجابات المناعية، وغالبا ما تسبب آثار جانبية خطيرة. لهذا السبب، وقد تم التحقيق في خيارات العلاج البديلة.

وتشمل العلاجات البديلة البروبيوتيك والمكملات الغذائية، التي تم تطبيقها في النماذج الحيوانية والتجارب السريرية مع مستويات متفاوتة من النجاح 6،7. لقد وجدنا مؤخرا أن تطبيق مختلف المكملات الغذائية واحدة، مثل الفيتامينات المضادة للأكسدة والأحماض الدهنية ω3 بولي غير المشبعة (PUFAS)، هو أقل شأنا من تطبيق مزيج من هذه الملاحق في تخفيف التهاب القولون وأعراض مرض القلب والأوعية الدموية 8،9. وقد أجريت هذه الدراسات على الفئران، لذلك يجب إجراء دراسات سريرية على البشر لتحديد ما إذا كانت هذه النتائج ستكون ينطبق أيضا على البشر. قبل البدء الدراسات السريرية، يجب تقييم فعالية وسلامة خيارات العلاج الجديدة في النماذج الحيوانية.

لIBD، وقد استخدم (DSS) نموذج ديكستران كبريتات الصوديوم على نطاق واسع لدراسة آليات تطور المرض والآثار المفيدة للعقاقير والمكملات الغذائية 6،10. في معظم الدراسات، إلا مرض حاد على مدى فترة زمنية من هو فعل سبعة أيام. ومع ذلك، فإن العلامات السريرية التي لوحظت في هذه الحيوانات تشبه تلك التي لوحظت في مرضى التهاب الامعاء (أي الإسهال الدموي، وفقدان الوزن، وضعف الظهارية، وتسلل الخلايا المناعية) 10. مفاجآت صيف دبي يدفع تقرحات في الغشاء المخاطي،مما أدى إلى خلل الحاجز وفي زيادة نفاذية الظهارية في الأمعاء 11. لا تزال الآلية الدقيقة غير معروفة. ومع ذلك، تشير الدراسة إلى أن مفاجآت صيف دبي يتفاعل مع الأحماض المتوسطة سلسلة طول الدهنية لتشكيل نانو lipocomplexes التي تكون قادرة على دخول الخلايا الظهارية وللحث على إشارات التهاب الممرات 12. في هذه المقالة، نحن تصف بالتفصيل كيف هو فعل والتهاب القولون تحليلها في الفئران، كيف المكملات الغذائية يتم تطبيقها بواسطة أنبوب تغذية لضمان جرعة ثابتة في كل حيوان، وكيف يتم فحص آثار مثل هذه المكملات على مختلف أعراض التهاب القولون.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

وقد تمت الموافقة على جميع التجارب على الحيوانات من قبل لجنة رعاية واستخدام الحيوان المؤسسية Cinvestav.

1. إعداد مفاجآت صيف دبي مياه الشرب وتحريض من التهاب القولون

  1. إعداد 3.5٪ ث / ت ديكستران سلفات الصوديوم (DSS) حل في مياه الشرب تعقيمها. مفاجآت صيف دبي يذوب بسهولة وليس مطلوبا لتصفية الحل النهائي.
    ملاحظة: 7 أيام من العلاج مفاجآت صيف دبي تحرض التهاب القولون الحاد. إذا حمل التهاب القولون معتدل، 3 - ينصح 4 أيام من العلاج. طالما أن مياه الشرب مفاجآت صيف دبي يبقى واضحا، فإنه ليس من الضروري تغيير الماء. ومع ذلك، إذا تبين عكر، فإنه يجب أن يتم استبداله.
  2. تسجيل الوزن الأساسي من ذكور الفئران. تأكد من أنها 8-12 أسابيع من العمر، وضمن مجموعة من 21 - 25 جرام من وزن الجسم.
    ملاحظة: يجب أن يكون الأمثل للتركيز مفاجآت صيف دبي المناسب في كل مختبر. النتائج يمكن أن تختلف اختلافا كبيرا، وهذا يتوقف على ظروف السكن. وذكرت 5٪ عادة للحث ج قوية - تركيزات بين 2.5olitis في الفئران C57BL / 6J WT 10. مفاجآت صيف دبي من شركات مختلفة، والكثير مختلفة ينبغي اختبار، والنتائج قد تختلف أيضا مع مصادر مختلفة من مفاجآت صيف دبي.
  3. توفير المياه libitum الإعلانية واستبدالها بالماء مفاجآت صيف دبي الطازجة 3.5٪ إذا لزم الأمر.

2. تطبيق المكملات الغذائية بواسطة التغذية الأنبوبية

  1. يعد حل "feedable" من المكملات الغذائية المطلوبة في مذيب مناسب. لهذه الدراسة، كنا مزيج يحتوي على 200 ملغ / كغ L-أرجينين، 83 ملغم / كغم من فيتامين C، 46 ملغم / كغم من فيتامين E، و 77 ملغ / كغ ايكوسابنتانويك حمض (EPA)، و 115 ملغم / كغم الدوكوساهيكسانويك حامض (DHA ) في 1: الحل 1 من النفط المياه والقرطم.
  2. ملء حقنة 1 مل متصلة إبرة أنبوب تغذية (15 G × 50 ملم) مع خليط المكملات الغذائية. مسح السطح الخارجي للإبرة أنبوب تغذية لإزالة أي مركب خارج الإبرة وضمان تطبيق الجرعة المناسبة.
  3. كبح الماوس عن طريق استيعاب قاعدة الذيل معيد واحدة والتي تجتاح بحزم أضعاف الجلد في الجزء الخلفي من الرقبة مع الإبهام والسبابة من جهة أخرى. وضع الذيل بين الاصبع الثالث وقاعدة الإبهام من نفس اليد التي تحمل الرقبة.
  4. مع الحفاظ على الماوس في وضع مستقيم، أدخل الإبرة في الجانب الأيسر من فم الحيوان واتبع بعناية سقف الفم لتحديد موقع المريء. إذا واجهت أي مقاومة، ودفع الإبرة نحو المعدة.
    ملاحظة: تحقق من أن هذا الحيوان يتنفس بشكل صحيح قبل المتابعة.
  5. إدارة الخليط ببطء، وإزالة أنبوب عن طريق سحب ببطء من الحقنة، والافراج عن الماوس. تطبيق المكملات الغذائية مرة واحدة يوميا بواسطة التغذية الأنبوبية خلال التجربة التهاب القولون.

