Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

Summary

Current treatments of inflammatory bowel diseases (IBD) aim at alleviating disease symptoms but may cause severe side effects. Thus, alternative strategies are being investigated in animal colitis models. Here, we explain how the beneficial effects of diet supplements on clinical IBD signs are analyzed in such a colitis model.

Abstract

Inflammatory bowel diseases (IBD), including Crohn's disease and ulcerative colitis, are chronic relapsing disorders of the intestines. They cause severe problems, such as abdominal cramping, bloody diarrhea, and weight loss, in affected individuals. Unfortunately, there is no cure yet, and treatments only aim to alleviate symptoms. Current treatments include anti-inflammatory and immunosuppressive drugs that may cause severe side effects. This warrants the search for alternative treatment options, such as nutritional supplements, that do not cause side effects. Before their application in clinical studies, such compounds must be rigorously tested for effectiveness and security in animal models. A reliable experimental model is the dextran sulfate sodium (DSS) colitis model in mice, which reproduces many of the clinical signs of ulcerative colitis in humans. We recently applied this model to test the beneficial effects of a nutritional supplement containing vitamins C and E, L-arginine, and ω3-polyunsaturated fatty acids (PUFA). We analyzed various disease parameters and found that this supplement was able to ameliorate edema formation, tissue damage, leukocyte infiltration, oxidative stress, and the production of pro-inflammatory cytokines, leading to an overall improvement in the disease activity index. In this article, we explain in detail the correct application of nutritional supplements using the DSS colitis model in C57Bl/6 mice, as well as how disease parameters such as histology, oxidative stress, and inflammation are assessed. Analyzing the beneficial effects of different diet supplements may then eventually open new avenues for the development of alternative treatment strategies that alleviate IBD symptoms and/or that prolong the phases of remission without causing severe side effects.

Introduction

Colitis is an inflammatory condition of the colon that can cause diarrhea and abdominal pain. Colitis can be acute, in response to infection or to stress, or it can develop as a chronic disease, such as in ulcerative colitis (UC), which belongs to the group of inflammatory bowel diseases (IBD). Although the clinical signs of UC have been well described, the pathogenesis is still poorly understood¹. It is accepted among experts that UC is a multifactorial disease, with genetic mutations and aberrant immune responses playing a major role². However, environmental factors, such as style of living and nutrition, also contribute to disease development and progression³.

Unfortunately, IBD is not curable, but there are many treatment options that aim to alleviate clinical symptoms. Current treatments include anti-inflammatory drugs, such as sulfasalazine and corticosteroids; immunosuppressants, such as azathioprine; monoclonal antibodies that capture pro-inflammatory cytokines, such as tumor necrosis factor-α (TNF-α), or block adhesion molecules, such as integrins, to reduce excessive leukocyte recruitment; and inhibitors that target kinases that trigger pro-inflammatory pathways, such as Janus kinase (JAK)⁴. Not all patients respond to all treatments, so therapeutic strategies must be individualized⁵. Furthermore, most of these therapeutic drugs interfere with the metabolism and immune responses, often causing severe side effects. For this reason, alternative treatment options have been investigated.

Alternative treatments include probiotics and nutritional supplements, which have been applied in animal models and clinical trials with varying levels of success^6,7. We recently found that the application of different single nutritional supplements, such as anti-oxidative vitamins or ω3-poly-unsaturated fatty acids (PUFAs), is inferior to the application of a combination of such supplements in alleviating colitis and cardiovascular disease symptoms^8,9. These studies were performed in mice, so clinical studies must be performed in humans to determine whether these findings will also be applicable to humans. Before clinical studies are initiated, the effectiveness and safety of new treatment options must be evaluated in animal models.

For IBD, the dextran sulfate sodium (DSS) model has been widely used to study the mechanisms of disease development and the beneficial effects of drugs and nutritional supplements^6,10. In most studies, only an acute disease over a time period of seven days is induced; nevertheless, the clinical signs observed in these animals closely resemble those observed in IBD patients (i.e., bloody diarrhea, weight loss, epithelial dysfunction, and immune cell infiltration)¹⁰. DSS induces erosions in the mucosa, resulting in barrier dysfunction and in increased intestinal epithelial permeability¹¹. The exact mechanism remains unknown. However, a study suggests that DSS interacts with medium chain-length fatty acids to form nano-lipocomplexes that are able to enter epithelial cells and to induce inflammatory signaling pathways¹². In this article, we describe in detail how colitis is induced and analyzed in mice, how nutritional supplements are applied by gavage to ensure a constant dosage in each animal, and how the effects of such supplements on various colitis symptoms are examined.