3. تحديد مؤشر آخر على الأمراض

ملاحظة: مؤشر نشاط المرض هو مزيج من عشرات لفقدان الوزن، ونزيف حول الشرج، وقوام البراز، والتي هي اوبtained يوميا 13.

  1. قياس وزن الجسم يوميا وتعيين بنتيجة 0-4 وفقا لنسبة فقدان الوزن (0: 0٪، 1: 1-5٪، 2: 5-10٪، 3: 10 - 20٪، و 4:> 20 ٪).
    يتم تحديد وزن الجسم الخسارة عن طريق حساب الفرق في المئة بين الوزن القاعدية قبل تحريض DSS-التهاب القولون والوزن الفعلي: ملاحظة.
  2. لتحديد مستوى من نزيف حول الشرج، وجمع عينة البراز الطازجة واستخدام أدوات تطبيقها المقدمة للتطبيق مسحة رقيقة على شريحة من البراز طقم اختبار الدم الخفي غاياك. استخدام قضيب جديدة لكل عينة.
    1. إغلاق غطاء على الجبهة وفتح نافذة على الجزء الخلفي من الشريحة. تطبيق قطرتين من الحل المطور إلى الوراء في موقع العينة.
    2. قراءة النتائج بعد 30 ثانية. أي أثر للون الأزرق هو إيجابي للدم غامض. تعيين بنتيجة 0-4 (0: لا شيء، 0،5-2،5: غاياك إيجابي البراز فحص الدم الخفي (وهذا يتوقف على قوة الإشارة)، و3-4: اللائحة العامة للمنظمةSS النزيف).
      ملاحظة: إذا كان الدم في البراز واضح، لم يكن البراز فحص الدم الخفي غاياك التي يتعين القيام بها، وعلى درجة من 3، 3.5، أو يتم تعيين 4، اعتمادا على كمية من الدم وضوحا.
  3. تحديد البراز الاتساق من خلال مراقبة عينة البراز الطازج. تعيين بنتيجة 0-4 (0: عادي / الصلبة، 0،5-2،5: البراز فطيرة، و3-4: الإسهال).

4. تحديد المعوية طلائي النفاذية في فيفو من إيفانس الأزرق الفحص

  1. تخدير الحيوانات عن طريق حقنها داخل الصفاق مع خليط من الكيتامين (100 ملغم / كغم من وزن الجسم) وزيلازين (13 ملغ / كغ من وزن الجسم) المخفف في محلول ملحي (كلوريد الصوديوم 0.9٪)، وتقييم عمق التخدير عن طريق رصد قرصة الانسحاب لا ارادي.
  2. وضع الحيوانات تخدير في موقف ضعيف وإجراء عملية فتح البطن لفضح الأمعاء.
  3. تحديد الأعور وجعل شق صغير في الجزء الأقرب من القولون لscendens (من الناحية المثالية، متاخم لالأعور).
  4. اضافة الى وجود إبرة التغذية (G22) وضمان الحصول عليها مع ربطة باستخدام خيط الحرير المشترك. بعناية تدفق وفيرة برنامج تلفزيوني من خلال أنبوب لشطف من كل البراز من القولون. غرس ايفانز حل الأزرق (1.5٪ ث / ت في برنامج تلفزيوني) في القولون حتى تصل إلى فتحة الشرج.
  5. احتضان الأزرق ايفانز لمدة 15 دقيقة. تغسل الصبغة عن طريق تنظيف الأنبوب مع وفرة في برنامج تلفزيوني حتى تبييض حول الشرج واضح.
  6. الموت ببطء الحيوانات عن طريق التفكك عنق الرحم.
  7. استئصال القولون وشطفه مرة أخرى مع وفرة في برنامج تلفزيوني. شطف مرة واحدة مع 1 مل من 6 ملي N -acetylcysteine في برنامج تلفزيوني للقضاء على أي صبغة التمسك المخاط القولون.
  8. قطع القولون طوليا وشطفه مرة أخرى مع برنامج تلفزيوني و 1 مل من 6 ملي N -acetylcysteine.
  9. تسجيل الوزن والطول. لاستخراج ايفانز صبغة زرقاء، ضع القولون في 2 مل من N، N -dimethylformamide بين عشية وضحاها في درجة حرارة الغرفة مع agitatio لطيفن. قياس تركيز الصبغة طيفيا في 610 نانومتر.

مجموعة 5. النسيج

  1. تخدير الحيوانات عن طريق حقنها داخل الصفاق مع خليط من الكيتامين (100 ملغم / كغم من وزن الجسم) وزيلازين (13 ملغ / كغ من وزن الجسم) المخفف في محلول ملحي (كلوريد الصوديوم 0.9٪)، وتقييم عمق التخدير عن طريق رصد قرصة الانسحاب لا ارادي.
  2. الموت ببطء الحيوانات عن طريق التفكك عنق الرحم.
  3. وضع الحيوانات في موقف ضعيف وإجراء عملية فتح البطن لفضح تجويف البطن.
  4. باستخدام مقص، تشريح القولون بأكمله وتسجيل طوله.
  5. تدفق القولون عدة مرات مع بعناية المبردة PBS لإزالة البراز. سجل وزن الأنسجة والتحضير للالتجارب التالية، كما هو موضح في الخطوات 5،6-5،8.
  6. لعزل الحمض النووي الريبي والميلوبيروكسيديز المقايسات (MPO)، وقطع عينة الأنسجة بشكل مناسب الحجم (100 ملغ وعادة ما يكفي)، وضعه داخل أنبوب، ونظام الحسابات القوميةف تجميده في النيتروجين السائل. تخزين الأنسجة عند -80 درجة مئوية لاستخدامها في المستقبل.
  7. لتلطيخ المناعي وتقرير الاكسدة (أنظر أدناه)، وقطع القولون عينة صغيرة (0،5-1 سم) وsubmerse في أكواب صغيرة من الألومنيوم مليئة الأمثل درجة حرارة القطع (أكتوبر) مركب. وضع أكواب على الثلج الجاف والسماح لهم تجميد ببطء، لتجنب تشكيل فقاعة. عينات الأنسجة المجمدة يمكن تخزينها في -80 درجة مئوية لاستخدامها في المستقبل.
  8. لفات السويسري 14، فتح القولون طوليا وإزالة بعناية البراز باستخدام ملقط. لفة منه، مع الغشاء المخاطي تواجه الداخل، وذلك باستخدام ملقط غرامة الرؤوس أو رقيقة، عصا خشبية مستديرة. وضع بعناية داخل الكاسيت تضمين وتابع الخطوة 6.1.
    ملاحظة: مفاجآت صيف دبي يدفع الضرر في القولون. ومع ذلك، توزيع الضرر يختلف من الأقرب إلى القولون البعيدة، مع معظم الضرر عادة ما ينظر إليها في القولون القاصي والمستقيم. وبالتالي، فإننا نوصي تحليل الأنسجة إما في عمود القاصيأو في الأدوار السويسرية القولون بأكمله.

6. تحليل الأنسجة القولون عن طريق تلطيخ الهيماتوكسيلين يوزين

  1. تحضير الأنسجة
    1. للتحليل النسيجي، غمر إما لفات السويسرية أو قطع صغيرة من أنسجة القولون بعض المناطق من سيطرة والفئران التي عولجت في 5 مل من 10٪ الفورمالديهايد لمدة 48 ساعة في درجة حرارة الغرفة (RT) لتحقيق التثبيت الصحيح.
      ملاحظة: يتم تنفيذ جميع خطوات أخرى في الخطوة 6 من في RT، ما لم ينص على خلاف ذلك.
    2. غسلها بماء الصنبور لمدة 18 ساعة.
    3. يذوى لهم 15 مل من الايثانول 70٪ لمدة 1 ساعة، 96٪ لمدة 1 ساعة، والايثانول المطلق لمدة 1 ساعة. كرر كل خطوة مع الكحول النقي قبل الشروع في تركيز المقبل.
    4. استمرار الجفاف في خليط من 7.5 مل من الايثانول المطلق و 7.5 مل من زيلين المطلق لمدة 1 ساعة. أكرر مرة واحدة قبل تمرير عينات إلى 15 مل من زيلين المطلق لمدة 1 ساعة. كرر هذه الخطوة مرة واحدة مع زيلين جديدة.
    5. تضمين عينات الأنسجة القولون في البارافين
      1. تزج العينات في 50 مل من البارافين السائل لمدة 17 ساعة. كرر هذه الخطوة مرة واحدة ولكن لح 3 فقط.
      2. تزج العينات في مكعبات (البلاستيك، قالب مربع، حجم: 22 × 22 × 22 ملم) في 810 مل من البارافين السائل.
      3. السماح للالبارافين مع عينات الأنسجة القولون ليصلب لمدة 24 ساعة عند RT.
    6. قطع الأنسجة عبر أقسام باستخدام مشراح
      1. قطع عينات القولون باستخدام مبضع للفحص المجهري، وفقا لتعليمات الشركة المصنعة، في سمك من 5 ميكرون.
      2. جمع التخفيضات في حمام مائي (1 لتر) يحتوي على 0.3٪ الجيلاتين. وهذا ما يمنع للطي من الأنسجة عبر أقسام. استرداد أقسام الأنسجة وجبل لهم على الشرائح الزجاجية.
    7. الهيماتوكسيلين ويوزين تلطيخ من الأنسجة للصليب المقاطع
      1. Deparaffinize العينات لمدة 18 ساعة عند 60 درجة مئوية في حاضنة. لهذا الغرض، واستخدام الصورة الزجاجLIDE الرف مع مقبض.
      2. بعد deparaffinization، تزج الشرائح في 70 مل من زيلين المطلق لمدة 5 دقائق. كرر هذه الخطوة مرة واحدة مع زيلين جديدة.
      3. نقل العينات إلى 70 مل من الكحول المطلق لمدة 1 دقيقة. كرر هذه الخطوة مرة واحدة مع الكحول النقي.
      4. احتضان عينات الأنسجة القولون في 70 مل من الايثانول 96٪ لمدة 1 دقيقة. كرر هذه الخطوة مرة واحدة مع الكحول النقي.
      5. غسل العينات في مياه الحنفية مرتين لمدة 2 ق.
      6. احتضان الأنسجة في هاريس الهيماتوكسيلين لمدة 7 دقائق.
      7. غسل العينات في مياه الحنفية مرتين لمدة 2 ق.
      8. احتضان هذه العينات في الكحول الحمضية (70 مل من الايثانول 70٪ و 700 ميكرولتر من 1 M حمض الهيدروكلوريك) لمدة 7 ق.
      9. غسل العينات في مياه الحنفية مرتين لمدة 2 ق.
      10. احتضان عينات الأنسجة في 70 مل من كربونات الليثيوم (1 غرام من كربونات الليثيوم في 100 مل من الماء المقطرة) لمدة 7 ق.
      11. غسل العينات في مياه الحنفية مرتين لمدة 2 ق.
      12. احتضان العينات في 70 مل من الايثانول 80٪ لمدة 1 دقيقة.
      13. نقل العينات إلى 70 مل من يوزين-Y لمدة 15 ثانية.
      14. احتضان لهم في 70 مل من 96٪ من الإيثانول لمدة 1 دقيقة. كرر هذه الخطوة مرة واحدة مع الكحول النقي.
      15. احتضان عينات الأنسجة في 70 مل من الايثانول المطلق (الكحول الإيثيلي اللامائية المطلق) لمدة 1 دقيقة. كرر هذه الخطوة مرة واحدة مع الكحول النقي.
      16. احتضان العينات في 70 مل من خليط من 35 مل من الكحول المطلق و 35 مل من زيلين المطلق لمدة 1 دقيقة.
      17. نقل العينات إلى 70 مل من زيلين المطلق لمدة 1 دقيقة. كرر هذه الخطوة لمدة 5 دقائق في 70 مل من زيلين المطلق الطازجة.
      18. إضافة 80 ميكرولتر من الراتنجات الاصطناعية للعينات الأنسجة القولون، وغطاء لهم coverslips، والسماح لهم الجافة لمدة 24 ساعة عند RT. وأخيرا، وتحليل العينات باستخدام المجهر مشرق الميدان 8.