Protocol

All animal experiments have been approved by the Institutional Animal Care and Use Committee of Cinvestav.

1. Preparation of DSS Drinking Water and the Induction of Colitis

1. Prepare a 3.5% w/v dextran sulfate sodium (DSS) solution in autoclaved drinking water. DSS dissolves easily and it is not required to filter the final solution.
   NOTE: 7 days of DSS treatment induces severe colitis. If inducing mild colitis, 3 - 4 days of treatment are recommended. As long as the DSS drinking water stays clear, it is not necessary to change the water. However, if it turns turbid, it must be replaced.
2. Record the baseline weight of male mice. Ensure that they are 8 - 12 weeks of age and within a range of 21 - 25 g bodyweight.
   NOTE: The appropriate DSS concentration must be optimized in each laboratory. Results can greatly vary, depending upon the housing conditions. Concentrations between 2.5 - 5% are usually reported to induce strong colitis in C57Bl/6J WT mice¹⁰. DSS from different companies and different lots should be tested, as results may also vary with different sources of DSS.
3. Provide water ad libitum and replace it with fresh 3.5% DSS water if necessary.

2. Application of Nutritional Supplements by Gavage

1. Prepare a "feedable" solution of the desired nutritional supplements in an appropriate solvent. For this study, we used a mixture containing 200 mg/kg L-arginine, 83 mg/kg vitamin C, 46 mg/kg vitamin E, 77 mg/kg eicosapentaenoic acid (EPA), and 115 mg/kg docosahexaenoic acid (DHA) in a 1:1 solution of water and safflower oil.
2. Fill a 1-mL syringe connected to a gavage needle (15 G x 50 mm) with the nutritional supplement mixture. Wipe the outside of the gavage needle to remove any compound outside of the needle and to ensure proper dose application.
3. Restrain the mouse by grasping the base of the tail with one hand and by firmly gripping a skin fold at the back of the neck with the thumb and forefinger of the other hand. Place the tail between the third finger and the base of the thumb of the same hand that holds the neck.
4. While maintaining the mouse in an upright position, insert the needle into the left side of the animal's mouth and carefully follow the roof of the mouth to locate the esophagus. If no resistance is encountered, advance the needle towards the stomach.
   NOTE: Verify that the animal is breathing properly before proceeding.
5. Administer the mixture slowly, remove the tube by slowly pulling out the syringe, and release the mouse. Apply nutritional supplements once daily by gavage during the course of the colitis experiment.

3. Determination of the Disease Activity Index

NOTE: The disease activity index is the combination of the scores for weight loss, perianal bleeding, and stool consistency, which are obtained daily¹³.

1. Measure the bodyweight daily and assign a score of 0 to 4 according to the weight loss percentage (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, and 4: > 20%).
   NOTE: Bodyweight loss is determined by calculating the difference in percent between the basal weight before the induction of DSS-colitis and the actual weight.
2. To determine the level of perianal bleeding, collect a fresh stool sample and use the provided applicators to apply a thin smear on a slide from a guaiac fecal occult blood test kit. Use a fresh applicator for each sample.
   1. Close the cover on the front and open the window on the back of the slide. Apply two drops of the developer solution to the back at the sample location.
   2. Read the results after 30 s. Any trace of blue color is positive for occult blood. Assign a score of 0 to 4 (0: none, 0.5 - 2.5: positive guaiac fecal occult blood test (depending upon the signal strength), and 3 - 4: gross bleeding).
      NOTE: If blood in the stool is visible, the guaiac fecal occult blood test does not have to be performed, and a score of 3, 3.5, or 4 is assigned, depending upon the amount of visible blood.
3. Determine stool consistency by observing a fresh stool sample. Assign a score of 0 to 4 (0: normal/solid, 0.5 - 2.5: pasty stool, and 3 - 4: diarrhea).