    7. تحليل مفرق التركيب التي كتبها المناعي

    1. تحضير الأنسجة كما هو موضح في الخطوة 5.7 و قطع 8 ميكرون سميكة المقاطع العرضيةباستخدام ناظم البرد.
    2. إصلاح وpermeabilize القولون عبر المقاطع مع 96٪ من الإيثانول في -20 درجة مئوية لمدة 20 دقيقة.
      ملاحظة: يجب أن يتولى جميع حضانات اللاحقة بها في RT، ما لم ينص على خلاف ذلك، في مربع مظلم رطب لمنع جفاف وتألقي يتلاشى.
    3. عينات من الهواء الجافة، ثم شطف لهم 3 مرات لمدة 5 دقائق مع كل برنامج تلفزيوني 1X
    4. احتضان هذه العينات مع عرقلة الحل (PBS تحتوي على 0.01٪ توين و 2٪ BSA) لمدة 2 ساعة.
    5. إزالة عرقلة الحل وشطفه مع برنامج تلفزيوني، 0.01٪ توين لمدة 10 دقيقة.
    6. خلال هذا الوقت، وتمييع الأجسام المضادة الأولية لتركيزات المطلوب في برنامج تلفزيوني، 0.01٪ توين.
    7. إزالة حل الغسيل، وتطبيق حل الضد من الخطوة السابقة، واحتضان بين عشية وضحاها في 4 درجات مئوية في مربع مرطب.
    8. إزالة حل الأجسام المضادة ويغسل 3 مرات مع برنامج تلفزيوني، 0.01٪ توين لمدة 5 دقائق كل ومرة ​​واحدة مع الماء منزوع الأيونات لمدة 10 دقيقة، مع الإثارة لطيف جدا.
    9. أثناء الغسيل، الطرد المركزي فلورochromeconjugated، أنواع محددة الأجسام المضادة الثانوية في 14000 x ج لمدة 20 دقيقة على 4 درجات مئوية.
    10. تمييع الأجسام المضادة الثانوية دون رواسب كما هو مبين من قبل مقدم في برنامج تلفزيوني، 0.01٪ توين، تطبيقها، واحتضان لمدة 1 ساعة على RT.
    11. كرر الخطوة 7.8 وإزالة حل غسل تماما بقدر الإمكان.
    12. ماصة 4 ميكرولتر من مكافحة يتلاشى وكيل على كل عينة على الشريحة.
    13. تغطية العينات مع ساترة.
    14. الهواء الجاف لمدة 1 ساعة.
    15. شريحة ختم بطلاء الأظافر. ويمكن تخزين الشرائح في -20 درجة مئوية حتى مزيد من التحليل.
    16. تحليل على المجهر ليزر متحد البؤر 8.

    8. تحديد الإجهاد التأكسدي بواسطة الأكسدة من إيثيديوم

    1. بعد 7 أيام من مفاجآت صيف دبي التهاب القولون، وإعداد الأنسجة كما هو موضح في الخطوة 5.7 وخفض أقسام القولون في ناظم البرد في سمك من 5 ميكرون. جبل الصليب المقاطع على الشرائح الزجاجية تعامل مع حل يسين بولي-L-واحتضان عينات خفة دمح 5 ميكرومتر من dihydroethidium (DHE) في الماء عند 37 درجة مئوية لمدة 30 دقيقة في الظلام.
    2. غسل العينات مع برنامج تلفزيوني (الرقم الهيدروجيني 7.6) ثلاث مرات لمدة 15 دقيقة لكل منهما مع الإثارة لطيف في RT. الهواء الجاف العينات وإضافة قطرة من تصاعد المتوسطة لحماية مضان. مراقبة مضان من إيثيديوم المؤكسد على الليزر مسح متحد البؤر المجهر (40X التكبير، 568 نانومتر الطول الموجي).

    9. تحليل خلايا الدم البيضاء التوظيف من الخطة الرئيسية للعمليات الفحص

    1. بعد 7 أيام من مفاجآت صيف دبي التهاب القولون، وجمع الأنسجة القولون والتجانس العينات (200-400 ملغ) مع 1 مل من hexadecyltrimethylammonium (HTAB) عازلة (0.5٪ HTAB في 50 ملي العازلة الفوسفات، ودرجة الحموضة 6.0) باستخدام الخالط على الجليد.
    2. شطف غيض من الخالط مرتين مع 1 مل من HTAB عازلة لتشمل جميع الأنسجة في المحللة ويصوتن خمس مرات في 40٪ السعة ل10 ثانية لكل منهما. تجميد ذوبان الجليد في النيتروجين السائل ثلاث مرات.
    3. أجهزة الطرد المركزي في 14000 x ج لمدة 15 دقيقة، وجمع طاف.إعداد 2،2'-azino مكرر (3-ethylbenzothiazoline-6-السلفونيك حمض) (ABTS) حل عن طريق خلط ABTS، 5 مل من سيترات الصوديوم (1 M في الماء)، 0.1 مل من بيروكسيد الهيدروجين، و 45 مل من ثنائي المياه -distilled.
    4. خلط 0.1 مل من كل طاف مع 0.1 مل من ABTS الحل في لوحة 96-جيدا مسطحة القاع. بعد 10 دقيقة، وقياس الامتصاصية في 460 نانومتر باستخدام مطياف.

    10. تقييم التعبير من السيتوكينات الموالية للالتهابات عن طريق PCR

    1. الأنسجة التجانس
      1. التجانس 50-100 ملغ من عينات الأنسجة القولون في 1 مل من خليط guanidinium ثيوسيانات الفينول كلوروفورم حمض باستخدام الخالط السلطة.
      2. احتضان في درجة حرارة الغرفة لمدة 15 دقيقة.
    2. مرحلة الانفصال
      1. إضافة 0.2 مل من الكلوروفورم ويهز بقوة لمدة 30 ثانية.
      2. احتضان عند 4 درجة مئوية لمدة 30 دقيقة.
      3. أجهزة الطرد المركزي في 12000 x ج لمدة 60 دقيقة على 4 درجات مئوية.
      4. نقل شالمرحلة المائية pper إلى أنبوب جديد (~ 500 ميكرولتر).
    3. RNA الهطول وإعادة تعليق
      1. إضافة 0.5 مل من الكحول الآيزوبروبيل واحتضان العينات عند 4 درجة مئوية لمدة 60 دقيقة.
      2. أجهزة الطرد المركزي في 12000 x ج لمدة 30 دقيقة على 4 درجات مئوية.
      3. إزالة طاف تماما.
      4. إضافة 1 مل من الايثانول 75٪ ودوامة.
      5. أجهزة الطرد المركزي في 12000 x ج لمدة 30 دقيقة على 4 درجات مئوية.
      6. إزالة طاف.
      7. السماح للالإيثانول المتبقية إلى الهواء الجاف لمدة 3-5 دقيقة.
        ملاحظة: من المهم عدم السماح للبيليه RNA يجف تماما، لأن هذا سيقلل كثيرا ذوبانه.
      8. إعادة حل بيليه في 0.3 مل من diethylpyrocarbonate (DEPC) المياه المعالجة بالإثير. على الفور نسخ من عينات الحمض النووي الريبي إلى [كدنا (أكثر استقرارا، راجع الخطوة 10.5) أو مخزن في -80 درجة مئوية.
    4. RNA الكمي
      1. تمييع 1 ميكرولتر من الحمض النووي الريبي مع 99 ميكرولتر من المياه المعالجة DEPC.
      2. قراءة الالبريد OD في 260 نانومتر و 280 نانومتر باستخدام الأشعة فوق البنفسجية / VIS معمل لتحديد تركيز العينة والنقاء.
    5. كدنا] التجميعي
      1. مزيج عينات الحمض النووي الريبي (1-5 ميكروغرام) مع 1 ميكرولتر من جزئية (DT) 12-18 (0.5 ميكروغرام / ميكرولتر) والمياه المعالجة DEPC (الحجم الكلي لل12 ميكرولتر) في ريبونوكلياز خالية من أنابيب معقمة.
      2. احتضان عند 70 درجة مئوية لمدة 10 دقيقة.
      3. إضافة 2 ميكرولتر من 10X PCR العازلة، 1 ميكرولتر من 50 ملي MgCl 1 ميكرولتر من 10 مزيج ملي dNTP، و 2 ميكرولتر من 0.1 M dithiothreitol (DTT).
      4. احتضان عند 4 درجة مئوية لمدة 5 دقائق.
      5. إضافة 1 ميكرولتر من الناسخ العكسي واحتضان عند 42 درجة مئوية لمدة 5 دقائق.
      6. احتضان عند 70 درجة مئوية لمدة 15 دقيقة.
      7. احتضان عند 4 درجة مئوية لمدة 15 دقيقة. ويمكن تخزين [كدنا] في -20 درجة مئوية حتى استخدامها مرة أخرى.
    6. PCR
      1. مزيج 2.5 ميكرولتر من 10X PCR العازلة، 1.5 ميكرولتر من 25 ملي MgCl 0.5 ميكرولتر من 10 ملي dNTP المزيج، 0.25 μL من البلمرة طق الحمض النووي، 0.25 ميكرولتر من كل التمهيدي (10 ميكرومتر) وكدنا] (100 نانوغرام)، والماء المعقم إلى الحجم الكلي لل25 ميكرولتر.
      2. تشغيل العينات على cycler الحرارية 96-جيدا. لمنع تضخيم الحمض النووي الجيني، إلى الأمام والاشعال يجب أن يكون موجودا في الإكسونات مختلفة عكس: IL1β-FW: GCAACTGTTCCTGAACTCAACT وIL1β-RE: TCTTTTGGGGTCCGTCAACT. IL6-FW: CCTTCCTACCCCAATTTCCAA وIL6-RE: AGATGAATTGGATGGTCTTGGTC. KC-FW: TGTCAGTGCCTGCAGACCAT وKC-RE: CCTGAGGGCAACACCTTCA. وأكتين-FW: TATCCACCTTCCAGCAGATGT وأكتين-RE: AGCTCAGTAACAGTCCGCCTA. استخدام شروط الاسترداد التالية: 95 درجة مئوية لمدة 5 دقائق تليها 30 دورات في درجة حرارة 95 درجة مئوية لمدة 15 ثانية، 58 درجة مئوية لمدة 30 ثانية، و 72 درجة مئوية لمدة 30 ثانية، بالإضافة إلى تمديد نهائي لمدة 10 دقيقة في 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

النظام الغذائي ملاحق يمكن أن تحمي من مفاجآت صيف دبي التهاب القولون

المضادة للالتهابات ومضادة للأكسدة المكملات الغذائية اتباع نظام غذائي، مثل فيتامين C، فيتامين E، وأكسيد النيتريك (NO) -source L-أرجينين، والأحماض الدهنية غير المشبعة ω3 (ω3-أومجا)، وقد استخدمت مع متفاوتة من النجاح في الحيوان نماذج لتخفيف علامات الأمراض الالتهابية 3،6،15. سوء التغذية، والإجهاد التأكسدي، وإنتاج السيتوكينات الموالية للالتهابات يمكن أن تؤدي على حد سواء الحادة والمزمنة والتهاب القولون 3. في دراسة سابقة، أثبتنا أن مزيج من المغذيات الدقيقة وأظهر آثار وقائية ضد الناجم عن التهاب القولون مفاجآت صيف دبي في الجسم الحي. هنا، ونحن نقدم بروتوكولات وإجراءات تفصيلية عن كيفية قياس هذه التأثيرات 8. أولا، قمنا بتحليل آثار المكملات الغذائية على تطور المرض عن طريق تحديد مؤشر نشاط المرض (DAI)، التي تتألف من المعلمات الثلاث من فقدان الوزن، قوام البراز، ونزيف حول الشرج. وأظهرت نتائج ممثل أن العلاج مفاجآت صيف دبي أدى إلى DAI-زيادة مستمرة، كما هو متوقع، بلغ حدا أقصى قدره 8.2 ± 0.46 في اليوم السابع (الشكل 1A). المضادة للالتهابات حمية مكملات تأخير ظهور التهاب القولون، ولكن في نقطة زمنية لاحقة، عندما كان التهاب القولون قوي جدا، وكان تأثير وقائي الهامشية والتي لم تعد ذات دلالة إحصائية، مما يوحي بأن مكملات الحمية لا تكون فعالة إلا عندما يكون التهاب القولون ليست قوية جدا حتى الان. الأهم من ذلك، أن التدخل الغذائي منع الناجم عن الزيادة مفاجآت صيف دبي في نفاذية الظهارية في الأمعاء، والتي هي سمة هامة من سمات التهاب القولون (الشكل 1B). أدى مفاجآت صيف دبي التهاب القولون إلى انخفاض أطوال القولون، والتخفيف من حدتها هذا تقصير أيضا المضادة للالتهابات ومضادة للأكسدة الحمية (الشكل 1C). وهكذا، والأعراض السريرية لالتهاب القولون يمكن حقا أن التخفيف من التغيرات في تركيبة النظام الغذائي.

gether.within الصفحات = "1"> الأضرار القولون الأنسجة والتفكيك من TJ وAJ خلال التهاب القولون هو تخفيف التي كتبها المضادة للالتهابات ومضاد للأكسدة ملاحق النظام الغذائي