4. Determining Intestinal Epithelial Permeability In Vivo by Evans Blue Assay

1. Anesthetize the animals by injecting them intraperitoneally with a mixture of ketamine (100 mg/kg of bodyweight) and xylazine (13 mg/kg of bodyweight) diluted in saline solution (0.9% NaCl), and assess the depth of anesthesia by monitoring the pinch withdrawal reflex.
2. Place the anesthetized animals in a supine position and perform a laparotomy to expose the intestines.
3. Locate the cecum and make a small incision in the proximal segment of the colon ascendens (ideally, immediately adjacent to the cecum).
4. Insert a feeding needle (G22) and secure it with a ligature using a common silk thread. Carefully flush abundant PBS through the tube to rinse out all feces from the colon. Instill Evans blue solution (1.5% w/v in PBS) into the colon until it reaches the anus.
5. Incubate the Evans blue for 15 min. Wash out the dye by flushing the tube with abundant PBS until the perianal washout is clear.
6. Euthanize the animals by cervical dislocation.
7. Excise the colon and rinse it again with abundant PBS. Rinse once with 1 mL of 6 mM N-acetylcysteine in PBS to eliminate any dye sticking to the colonic mucus.
8. Cut the colon longitudinally and rinse it once more with PBS and 1 mL of 6 mM N-acetylcysteine.
9. Record the weight and length. To extract the Evans blue dye, place the colon in 2 mL of N,N-dimethylformamide overnight at room temperature with gentle agitation. Measure the dye concentration spectrophotometrically at 610 nm.

5. Tissue Collection

1. Anesthetize the animals by injecting them intraperitoneally with a mixture of ketamine (100 mg/kg of bodyweight) and xylazine (13 mg/kg of bodyweight) diluted in saline solution (0.9% NaCl), and assess the depth of anesthesia by monitoring the pinch withdrawal reflex.
2. Euthanize the animals by cervical dislocation.
3. Place the animals in a supine position and perform a laparotomy to expose the abdominal cavity.
4. Using scissors, dissect the entire colon and record its length.
5. Flush the colon carefully several times with chilled PBS to remove the feces. Record the tissue weight and prepare for the following experiments, as described in steps 5.6 - 5.8.
6. For RNA isolation and myeloperoxidase (MPO) assays, cut off an appropriately-sized tissue sample (100 mg is usually sufficient), place it inside a tube, and snap-freeze it in liquid nitrogen. Store the tissues at -80 °C for future use.
7. For immunofluorescence staining and oxidative stress determination (see below), cut a small colon sample (0.5 - 1 cm) and submerse it in small aluminum cups filled with optimal cutting temperature (OCT) compound. Place the cups on dry ice and let them freeze slowly, in order to avoid bubble formation. Frozen tissue samples can be stored at -80 °C for future use.
8. For Swiss rolls¹⁴, open the colon longitudinally and carefully remove feces using forceps. Roll it up, with the mucosa facing inwards, using fine-tipped forceps or a thin, round wooden stick. Carefully place it inside an embedding cassette and continue with step 6.1.
   NOTE: DSS induces damage in the colon. However, damage distribution varies from the proximal to the distal colon, with most damage usually seen in the distal colon and rectum. Thus, we recommend analyzing the histology either in the distal colon or in Swiss roles of the entire colon.