في تحليل أسباب التهاب القولون وتقدم أقل حدة في الحيوانات تلقي تكملة النظام الغذائي، وجرى التحقيق التشكل الأنسجة بعد الهيماتوكسيلين / يوزين (H / E) تلطيخ الأنسجة القولون البعيدة جزءا لا يتجزأ من البارافين. وأظهرت عينات السيطرة على التشكل الطبيعي (الشكل 2A، لوحة العليا)، في حين أن الحيوانات تعامل مع 3.5٪ مفاجآت صيف دبي أظهرت علامات نموذجية من التهاب القولون (أي تسلل الكريات البيض، وتشكيل وذمة، وخلل التنسج سرداب، وتقرحات، الشكل 2A، وسط لوحة). من المذكرة، ومعالجة متوازية مع النظام الغذائي مكملات التغيرات المورفولوجية التي يسببها التهاب القولون التخفيف بشكل واضح، مع التشكل العام الذي كان أكثر قابلية للمقارنة مع مجموعة التحكم (الشكل 2A، اللوحة السفلية). وكانت هذه الملاحظات تشبه الى حد بعيد ما كانذكرت للمشاركة في العلاج مع البكتيريا بروبيوتيك 13 و تظهر بوضوح أن التغيرات في النظام الغذائي يمكن أن تتعارض مع تطور التهاب القولون.

نحن نعرف بالفعل ان نفاذية الظهارية في الأمعاء الناجم عن التهاب القولون يمكن مواجهة ذلك عن طريق اتباع نظام غذائي مكملات. زيادة نفاذية هي السمة المميزة لمرض التهاب الأمعاء، وأنه في جزء كبير الناجمة عن التفكيك للاستقرار تقاطعات الملتصقة (AJ) ومنعطفات ضيقة (TJ). هو فعل زعزعة الاستقرار من الاتصالات الخلايا الظهارية التي استيعاب البروتينات صلي بواسطة السيتوكينات الموالية للالتهابات، والتي يتم إنتاجها بوفرة أثناء التهاب القولون 16. لقد وجدنا من خلال تلوين مناعي من النسيج القولون البعيدة، التي استوعبت TJ جزيء نطيقة النطيقة-1 (ZO-1) وAJ جزيء E-كادهيرين خلال الناجم عن التهاب القولون مفاجآت صيف دبي وكان أن شارك في توطين هذه البروتينات المفقودة جزئيا في سرداب الاتصالات الخلايا الظهارية (الشكل 2B). أناmportantly، تدخيل E-كادهيرين وZO-1 تم تخفيض عندما كانت الفئران المعالجة مفاجآت صيف دبي شارك في تعامل مع الحمية المضادة للالتهابات ومضادة للأكسدة (الشكل 2B). وعموما، كانت سرداب وتقاطع هياكل أكثر مقارنة مع الضوابط عندما تم تطبيق ملحق غذائي، مما يشير إلى أن التأثير الوقائي لوحظ أن ما لا يقل عن ويرجع ذلك جزئيا إلى الحفاظ على هوية العمارة الأنسجة.

التدخل الغذائي يمكن مواجهة التهاب العدلات التوظيف، والإجهاد التأكسدي، وإنتاج السيتوكينات الموالية للالتهابات

السمة المميزة أخرى من مرض التهاب الأمعاء هو غير المنضبط العدلات تسلل. تساهم العدلات تجنيدهم للتلف الأنسجة من خلال إنتاج وإطلاق أنواع الاكسجين التفاعلية (ROS) والبروتياز 17. باستخدام فحص النشاط الخطة الرئيسية للعمليات، وجدنا تجنيد العدلة قوي في القولون ردا على مفاجآت صيف دبي، الذي تصدى لعن طريق الحمية مكملات (الشكل 3A).

الاكسدة هو سمة هامة أخرى من التهاب القولون، والناجمة عن إطلاق سراح ROS من العدلات تجنيدهم. وهكذا، قمنا بتحليل إنتاج ROS في القولون عبر أقسام. يوضح الشكل 3B أن العلاج مفاجآت صيف دبي ارتفعت بقوة الاكسدة. من المذكرة، والتغيرات في النظام الغذائي منعت تماما بفعل DSS-الاكسدة (الشكل 3B)، والتي هي على الأرجح نتيجة لانخفاض التوظيف العدلات (الشكل 3A).

ويتم إنتاج السيتوكينات الموالية للالتهابات وكيموكينات بقوة من قبل مختلف أنواع الخلايا خلال 18 التهاب القولون. وتساهم هذه الوسائط الالتهابية إلى المتعادلة التوظيف والبروتين تقاطع استيعاب-الميزات التي كنا نعرف بالفعل أن تكون مخففة من التغييرات في النظام الغذائي. تحليل التعبير مرنا بواسطة RT-PCR كشفت أن مفاجآت صيف دبيزيادة التعبير عن IL1β، IL-6، والمشتقة من الخلايا الكيراتينية chemokine (KC)، كما هو متوقع (الشكل 3C)، وهذا النظام الغذائي مكملات المضادة للالتهابات تقلص هذه الزيادة الناجمة عن مفاجآت صيف دبي (الشكل 3C). وتعني هذه البيانات أن يكمل النظام الغذائي يمكن أن تكون في الواقع لمواجهة الأعراض السريرية لمرض التهاب الأمعاء.

شكل 1
الشكل 1. المكملات الغذائية يمكن أن تخفف مؤشر مرض آخر، المعوية طلائي النفاذية، وتقصير القولون. (A) مؤشر نشاط المرض (DAI والقيم 0-12) ويتكون من المعلمات الثلاث من فقدان الوزن، وقوام البراز، ونزيف حول الشرج وكانت قد سجلت يوميا في المجموعات التجريبية السيطرة (السيطرة)، والتهاب القولون، والتهاب القولون + المكملات الغذائية (التهاب القولون + ملحق). وقال إن المجموعة الضابطة لم تظهر أي علامات التهاب القولون، مما أدى إلى DAI 0 throughouر الفترة التجريبية. ن = 5 لكل مجموعة. وقد تم قياس (ب) المعوية نفاذية الظهارية من قبل ايفانز تسرب الأزرق في المجموعات التجريبية المذكورة أعلاه وأعرب باسم امتصاص عند 620 نانومتر في غرام من الأنسجة. ن = 8 في كل مجموعة. وتظهر جميع البيانات كمتوسط ​​± الانحراف المعياري للمتوسط ​​(SDM). * ف <0.05. ** ف <0.01. *** ع <0.001. تم حسب الإحصاءات التي كتبها في اتجاه واحد أنوفا. (C) صور الممثل كولون كاملة من المجموعات التجريبية منها بعد 7 أيام من العلاج. المقياس على اليسار في الطول. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. الأنسجة الصرف ومفرق العمارة هي الحفاظ على أفضل أثناء التهاب القولون عند تطبيق التغذية سوpplements. (أ) 5 ميكرون البارافين المقطع العرضي من الخزعات النسيجية من كولون البعيدة للمجموعة التجريبية منها كانت ملطخة الهيماتوكسيلين / يوزين وتحليلها لعلامات نموذجية من التهاب القولون، مثل تشكيل ذمة (الأسهم)، الكريات البيض التسلل (السهام)، وتقرح (*). التشكل الأنسجة العام للالتهاب القولون + ملحق. مجموعة أكثر يشبه ذلك من سيطرة من المجموعة التهاب القولون، تثبت وجود تأثير وقائي شامل ضد مفاجآت صيف دبي التهاب القولون. الصور هي تمثيلية من 3 الاستعدادات الأنسجة مستقلة لكل مجموعة. واتخذت صورة باستخدام الهدف 10X. بار = 100 ميكرون. (ب) كانت ملطخة 8 ميكرون القولون البرد أجزاء من كل مجموعة على حدة مع الأجسام المضادة ضد ZO-1 (الخضراء) وE-كادهيرين (أحمر). شارك في الترجمة (الأصفر في الصور المدمجة، سهام) من E-كادهيرين وZO-1 في سرداب الاتصالات الخلايا الظهارية التي فقدت أثناء التهاب القولون، ويتم الاحتفاظ معظمها في التهاب القولون + ملحق. تجمع. الصور هي تمثيلية من 3الاستعدادات الأنسجة مستقلة. بار = 50 ميكرون. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. العدلات التوظيف، والإجهاد التأكسدي، وإنتاج السيتوكينات الموالية للالتهابات يمكن الحد من المكملات الغذائية. وقد تم قياس (A) الميلوبيروكسيديز (MPO) النشاط لتحليل كمية من تجنيد الكريات البيض في أنسجة القولون في المجموعات التجريبية: السيطرة (السيطرة)، والتهاب القولون، والتهاب القولون + المكملات الغذائية (التهاب القولون + ملحق). ن = 5 لكل مجموعة. * ف <0.05. وتظهر البيانات كمتوسط ​​± SDM. تم حسب الإحصاءات التي كتبها في اتجاه واحد أنوفا. (ب) مضان من إيثيديوم أكسدة، يصور في أحمر كمقياس للإجهاد التأكسدي في 8 ميكرون البرد أقسام المشتركالأنسجة خط الطول، تم تسجيلها بواسطة المجهر متحد البؤر ليزر. الصور هي تمثيلية من 3 الاستعدادات الأنسجة مستقلة. بار = 100 ميكرون. (ج) إنتاج السيتوكينات الموالية للالتهابات IL1β وIL-6 وchemokine تقرر KC من نصف الكمية RT-PCR في هلام الاغاروز 1.5٪ (وقد عادت الأسود والأبيض من أجل الوضوح). β أكتين بمثابة الجينات التدبير المنزلي. وتظهر الصور التمثيلية من ثلاثة الاستعدادات كدنا] مستقلة. الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

من أجل استخدام المكملات الغذائية في الدراسات السريرية، وفوائد وسلامة مثل هذه المكملات يجب تقييمها بعناية في الجسم الحي في الدراسات الحيوانية. في حالة التهاب القولون، تم إنشاء العديد من النماذج الحيوانية المناسبة التي تشبه الأعراض السريرية لمرض التهاب الأمعاء، بما في ذلك النماذج الكيميائية باستخدام مفاجآت صيف دبي، TNBS، أو حمض الخليك. خروج المغلوب (KO) نماذج مثل IL10-KO. والتهاب القولون المناعية خلايا بوساطة استخدام نقل بالتبني تي خلية 19-21. نموذج مفاجآت صيف دبي التهاب القولون هو طريقة سريعة وموثوق بها من إحداث التهاب القولون يشبه العديد من الأعراض مرض التهاب الأمعاء البشرية واستخدمت في عدد كبير من الدراسات التحقيق في الآليات الجزيئية للالتهاب القولون 22. وعلاوة على ذلك، مفاجآت صيف دبي التهاب القولون هو عكسها، وبالتالي يسمح أيضا لدراسة شفاء الأنسجة بعد أن تم إزالة الحوافز colitogenic. يصف بروتوكول المقدمة في التفاصيل نموذج التهاب القولون مفاجآت صيف دبي الذي تم الأمثل سابقا في مختبرنا 8.

23. بالإضافة إلى ذلك، يجب أن تكون مفاجآت صيف دبي في نطاق الوزن الجزيئي من 40 - 50 كيلو دالتون للحث على التهاب القولون. للباحث سطحي، سيكون من المهم وضع العين لإجراء تقييم غير متحيز للالمعلمات DAI من قوام البراز ونزيف حول الشرج. إذا تم إجراء تقييم من قبل الباحث سطحي، ومن المفضل أن يكون زميل تأكيد التقييم، من الناحية المثالية بطريقة أعمى.

لتحليل نفاذية الظهارية في الأمعاء عن الجزيئات، وقد استخدمت ثلاث طرق رئيسية في جميع أنحاء الأدب: فحص ايفانز الأزرق صبغ، كما هو موضح هنا. وتقطير من 4 كيلو دالتون FITC-ديكستران في حلقة المعوية. وتغذية 13،24،25 4 كيلو دالتون FITC-ديكستران. في مقايسة الأخير، ويتم تغذية FITC-ديكستران بواسطة التغذية الأنبوبيةويتم قياس كمية FITC ديكستران التي عبرت ظهارة وتسربت إلى مجرى الدم fluorometrically من عينات المصل. في هذا الاختبار، يتم قياس نفاذية الجهاز الهضمي بأكمله، منذ التتبع يمر على طول الطريق من المريء إلى المستقيم وسوف معظم التتبع تمر قبل أن تصل إلى القولون. في نموذج حلقة، يتم قياس النفاذية في المنطقة المعوية يقتصر استخدامها لحلقة (عادة في الأمعاء الدقيقة) 25. في المقابل، فإن فحص الأزرق ايفانز لديه ميزة أن يقاس فقط نفاذية الظهارية في القولون، حيث يتم غرس التتبع مباشرة في القولون بأكمله. وهكذا، وذلك باستخدام هذا الاختبار، يمكننا أن نستنتج أن ظهارة القولون محمي بواسطة تكملة النظام الغذائي.