6. Analysis of Colon Histology by Hematoxylin-eosin Staining

1. Tissue Preparation
   1. For the histological analysis, submerge either the Swiss rolls or the small tissue pieces from certain colon regions of control and treated mice in 5 mL of 10% formaldehyde for 48 h at room temperature (RT) to achieve proper fixation.
      NOTE: All further steps in step 6 are carried out at RT, unless otherwise indicated.
   2. Wash them with tap water for 18 h.
   3. Dehydrate them with 15 mL of 70% ethanol for 1 h, 96% for 1 h, and absolute ethanol for 1 h. Repeat each step with fresh alcohol before proceeding to the next concentration.
   4. Continue the dehydration in a mixture of 7.5 mL of absolute ethanol and 7.5 mL of absolute xylene for 1 h. Repeat once before passing the samples to 15 mL of absolute xylene for 1 h. Repeat this step once with fresh xylene.
2. Embedding Colon Tissue Samples in Paraffin
   1. Immerse the samples in 50 mL of liquid paraffin for 17 h. Repeat this step once but for only 3 h.
   2. Immerse the samples in cubes (plastic, square mold, size: 22 x 22 x 22 mm) in 810 mL of liquid paraffin.
   3. Allow the paraffin with the colon tissue samples to solidify for 24 h at RT.
3. Cutting Tissue Cross-sections using a Microtome
   1. Cut colon samples using a microtome, according to the manufacturer's instructions, at a thickness of 5 µm.
   2. Collect the cuts in a water bath (1 L) containing 0.3% gelatin. This prevents the folding of tissue cross-sections. Recover the tissue sections and mount them on glass slides.
4. Hematoxylin and Eosin Staining of Tissue Cross-sections
   1. Deparaffinize the samples for 18 h at 60 °C in an incubator. For this purpose, use a glass slide rack with a handle.
   2. After deparaffinization, immerse the slides in 70 mL of absolute xylene for 5 min. Repeat this step once with fresh xylene.
   3. Transfer the samples into 70 mL of absolute alcohol for 1 min. Repeat this step once with fresh alcohol.
   4. Incubate the colon tissue samples in 70 mL of ethanol 96% for 1 min. Repeat this step once with fresh alcohol.
   5. Wash the samples in tap water twice for 2 s.
   6. Incubate the tissues in Harris hematoxylin for 7 min.
   7. Wash the samples in tap water twice for 2 s.
   8. Incubate the samples in acidic alcohol (70 mL of ethanol 70% and 700 µL of 1 M hydrochloric acid) for 7 s.
   9. Wash the samples in tap water twice for 2 s.
   10. Incubate the tissue samples in 70 mL of lithium carbonate (1 g of lithium carbonate in 100 mL of distillated water) for 7 s.
   11. Wash the samples in tap water twice for 2 s.
   12. Incubate the samples in 70 mL of ethanol 80% for 1 min.
   13. Transfer the samples into 70 mL of Eosin-Y for 15 s.
   14. Incubate them in 70 mL of 96% ethanol for 1 min. Repeat this step once with fresh alcohol.
   15. Incubate the tissue samples in 70 mL of absolute ethanol (ethyl alcohol absolute anhydrous) for 1 min. Repeat this step once with fresh alcohol.
   16. Incubate the samples in 70 mL of a mixture of 35 mL of absolute alcohol and 35 mL of absolute xylene for 1 min.
   17. Transfer the samples into 70 mL of absolute xylene for 1 min. Repeat this step for 5 min in 70 mL of fresh absolute xylene.
   18. Add 80 µL of synthetic resin to the colon tissue samples, cover them with coverslips, and let them dry for 24 h at RT. Finally, analyze the samples using bright-field microscopy⁸.

7. Analyzing Junction Composition by Immunofluorescence

1. Prepare the tissue as described in step 5.7 and cut 8 µm-thick cross-sections using a cryostat.
2. Fix and permeabilize colon cross-sections with 96% ethanol at -20 °C for 20 min.
   NOTE: All subsequent incubations should be carried out at RT, unless otherwise stated, in a humid dark box to prevent drying and fluorochrome fading.
3. Air-dry samples, and then rinse them 3 times for 5 min each with 1x PBS
4. Incubate the samples with blocking solution (PBS containing 0.01% Tween and 2% BSA) for 2 h.
5. Remove the blocking solution and rinse it with PBS-0.01% Tween for 10 min.
6. During this time, dilute the primary antibodies to the desired concentrations in PBS-0.01% Tween.
7. Remove the washing solution, apply the antibody solution from the previous step, and incubate overnight at 4 °C in a humidified box.
8. Remove the antibody solution and wash 3 times with PBS-0.01% Tween for 5 min each and once with deionized water for 10 min, with very gentle agitation.
9. While washing, centrifuge fluorochrome­conjugated, species-specific secondary antibodies at 14,000 x g for 20 min at 4 °C.
10. Dilute the secondary antibodies without precipitates as indicated by the provider in PBS-0.01% Tween, apply them, and incubate for 1 h at RT.
11. Repeat step 7.8 and remove the washing solution as completely as possible.
12. Pipette 4 µL of anti-fading agent over each sample on the slide.
13. Cover the samples with a coverslip.
14. Air dry for 1 h.
15. Seal slide with nail polish. Slides can be stored at -20 °C until further analysis.
16. Analyze on a confocal laser microscope⁸.

8. Determination of Oxidative Stress by Oxidation of Ethidium

1. After 7 days of DSS colitis, prepare tissue as described in step 5.7 and cut colon sections in a cryostat at a thickness of 5 µm. Mount cross-sections onto glass slides treated with poly-L-lysine solution and incubate the samples with 5 µM of dihydroethidium (DHE) in water at 37 °C for 30 min in the dark.
2. Wash the samples with PBS (pH 7.6) three times for 15 min each with gentle agitation at RT. Air dry the samples and add a drop of mounting medium to protect the fluorescence. Observe the fluorescence of oxidized ethidium on a laser-scanning confocal microscope (40X magnification, 568 nm wavelength).

9. Analysis of Leukocyte Recruitment by MPO Assay

1. After 7 days of DSS colitis, collect colon tissue and homogenize the samples (200 - 400 mg) with 1 mL of hexadecyltrimethylammonium (HTAB) buffer (0.5% HTAB in 50 mM phosphate buffer, pH 6.0) using a homogenizer on ice.
2. Rinse the tip of the homogenizer twice with 1 mL of HTAB buffer to include all tissue in the lysate and sonicate it five times at 40% amplitude for 10 s each. Freeze-thaw in liquid nitrogen three times.
3. Centrifuge at 14,000 x g for 15 min and collect the supernatant. Prepare 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) solution by mixing ABTS, 5 mL of sodium citrate (1 M in water), 0.1 mL of hydrogen peroxide, and 45 mL of bi-distilled water.
4. Mix 0.1 mL of each supernatant with 0.1 mL of ABTS solution in a 96-well flat-bottomed plate. After 10 min, measure the absorbance at 460 nm using a spectrophotometer.

10. Evaluating the Expression of Pro-inflammatory Cytokines by PCR

1. Tissue Homogenization
   1. Homogenize 50 to 100 mg of colon tissue samples in 1 mL of an acid guanidinium thiocyanate-phenol-chloroform mixture using a power homogenizer.
   2. Incubate it at room temperature for 15 min.
2. Phase Separation
   1. Add 0.2 mL of chloroform and shake vigorously for 30 s.
   2. Incubate at 4 °C for 30 min.
   3. Centrifuge at 12,000 x g for 60 min at 4 °C.
   4. Transfer the upper aqueous phase into a fresh tube (~500 µL).
3. RNA Precipitation and Resuspension
   1. Add 0.5 mL of isopropyl alcohol and incubate the samples at 4 °C for 60 min.
   2. Centrifuge at 12,000 x g for 30 min at 4 °C.
   3. Remove the supernatant completely.
   4. Add 1 mL of ethanol 75% and vortex.
   5. Centrifuge at 12,000 x g for 30 min at 4 °C.
   6. Remove the supernatant.
   7. Allow the remaining ethanol to air-dry for 3-5 min.
      NOTE: It is important not to let the RNA pellet dry completely, as this will greatly decrease its solubility.
   8. Re-dissolve the pellet in 0.3 mL of diethylpyrocarbonate (DEPC)-treated water. Immediately transcribe the RNA samples into cDNA (more stable, see step 10.5) or store at -80 °C.
4. RNA Quantification
   1. Dilute 1 µL of RNA with 99 µL of DEPC-treated water.
   2. Read the OD at 260 nm and 280 nm using a UV/VIS spectrophotometer to determine sample concentration and purity.
5. cDNA Synthesis
   1. Mix RNA samples (1-5 µg) with 1 µL of Oligo(dT)_12-18 (0.5 µg/µL) and DEPC-treated water (total volume of 12 µL) in RNase-free sterile tubes.
   2. Incubate at 70 °C for 10 min.
   3. Add 2 µL of 10x PCR Buffer, 1 µL of 50 mM MgCl₂, 1 µL of 10 mM dNTP mix, and 2 µL of 0.1 M dithiothreitol (DTT).
   4. Incubate at 4 °C for 5 min.
   5. Add 1 µL of reverse transcriptase and incubate at 42 °C for 5 min.
   6. Incubate at 70 °C for 15 min.
   7. Incubate at 4 °C for 15 min. cDNA can be stored at -20 °C until further use.
6. PCR
   1. Mix 2.5 µL of 10x PCR Buffer, 1.5 µL of 25 mM MgCl₂, 0.5 µL of 10 mM dNTP mix, 0.25 µL of Taq DNA polymerase, 0.25 µL of each primer (10 µM) and cDNA (100 ng), and sterile water to a total volume of 25 µL.
   2. Run the samples on a 96-well thermal cycler. To prevent amplification of genomic DNA, forward and reverse primers should be located in different exons: IL1β-FW: GCAACTGTTCCTGAACTCAACT and IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA and IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT and KC-RE: CCTGAGGGCAACACCTTCA; and Actin-FW: TATCCACCTTCCAGCAGATGT and Actin-RE: AGCTCAGTAACAGTCCGCCTA. Use the following PCR conditions: 95 °C for 5 min followed by 30 cycles at 95 °C for 15 s, 58 °C for 30 s, and 72 °C for 30 s, plus a final extension for 10 min at 72 °C.

Results

Diet Supplements Can Protect from DSS Colitis

Anti-inflammatory and anti-oxidative diet supplements, such as vitamin C, vitamin E, the nitric oxide (NO)-source L-arginine, and ω3-polyunsaturated fatty acids (ω3-PUFAs), have been used with varying success in animal models to alleviate signs of inflammatory diseases^3,6,15. Malnutrition, oxidative stress, and the production of pro-inflammatory cytokines can trigger both acu...

Discussion

In order to use nutritional supplements in clinical studies, the benefits and safety of such supplements must be carefully evaluated in vivo in animal studies. In the case of colitis, several appropriate animal models that resemble the clinical signs of IBD have been established, including chemical models using DSS, TNBS, or acetic acid; knock-out (KO) models such as IL10-KO; and immune-cell-mediated colitis using adoptive T-cell transfer^19-21. The DSS model of colitis is a rapid and reliable method o...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
0.3% of gelatin	Bioxon	158
10% formaldehyde	J.T. Baker	2106-03
96-well plate with flat bottom	Corning	3368
Absolute ethanol	J.T. Baker	9000-03
Absolute xylene	J.T. Baker	9490-03
ABTS	Sigma Aldrich	H5882
Bovine Serum Albumin	Sigma-Aldrich	9048-46-8
ColoScreen	Helena Laboratories	5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico)	Merck
Dextran Sulfate Sodium Salt	Affymetrix	9011-18-1	(M.W. 40,000-50,000)
Dihydroethidium	Life Technology	D11347
Eosin-Y	J.T. Baker	L087-03
Evans blue	Sigma-Aldrich	314-13-6
Feeding  needle	Cadence Science Inc.	9921
Glass slide rack with handle	Electron Microscopy	70312-16
Glass Slides	Corning	2947
Harris hematoxylin	Sigma-Aldrich	H3136
Hexadecyltrimethyammonium (HTAB)	Sigma Aldrich	H6269
Histosette (Embedding cassette)	Simport	M498.2
Hydrochloric acid 1 M	J.T. Baker	9535-62
Hydrogen peroxide	Sigma Aldrich	H3410
Ketamine	PiSA Agropecuaria	Q-7833-028
Liquid paraffin	Paraplast	39501-006
Lithium carbonate	Sigma-Aldrich	2362
N,N-dimethylformamide	J.T. Baker	68-12-2
N-acetylcysteine	Sigma-Aldrich	A9165
Plastic cubes	Electron Microscopy	70181
Poly-L-Lysine Solution	Sigma-Aldrich	25988-63-0
Prism 5 statistical software	GraphPad Software	Prism 5
Saline Solution 0.9% NaCl	CS PiSA	Q-7833-009
Sodium citrate	Sigma-Aldrich	W302600
Synthetic resin	Poly Mont	7987
Taq DNA polymerase	Invitrogen	11615-010
Tissue-tek. O.C.T Compound	Sakura Finetek	4583
Tuberculine Syringe	BD Plastipak	305945
Tween 20	Sigma-Aldrich	9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI	Vector Laboratories	H-1200
Xylazine	PiSA Agropecuaria	Q-7833-099