ومن المهم دائما لتسجيل الوزن القولون وطول بعد استخراج وقبل استخدام الأنسجة لفحوصات أخرى، لأن بعض البيانات (على سبيل المثال، تسربت ايفانز الأزرق في آسا نفاذيةوأعرب ص) في غرام من الأنسجة. وعلاوة على ذلك، فإن نسبة الوزن إلى الطول هي قراءة من المستقلين من تلف الأنسجة 26. بشكل عام، يتم تحليل مورفولوجيا الأنسجة باستخدام الأنسجة جزءا لا يتجزأ من البارافين ملطخة الهيماتوكسيلين ويوزين، كما هو موضح هنا. البارافين التضمين لديه ميزة أن التشكل الأنسجة يتم حفظها أفضل بكثير بالمقارنة مع الطرق الأخرى التضمين. وهذا يسمح لتحديد لا لبس فيه من أنواع مختلفة من الخلايا في الغشاء المخاطي (أي الخلايا المناعية، ظهارة، والخلايا الكأسية، وما إلى ذلك)، وتحليل التعديلات الأنسجة أثناء التهاب القولون، مثل تشكيل ذمة، وتسلل الكريات البيض، وتقرحات قمي الظهارية. من ناحية أخرى، البارافين لديه عيب أن تلطيخ مناعي يمكن أن يؤديها إلا بعد استعادة حاتمة تستغرق وقتا طويلا. ولذلك، فإننا نستعد دائما مختلفة الخزعات النسيجية المجمدة جزءا لا يتجزأ من أكتوبر المجمع. هذه عينات الأنسجة يمكن مقطوع بسهولة باستخدام ناظم البرد وتظهر مستويات منخفضة من التسليمofluorescence. نحن نستخدم الإيثانول لتثبيت بسبب الجفاف لأن أيا من أنها لا تتداخل مع خيوط الأكتين (كما يفعل الميثانول)، كما أنها لا تسبب تألق ذاتي (كما يفعل PFA). باستخدام هذه التقنيات، وجدنا أن المكملات المضادة للالتهابات ومضادة للأكسدة النظام الغذائي يمكن أن تحسن التشكل الأنسجة والهندسة المعمارية تقاطع أثناء التهاب القولون (قارن الشكل 2).

تجنيد العدلة المفرط هو حدث بالغ الأهمية خلال التهاب القولون التي يسببها إنتاج chemoattractants ردا على التهاب 17. تجنيد العدلات هو حدث الفسيولوجية بسبب العدلات تسهم في إزالة جديلة التهابات والتئام الجروح لاحق. ومع ذلك، إذا لم يتم التحكم في هذه الاستجابة المناعية الفطرية بشكل صحيح وإنهاء، العدلات في الغشاء المخاطي يمكن أن تسهم في تلف الأنسجة عن طريق الإفراج عن البروتياز وأنواع الاكسجين التفاعلية. العدلات تحتوي الخطة الرئيسية للعمليات، والتي يمكن قياسها بسهولة وكميا باستخدامفحص اللونية، حيث كمية MPO يتناسب طرديا مع عدد العدلات. ويبين الشكل 3A أن الزيادات التوظيف المتعادلة خلال التهاب القولون وأن التدخل الغذائي يمكن أن يمنع هذه الاستجابة المناعية المفرطة وغير المنضبط. وفقا للوجود العدلات وفرة في الغشاء المخاطي، ويزيد من الاكسدة خلال التهاب القولون (الشكل 3B).

النظام الغذائي لدينا مكملات يحمي بوضوح الغشاء المخاطي من الاكسدة، الذي هو على الأرجح نتيجة لانخفاض التوظيف العدلة. وكما ذكر، وتنجذب العدلات من كيموكينات والتي يسببها إنتاج كيموكينات من السيتوكينات الموالية للالتهابات التي تفرز من قبل مختلف أنواع الخلايا أثناء التهاب القولون. وبالتالي، فإننا نفترض أن انخفاض التوظيف العدلات هو نتيجة لانخفاض خلوى والإنتاج chemokine. يوضح الشكل 3C أن السيتوكينات الموالية للالتهابات IL-1β و IL-6، وكذلكchemokine KC، وupregulated خلال التهاب القولون الناجم عن مفاجآت صيف دبي. تكملة النظام الغذائي عكس مستويات IL-6 العودة للسيطرة على مستويات وتحسينها وزيادة إنتاج IL-1β وKC. وتجدر الإشارة، KC هو جاذب كيميائي أهم لالعدلات في الفئران.

وبالتالي، فمن المغري أن يتكهن بأن الحفاظ وحظ مورفولوجيا الأنسجة ويرجع ذلك إلى انخفاض تسلل العدلات، والتي هي بدورها نتيجة لانخفاض إنتاج KC. تحليل إنتاج الحمض النووي الريبي في الأنسجة تعامل DSS-بواسطة RT-PCR إشكالية عندما مفاجآت صيف دبي المتبقية موجودة في الحمض النووي الريبي معزولة. وذلك لأن مفاجآت صيف دبي يمنع كلا transcriptases العكسي وطق بلمرة. إذا لا يمكن أن يتحقق أي التضخيم، سيكون من الضروري لمواصلة تنقية عينات الحمض النووي الريبي عن طريق الترسيب بوساطة LiCl، كما هو موضح في مكان آخر (27).

باختصار، نحن تصف بالتفصيل طرق مختلفة لتحليل تلف الأنسجة خلال مفاجآت صيف دبي التهاب القولون وكيف دamage يمكن تحسينها عن طريق المكملات الغذائية. المعارف المكتسبة من التجارب على الحيوانات مثل هذه يمكن أن يبرر إنشاء أفواج المرضى للتحقيق في آثار وقائية من الملاحق التي تم تحليلها في IBD البشري. قد البيانات التي تم الحصول عليها من الدراسات السريرية ثم فتح آفاقا جديدة لتطوير استراتيجيات علاجية بديلة لإدارة مرض التهاب الأمعاء.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

الكتاب ليس لديهم ما يكشف.

Acknowledgments

وأيد هذا العمل من المنح المقدمة من المجلس المكسيكي للعلوم والتكنولوجيا (كوناكيت، 207268 و233395 لمايكل Schnoor). KFCO هي المستفيدة من راتب كوناكيت (396260) للحصول على درجة الماجستير.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
تحليل مفيد آثار المكملات الغذائية على وظائف الأمعاء طلائي الحاجز أثناء التجريبية التهاب القولون
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter