Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Analysere gunstige effektene av kosttilskudd på Intestinal Epitelial barrierefunksjoner Under Experimental kolitt

doi: 10.3791/55095 Published: January 5, 2017

Summary

Dagens behandling av inflammatoriske tarmsykdommer (IBD) tar sikte på å lindre sykdom symptomer, men kan forårsake alvorlige bivirkninger. Dermed blir alternative strategier blir undersøkt i dyre kolitt modeller. Her forklarer vi hvordan de gunstige effektene av kosttilskudd på kliniske IBD skiltene er analysert i en slik kolitt modell.

Abstract

Inflammatoriske tarmsykdommer (IBD), inkludert Crohns sykdom og ulcerøs kolitt, er kronisk tilbakevendende sykdommer i tarmene. De forårsaker alvorlige problemer, for eksempel magekramper, blodig diaré, og vekttap, i berørte personer. Dessverre er det ingen kur ennå, og behandlinger bare tar sikte på å lindre symptomene. Aktuelle behandlinger inkluderer anti-inflammatorisk og immundempende medikamenter som kan forårsake alvorlige bivirkninger. Dette garanterer jakten på alternative behandlingstilbud, for eksempel kosttilskudd, som ikke forårsaker bivirkninger. Før sin søknad i kliniske studier, må slike forbindelser bli grundig testet for effektivitet og sikkerhet i dyremodeller. En pålitelig eksperimentell modell er dekstransulfat natrium (DSS) kolitt-modell i mus, som gjengir mange av de kliniske tegn på ulcerøs kolitt hos mennesker. Vi har nylig brukt denne modellen for å teste den reelle effekten av et kosttilskudd som inneholdervitamin C og E, L-arginin og co 3-flerumettede fettsyrer (PUFA). Vi analyserte forskjellige sykdomsparametre og fant at dette tillegget var i stand til å lindre ødemdannelse, vevsskade, leukocytt infiltrering, oksidativt stress, og produksjonen av pro-inflammatoriske cytokiner, fører til en generell forbedring i sykdomsaktivitetsindeks. I denne artikkelen forklarer vi i detalj korrekt anvendelse av kosttilskudd bruker DSS kolitt modell i C57BL / 6 mus, samt hvordan sykdomsparametre som histologi, oksidativt stress og betennelse vurderes. Analysere de gunstige effektene av ulike kosttilskudd kan deretter eventuelt åpne nye veier for utvikling av alternative behandlingsstrategier som lindrer IBD symptomer og / eller som forlenger faser av remisjon uten å forårsake alvorlige bivirkninger.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kolitt er en betennelsestilstand i tykktarmen som kan forårsake diaré og magesmerter. Kolitt kan være akutt, som respons på infeksjon eller stress, eller det kan utvikle seg som en kronisk sykdom, slik som i ulcerøs kolitt (UC), som tilhører gruppen av inflammatoriske tarmsykdommer (IBD). Selv om kliniske tegn på UC er godt beskrevet, er patogenesen fortsatt dårlig forstått en. Det er akseptert blant eksperter at UC er en multifaktoriell sykdom, med genetiske mutasjoner og avvikende immunresponser som spiller en stor rolle 2. Men miljøfaktorer som livsstil og ernæring, også bidra til sykdomsutvikling og progresjon tre.

Dessverre er IBD ikke kureres, men det er mange behandlingstilbud som tar sikte på å lindre kliniske symptomer. Aktuelle behandlinger inkluderer anti-inflammatorisk narkotika, for eksempel sulfasalazin og kortikosteroider; immunsuppressive midler, slik som azathioPrine; monoklonale antistoffer som bevarer pro-inflammatoriske cytokiner, slik som tumornekrosefaktor-α (TNF-α), eller blokkere adhesjonsmolekyler, slik som integriner, for å redusere overdreven leukocytt-rekruttering; og hemmere som er rettet mot kinaser som utløser proinflammatoriske trasé, slik som Janus kinase (JAK) 4. Ikke alle pasienter svare på alle behandlinger, så terapeutiske strategier må individualiseres 5. Videre er de fleste av disse terapeutiske legemidler interfererer med metabolismen og immunresponser, ofte forårsaker alvorlige bivirkninger. Av denne grunn har alternative behandlingstilbud blitt undersøkt.

Alternative behandlinger inkluderer probiotika og kosttilskudd, som er anvendt i dyremodeller og kliniske forsøk med varierende grad av suksess 6,7. Vi har nylig funnet ut at anvendelsen av ulike enkelt kosttilskudd, slik som anti-oksidative vitaminer eller ω3-poly-umettede fettsyrer (PUFAs), er dårligere enn bruk av en kombinasjon av slike tilskudd i å lindre kolitt og kardiovaskulær sykdom symptomer 8,9. Disse studiene ble utført i mus, så kliniske studier må utføres i mennesker for å bestemme hvorvidt disse funn vil også være anvendelig for mennesker. Før kliniske studier er igangsatt, må effektiviteten og sikkerheten av nye behandlingsalternativer vurderes i dyremodeller.

For IBD har dekstransulfat natrium (DSS) modellen er mye brukt til å studere mekanismer for sykdomsutvikling og de gunstige effektene av legemidler og kosttilskudd 6,10. I de fleste studiene, bare en akutt sykdom i løpet av et tidsrom på syv dager blir indusert; Likevel, de kliniske tegn observert i disse dyrene ligner de som ble observert i IBD pasienter (dvs. blodig diaré, vekttap, epithelial dysfunksjon, og immuncelleinfiltrasjon) 10. DSS induserer erosjoner i slimhinnene,resulterer i barriere dysfunksjon og økt intestinal epitel permeabilitet 11. Den eksakte mekanisme er ukjent. Imidlertid tyder en studie som DSS samhandler med middels kjedelengde fettsyrer for å danne nano lipocomplexes som er i stand til å gå inn epitelceller og å indusere inflammatoriske signalveier 12. I denne artikkelen beskriver vi i detalj hvordan kolitt indusert og analysert hos mus, hvordan ernæringstilskudd er brukt av sonde for å sikre en konstant dose i hvert dyr, og hvordan virkningene av slike kosttilskudd på ulike kolitt symptomer er undersøkt.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Alle dyreforsøk har blitt godkjent av Institutional Animal Care og bruk komité Cinvestav.

1. Utarbeidelse av DSS drikkevann og induksjon av kolitt

  1. Tilbered en 3,5% w / v dekstransulfat natrium (DSS) løsning i Autoclaved drikkevann. DSS oppløses lett og det er ikke nødvendig å filtrere den endelige løsningen.
    MERK: 7 dager DSS behandling induserer alvorlig kolitt. Hvis indusere mild kolitt, 3 - er 4 dagers behandling anbefales. Så lenge DSS drikkevannet holder seg klart, er det ikke nødvendig å endre vann. Imidlertid, hvis den blir grumset, må den skiftes ut.
  2. Ta opp den grunnlinjevekten av hannmus. Sørg for at de er 8 - 12 ukers alder og innenfor et område på 21-25 g kroppsvekt.
    MERK: Den aktuelle DSS konsentrasjonen må optimaliseres i hvert laboratorium. Resultatene kan variere sterkt, avhengig av boforhold. Konsentrasjoner mellom 2,5 til 5% er vanligvis rapportert å indusere sterk colitis i C57Bl / 6J WT mus 10. DSS fra ulike selskaper og forskjellige partier skal testes, som resultater kan også variere med ulike kilder til DSS.
  3. Gi vann ad libitum og erstatte den med friskt 3,5% DSS vann om nødvendig.

2. Bruk av kosttilskudd ved tvangsforing

  1. Utarbeide en "feedable" løsning av de ønskede kosttilskudd i et passende løsemiddel. For denne studien ble det benyttet en blanding inneholdende 200 mg / kg L-arginin, 83 mg / kg vitamin C, 46 mg / kg vitamin E, 77 mg / kg eikosapentaensyre (EPA), og 115 mg / kg dokosaheksaensyre (DHA ) i en 1: 1 løsning av vann og safflower olje.
  2. Fyll en 1-ml sprøyte som er koblet til en sonde nål (15 G x 50 mm) med kosttilskudd blandingen. Tørk utsiden av sonde nålen for å fjerne hvilken som helst forbindelse utsiden av nålen og for å sikre at dosen anvendelse riktig.
  3. Beherske musen ved å ta tak i haleroten meden hånd og ved fast å gripe en hud fold på baksiden av halsen med tommelen og pekefingeren på den andre hånden. Plassere halen mellom den tredje finger og roten av tommelen av samme hånd som holder halsen.
  4. Samtidig opprettholde musen i en oppreist posisjon, stikk nålen inn i venstre side av dyrets munn og følg taket av munnen for å finne spiserøret nøye. Hvis det oppstår ingen motstand, avansere nålen mot magen.
    MERK: Kontroller at dyret puster skikkelig før du fortsetter.
  5. Administrere blandingen langsomt, fjerne røret ved sakte trekke ut sprøyten, og slipp musen. Påfør kosttilskudd gang daglig med sonde i løpet av kolitt forsøket.

3. Fastsettelse av Disease Activity Index

MERK: Sykdommen aktivitetsindeks er en kombinasjon av resultatet for vekttap, perianal blødning, og avføring konsistens, som er obholdes daglig 13.

  1. Mål kroppsvekt daglig, og tildele en score på 0-4 i henhold til vekttap prosentandel (0: 0%, 1: 1-5%, 2: 5 - 10%, 3: 10 - 20%, og 4:> 20 %).
    MERK: Kroppsvekt tap blir bestemt ved å beregne forskjellen i prosent mellom det basale vekt før induksjon av DSS-kolitt og den faktiske vekten.
  2. For å bestemme nivået av perianal blødning, samle en fersk avføringsprøve og bruke den medfølgende applikatorer å påføre et tynt smøre på et lysbilde fra en guaiacum fekal okkult blod test kit. Bruke et friskt applikator for hver prøve.
    1. Lukk dekselet på forsiden og åpne vinduet på baksiden av lysbildet. Anvende to dråper av fremkallerløsning til baksiden på prøven sted.
    2. Les resultatene etter 30 s. Noen spor av blå farge er positiv for okkult blod. Tildele en score fra 0 til 4 (0: ingen, 0,5 til 2,5: positiv guaiacum fekal okkult blod test (avhengig av signalstyrke), og 3-4: Gross blødning).
      MERK: Hvis blod i avføringen er synlig, ikke guaiac fekalt skjult blod ikke trenger å bli utført, og en score på 3, 3,5, eller 4 er tilordnet, avhengig av mengden av synlig blod.
  3. Bestem avføring konsistens ved å observere en fersk avføringsprøve. Tildele en score fra 0 til 4 (0: normal / solid, 0,5 til 2,5: deigaktig avføring, og 3-4: diaré).

4. Fastsettelse Intestinal Epitelial Permeabilitet in vivo ved Evans blå analyse

  1. Bedøve dyrene ved å injisere dem intraperitonealt med en blanding av ketamin (100 mg / kg kroppsvekt) og xylazin (13 mg / kg kroppsvekt) fortynnet i saltoppløsning (0,9% NaCl), og vurdere anestesidybden ved å overvåke klemme tilbaketrekking refleks.
  2. Plasser bedøves dyrene i liggende stilling og utføre en laparotomi å utsette tarmen.
  3. Lokal cecum og lage et lite innsnitt i den proksimale delen av tykktarmen enscendens (ideelt sett, i umiddelbar nærhet til cecum).
  4. Sett inn en fôring nål (G22) og fest den med en ligatur ved hjelp av en vanlig silketråd. Omhyggelig i flukt rikelig PBS gjennom røret for å skylle ut all avføring fra tykktarmen. Innpode Evans blått-oppløsning (1,5% vekt / volum i PBS) inn i tykktarmen før den når anus.
  5. Inkuber Evans blue i 15 min. Skyll fargestoff ved å spyle røret med rikelig PBS til perianal utvasking er klart.
  6. Avlive dyrene ved halshugging.
  7. Eksisere tykktarm og skyll det igjen med rikelig PBS. Skyll en gang med 1 ml av 6 mM N-acetylcysteine i PBS for å eliminere ethvert fargestoff fester seg til colonic slim.
  8. Skjær kolon på langs og skyll den gang med PBS og 1 ml 6 mM N-acetylcysteine.
  9. Registrere vekt og lengde. For å trekke ut Evans blått fargestoff, plasserer kolon i 2 ml N, N-dimetylformamid over natten ved romtemperatur med forsiktig Agitation. Mål fargestoff konsentrasjon spektrofotometrisk ved 610 nm.

5. Tissue Collection

  1. Bedøve dyrene ved å injisere dem intraperitonealt med en blanding av ketamin (100 mg / kg kroppsvekt) og xylazin (13 mg / kg kroppsvekt) fortynnet i saltoppløsning (0,9% NaCl), og vurdere anestesidybden ved å overvåke klemme tilbaketrekking refleks.
  2. Avlive dyrene ved halshugging.
  3. Plasser dyrene i liggende stilling og utføre en laparotomi å avsløre bukhulen.
  4. Ved hjelp av saks, dissekere hele tykktarmen og registrere sin lengde.
  5. Spyl tykktarmen forsiktig flere ganger med kald PBS for å fjerne avføring. Spill vevet vekt og forberede de følgende eksperimenter, som er beskrevet i trinn 5,6 - 5,8.
  6. For RNA isolering og Myeloperoxidase (MPO) analyser, avskåret en riktig størrelse vevsprøve (100 mg er vanligvis tilstrekkelig), plassere den i en tube, og snap-fryse det i flytende nitrogen. Oppbevar vev ved -80 ° C for fremtidig bruk.
  7. For immunfluorescens farging og oksidativt stress bestemmelse (se nedenfor), skjæres en liten tykktarmen prøve (0,5 til 1 cm) og dyppes den i små aluminiumkopper er fylt med optimal skjære temperatur (OCT) forbindelsen. Plasser koppene på tørris og la dem fryse langsomt, for å unngå bobledannelse. Frosne vevsprøver kan oppbevares ved -80 ° C for fremtidig bruk.
  8. For sveitsiske ruller 14, åpner kolon på langs og fjern forsiktig avføring ved hjelp av tang. Rull den opp, med slimhinnene vendt innover, ved hjelp av fine tippet tang eller en tynn, rund trepinne. Plasser forsiktig det inne en embedding kassett og fortsetter med trinn 6.1.
    MERK: DSS induserer skade i tykktarmen. Imidlertid varierer skade fordeling fra den nære til den distale colon, med mest skade vanligvis sett i den distale colon og rektum. Derfor anbefaler vi å analysere histologi enten i distal colpå eller i sveitsiske roller i hele tykktarmen.

6. Analyse av Colon Histologi av Hematoxylin-eosin Farging

  1. tissue Forberedelse
    1. For histologisk analyse, dukke enten de sveitsiske ruller eller små biter vev fra visse tykktarms regioner i kontroll og behandlede mus i 5 ml 10% formaldehyd i 48 timer ved romtemperatur (RT) for å oppnå riktig fiksering.
      NOTE: Alle ytterligere trinn i trinn 6 blir utført ved romtemperatur med mindre annet er angitt.
    2. Vask dem med vann fra springen i 18 timer.
    3. Dehydrere dem med 15 ml av 70% etanol i 1 time, 96% i 1 time, og absolutt etanol i 1 time. Gjenta hvert trinn med frisk alkohol før du går videre til neste konsentrasjon.
    4. Fortsett dehydratiseringen i en blanding av 7,5 ml absolutt etanol og 7,5 ml absolutt xylen i 1 time. Gjenta en gang før den passerer prøvene til 15 ml absolutt xylen i 1 time. Gjenta dette trinnet en gang med fersk xylen.
    5. Embedding Colon vevsprøver i Parafin
      1. Dyppe prøvene i 50 ml av flytende parafin i 17 timer. Gjenta dette trinnet en gang, men for bare 3 timer.
      2. Fordyp prøvene i terninger (plast, firkantet mold, størrelse: 22 x 22 x 22 mm) i 810 ml flytende parafin.
      3. Tillat den parafin med colon vevsprøver for å stivne i 24 timer ved RT.
    6. Cutting Tissue Tverrsnitt ved hjelp av en Mikrotom
      1. Skjær kolon prøver ved hjelp av en mikrotom, i henhold til produsentens instruksjoner, med en tykkelse på 5 um.
      2. Samle kutt i et vannbad (1 l) inneholdende 0,3% gelatin. Dette forhindrer folding av vev tverrsnitt. Gjenopprette vev seksjoner og montere dem på glassplater.
    7. Hematoxylin og eosin Farging av Tissue Tverrsnitt
      1. Deparaffinize prøvene i 18 timer ved 60 ° C i en inkubator. For dette formålet, kan du bruke et glass sLiDE stativ med et håndtak.
      2. Etter deparaffinization, fordype lysbildene i 70 ml absolutt xylen i 5 min. Gjenta dette trinnet en gang med fersk xylen.
      3. Overfør prøvene inn i 70 ml absolutt alkohol i 1 min. Gjenta dette trinnet en gang med frisk alkohol.
      4. Inkuber kolon vevsprøver i 70 ml etanol, 96% i 1 min. Gjenta dette trinnet en gang med frisk alkohol.
      5. Vask prøvene i springvannet to ganger for 2 s.
      6. Inkuber vev i Harris hematoxylin i 7 minutter.
      7. Vask prøvene i springvannet to ganger for 2 s.
      8. Inkuber prøvene i sure alkohol (70 mL etanol 70% og 700 ul av 1 M saltsyre) i 7 s.
      9. Vask prøvene i springvannet to ganger for 2 s.
      10. Inkuber vevsprøver i 70 ml litium-karbonat (1 g litium-karbonat i 100 ml destillert vann) i 7 s.
      11. Vask prøvene i springvannet to ganger for 2 s.
      12. Prøvene inkuberes i 70 ml etanol 80% For 1 min.
      13. Overfør prøvene inn i 70 ml Eosin Y i 15 sek.
      14. Inkubere dem i 70 ml av 96% etanol i 1 min. Gjenta dette trinnet en gang med frisk alkohol.
      15. Inkuber vevsprøver i 70 ml absolutt etanol (etylalkohol absolutt vannfri) i 1 min. Gjenta dette trinnet en gang med frisk alkohol.
      16. Prøvene inkuberes i 70 ml av en blanding av 35 ml absolutt alkohol og 35 ml absolutt xylen i 1 min.
      17. Overfør prøvene inn i 70 ml absolutt xylen i 1 min. Gjenta dette trinnet for 5 min i 70 ml av fersk absolutt xylen.
      18. Legg 80 mL av syntetisk harpiks til kolon vevsprøver, dekk dem med Dekk, og la dem tørke i 24 timer ved RT. Til slutt, analysere prøvene ved hjelp av lys-felt mikroskopi 8.

    7. Analysere Junction Sammensetning av immunfluorescens

    1. Klargjør vev som beskrevet i trinn 5,7 og kuttet 8 mikrometer tykke tverrsnittved hjelp av en cryostat.
    2. Fiks og permeabilize kolon tverrsnitt med 96% etanol ved -20 ° C i 20 min.
      MERK: Alle etterfølgende inkubasjoner bør utføres ved RT, med mindre annet er oppgitt, i en fuktig mørk boks for å hindre uttørking og fluorochrome falming.
    3. Luft tørre prøver, og skyll dem 3 ganger for 5 min hver med 1x PBS
    4. Inkuber prøvene med blokkeringsløsning (PBS inneholdende 0,01% Tween og 2% BSA) i 2 timer.
    5. Fjern blokkeringsløsningen og skylle den med PBS-0,01% Tween i 10 min.
    6. I løpet av denne tiden, fortynne de primære antistoffer mot de ønskede konsentrasjoner i PBS-0,01% Tween.
    7. Fjern vaskeløsningen, påføre antistoffoppløsningen fra det foregående trinn, og inkuber over natten ved 4 ° C i en fuktet boks.
    8. Fjern det antistoffløsning og vask 3 ganger med PBS-0,01% Tween i 5 minutter hver og én gang med avionisert vann i 10 minutter, med meget forsiktig omrøring.
    9. Mens vask, sentrifuger fluorochromeconjugated, artsspesifikke sekundære antistoffer ved 14 000 xg i 20 min ved 4 ° C.
    10. Fortynn de sekundære antistoffer uten utfellinger som angitt av leverandøren i PBS-0,01% Tween, anvende dem, og inkuberes i 1 time ved RT.
    11. Gjenta trinn 7.8 og fjerne vaskeløsningen så fullstendig som mulig.
    12. Pipetter 4 mL av anti-falming middel over hver prøve på lysbildet.
    13. Dekk prøvene med et dekkglass.
    14. Lufttørke i en time.
    15. Seal lysbilde med neglelakk. Presentasjoner kan oppbevares ved -20 ° C inntil videre analyse.
    16. Analyser på et konfokal laser mikroskop 8.

    8. Fastsettelse av oksidativt stress ved oksidasjon av Ethidium

    1. Etter 7 dagers DSS kolitt, forberede vev som beskrevet i trinn 5.7 og kuttet kolon seksjoner i en kryostat ved en tykkelse på 5 mikrometer. Mount tverrsnitt på glassplater behandlet med poly-L-lysin løsning og inkuber prøvene viddh 5 uM av dihydroethidium (DHE) i vann ved 37 ° C i 30 minutter i mørket.
    2. Vask prøvene med PBS (pH 7,6) tre ganger i 15 minutter hver med forsiktig omrøring ved romtemperatur. Air tørke prøvene og tilsett en dråpe monteringsmedium for å beskytte fluorescens. Observer fluorescens av oksidert ethidium på en laser-scanning confocal mikroskop (40X forstørrelse, 568 nm bølgelengde).

    9. Analyse av Leukocytt Rekruttering av MPO analyse

    1. Etter 7 dagers DSS kolitt, samle tykktarm vev og homogenisere prøver (200-400 mg) med 1 ml heksadecyltrimetydimonium (HTAB) buffer (0,5% HTAB i 50 mM fosfatbuffer, pH 6,0) ved bruk av en homogenisator på is.
    2. Skyll spissen av homogenisatoren to ganger med 1 ml HTAB-buffer for å inkludere alle vev i lysatet og sonikere det fem ganger ved 40% amplitude for 10 s hver. Fryse-tine i flytende nitrogen tre ganger.
    3. Sentrifuger ved 14000 xg i 15 min, og samle supernatanten.Fremstille 2,2'-azino-bis (3-etylbenzotiazolin-6-sulfonsyre) (ABTS) løsning ved å blande ABTS, 5 ml natriumcitrat (1 M i vann), 0,1 ml av hydrogenperoksyd, og 45 ml av bi -destillert vann.
    4. Blande 0,1 ml av hver supernatant med 0,1 ml ABTS-løsning i en 96-brønns flatbunnet plate. Etter 10 min måle absorbansen ved 460 nm ved hjelp av et spektrofotometer.

    10. Evaluering av Expression of proinflammatoriske cytokiner ved PCR

    1. tissue Homogenisering
      1. Homogenisere 50 til 100 mg kolon vevsprøver i 1 ml av en syre guanidiniumtiocyanat-fenol-kloroform blanding ved hjelp av en kraft homogenisator.
      2. Inkuber ved romtemperatur i 15 min.
    2. faseseparasjon
      1. Legg 0,2 ml kloroform og ristes kraftig i 30 sek.
      2. Inkuber ved 4 ° C i 30 minutter.
      3. Sentrifuger ved 12000 x g i 60 min ved 4 ° C.
      4. Overfør upper vannfase i et nytt rør (~ 500 ul).
    3. RNA Nedbør og Resuspensjon
      1. Tilsett 0,5 ml isopropylalkohol, og prøvene inkuberes ved 4 ° C i 60 min.
      2. Sentrifuger ved 12000 x g i 30 min ved 4 ° C.
      3. Fjern supernatanten helt.
      4. Tilsett 1 ml etanol 75% og virvle.
      5. Sentrifuger ved 12000 x g i 30 min ved 4 ° C.
      6. Fjern supernatanten.
      7. Tillate den gjenværende etanol for å lufttørke i 3-5 min.
        MERK: Det er viktig å ikke la RNA pellet tørke helt, da dette vil i stor grad redusere sin løselighet.
      8. Re-oppløse pelleten i 0,3 ml av dietylpyrokarbonat (DEPC) -behandlet vann. Umiddelbart transkribere RNA prøvene i cDNA (mer stabile, se trinn 10.5) eller oppbevar ved -80 ° C.
    4. RNA Kvantifisering
      1. Bland 1 mL av RNA med 99 mL av DEPC-behandlet vann.
      2. Les the OD ved 260 nm og 280 nm ved hjelp av et UV / VIS-spektrofotometer for å bestemme prøvekonsentrasjon og renhet.
    5. cDNA Synthesis
      1. Bland RNA prøver (1-5 ug) med 1 pl Oligo (dT) 12-18 (0,5 ug / ul) og DEPC-behandlet vann (totalt volum på 12 ul) i RNase-fri sterile rør.
      2. Inkuber ved 70 ° C i 10 min.
      3. Tilsett 2 mL av 10 x PCR-buffer, 1 pl 50 mM MgCl2, 1 pl 10 mM dNTP blanding, og 2 ul av 0,1 M ditiotreitol (DTT).
      4. Inkuber ved 4 ° C i 5 minutter.
      5. Tilsett 1 pl revers transkriptase og inkuber ved 42 ° C i 5 minutter.
      6. Inkuber ved 70 ° C i 15 min.
      7. Inkuber ved 4 ° C i 15 min. cDNA kan oppbevares ved -20 ° C inntil videre anvendelse.
    6. PCR
      1. Bland 2,5 ul 10 x PCR-buffer, 1,5 ul 25 mM MgCl2, 0,5 pl 10 mM dNTP blanding, 0,25 μL av Taq-DNA-polymerase, 0,25 ul av hver primer (10 uM) og cDNA (100 ng), og sterilt vann til et totalt volum på 25 ul.
      2. Kjør prøvene på en 96-brønns termosykler. For å hindre oppformering av genomisk DNA, forover og bakover primere bør plasseres i ulike eksoner: IL1β-FW: GCAACTGTTCCTGAACTCAACT og IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA og IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT og KC-RE: CCTGAGGGCAACACCTTCA; og Actin-FW: TATCCACCTTCCAGCAGATGT og Actin-RE: AGCTCAGTAACAGTCCGCCTA. Bruke følgende PCR-betingelser: 95 ° C i 5 minutter etterfulgt av 30 sykluser ved 95 ° C i 15 s, 58 ° C i 30 s, og 72 ° C i 30 s, i tillegg til en endelig forlengelse i 10 minutter ved 72 ° C .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Diet Supplements kan beskytte fra DSS kolitt

Anti-inflammatorisk og anti-oksidative kosttilskudd, slik som vitamin C, vitamin E, nitrogenoksid (NO) -source L-arginin og co 3-flerumettede fettsyrer (PUFA-ro3), er blitt anvendt med varierende suksess i dyr modeller for å lindre symptomer på inflammatoriske sykdommer 3,6,15. Underernæring, oksidativt stress, og produksjonen av proinflammatoriske cytokiner kan utløse både akutt og kronisk kolitt tre. I en tidligere studie, viste vi at en kombinasjon av mikronæringsstoffer viste beskyttende effekt mot DSS-indusert kolitt in vivo. Her gir vi detaljerte protokoller for hvordan disse effektene ble målt åtte. Først, analyserte vi effektene av kosttilskudd for sykdomsprogresjon ved å bestemme sykdomsaktivitetsindeks (DAI), som består av de tre parametere av vekttap,avføring konsistens, og perianal blødning. Representative resultater viste at DSS behandling førte til en stadig økende DAI, som forventet, og nådde et maksimum på 8,2 ± 0,46 på dag syv (figur 1A). Anti-inflammatorisk diett-tilskudd forsinket inntreden av kolitt, men ved senere tidspunkter, da kolitt var meget sterk, ble den beskyttende effekten marginal og ikke lenger er statistisk signifikant, noe som tyder på at kosttilskudd er bare effektive når det kolitt er ennå ikke er for sterk. Viktigere, kan kost inngrep hindre DSS-indusert økning i intestinal epithelial permeabilitet, noe som er et viktig trekk ved kolitt (figur 1B). DSS kolitt ført til reduserte kolon lengder, og denne forkorting ble også forbedres ved den anti-inflammatoriske og anti-oksidativ diett supplement (figur 1C). Således kan kliniske symptomer på kolitt faktisk lindres ved endringer i kostholdet sammensetning.

For å analysere hvorfor kolitt progresjon var mindre alvorlig i dyr som fikk en diett supplement, ble vev morfologi undersøkt etter hematoxylin / eosin (H / E) farging av parafin-embedded distal kolon vev. Kontrollprøver viste en normal morfologi (Figur 2A, øvre panel), mens dyr behandlet med 3,5% DSS viste typiske tegn på kolitt (dvs. leukocyttinfiltrasjon, ødemdannelse, krypten dysplasi, og sår, figur 2A, midt panel). Av notatet, parallell behandling med diett kosttilskudd klart lindres kolitt-indusert morfologiske endringer, med en samlet morfologi som var mer sammenlignbar med kontrollgruppen (figur 2A, nedre panel). Disse observasjonene var svært lik det som har værtrapportert for co-behandlinger med probiotiske bakterier 13 og tydelig viser at endringer i kostholdet kan motvirke utviklingen av kolitt.

Vi visste allerede at kolitt-indusert intestinal epithelial permeabilitet kan bli motvirket av diett kosttilskudd. Økt permeabilitet er et kjennetegn på IBD, og ​​det er i stor grad forårsaket av demontering av de stabiliserende adherens veikryss (AJ) og tett veikryss (TJ). Destabilisering av epiteliale celle kontakter etter internalisering av synaptiske proteiner som induseres av pro-inflammatoriske cytokiner, som er rikelig stilles under kolitt 16. Vi har funnet, ved immunfluorescens-fargingen av distal colon vev, at TJ molekylet zonula okkludens-1 (ZO-1) og AJ molekylet E-cadherin ble internalisert under DSS-indusert kolitt og at ko-lokalisering av disse proteiner ble delvis tapt på krypten epiteliale cellekontakter (figur 2B). Jegmportantly, internalisering av E-cadherin og ZO-1 ble redusert når DSS-behandlede mus ble ko-behandlet med et anti-inflammatorisk og anti-oksidativ diett supplement (figur 2B). Totalt sett, krypten og koblingskonstruksjoner var mer sammenlignbare med kontroller når dietten supplement ble brukt, noe som tyder på at den observerte beskyttende effekten var i hvert fall delvis på grunn av bevaring av vev arkitektur.

Dietary Intervention kan motvirke inflammatorisk nøytrofile Rekruttering, oksidativt stress, og produksjonen av proinflammatoriske cytokiner

Et annet kjennetegn på IBD er ukontrollert nøytrofile infiltrasjon. Rekruttert nøytrofile bidra til vevsskade ved å produsere og frigjøre reaktive oksygenforbindelser (ROS) og proteaser 17. Ved hjelp av en MPO aktivitetsanalyse, fant vi sterke nøytrofile rekruttering i tykktarmen som svar på DSS, som ble motvirketved hjelp av diett-tilskudd (figur 3A).

Oksidativt stress er en annen viktig funksjon av kolitt, forårsaket av utslipp av ROS fra rekruttert nøytrofile. Derfor analyserte vi produksjonen av ROS i tykktarm tverrsnitt. Figur 3B viser at DSS behandling sterkt økt oksidativt stress. Av notatet, endringer i kosthold helt forhindret DSS-indusert oksidativt stress (figur 3B), som er mest sannsynlig en konsekvens av redusert nøytrofile rekruttering (figur 3A).

Pro-inflammatoriske cytokiner og kjemokiner er sterkt produseres av forskjellige celletyper i løpet av 18 kolitt. Slike inflammatoriske mediatorer bidrar til nøytrofile rekrutterings- og krysset protein internalise-funksjoner som vi allerede visste kunne dempes ved endringer i kosthold. Analyse av mRNA ekspresjon ved RT-PCR avslørte at DSSøket ekspresjon av IL1β, IL-6, og keratinocytt-avledet kjemokin (KC), som forventet (fig 3C), og at anti-inflammatorisk diett-tilskudd redusert dette DSS-induserte økningen (figur 3C). Disse dataene antyder at kosttilskudd kan faktisk bidra til å motvirke kliniske tegn på IBD.

Figur 1
Figur 1. Nutritional Supplements kan lindre Disease Activity Index, Intestinal Epitelial permeabilitet, og Colon Avkortning. (A) Et sykdomsaktivitetsindeks (DAI, verdier fra 0 - 12) består av tre parametere av vekttap, avføring konsistens, og perianal blødning og ble registrert daglig i de eksperimentelle gruppene av kontroll (Ctrl), kolitt, og kolitt + kosttilskudd (kolitt + suppl.). Kontrollgruppen viste ingen tegn på kolitt, noe som resulterer i en DAI fra 0 throughout forsøksperioden. n = 5 per gruppe. (B) intestinal epithelial permeabiliteten ble målt ved Evans blå lekkasje i de ovennevnte forsøksgruppene og ble uttrykt som absorpsjonen ved 620 nm per gram vev. n = 8 per gruppe. Alle data er vist som gjennomsnitt ± standardavvik av gjennomsnittet (SDM). * P <0,05; ** P <0,01; *** P <0,001. Statistikk ble beregnet ved enveis ANOVA. (C) Representative bilder av hele kolon i de respektive forsøksgruppene etter 7 dagers behandling. Skalaen til venstre er i cm. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. Tissue morfologi og Junction Arkitektur er bedre bevart under kolitt når du søker Nærings Supplements. (A) 5-um paraffin tverrsnitt av vevsbiopsier fra den distale kolon i de respektive eksperimentelle grupper ble farget med hematoxylin / eosin og analysert for typiske tegn på kolitt, så som ødem-dannelse (piler), leukocytt-infiltrering (pilhoder), og sårdannelse (*). Samlet vev morfologi kolitt + suppl. gruppe mer ligner den i kontrollgruppen enn kolitt gruppen, noe som viser en generell beskyttende effekt mot DSS kolitt. Bildene er representativ for 3 uavhengige vevspreparater per gruppe. Bilder ble tatt med en 10X objektiv. Bar = 100 mikrometer. (B) 8 mikrometer kolon kryo-deler av de respektive gruppene ble farget med antistoffer mot ZO-1 (grønn) og E-cadherin (rød). Samlokalisering (gul i det fusjonerte bilder, piler) av E-cadherin og ZO-en på krypten epiteliale cellekontakter, som er tapt under kolitt, er stort sett bevart i kolitt + suppl. gruppe. Bildene er representative for treuavhengige vev preparater. Bar = 50 mikrometer. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. nøytrofile Rekruttering, oksidativt stress, og produksjonen av proinflammatoriske cytokiner kan reduseres med kosttilskudd. (A) Myeloperoxidase (MPO) aktivitet ble målt til å analysere mengden av leukocytter rekruttering til kolon vev i forsøksgrupper: kontroll (ctrl), kolitt og kolitt + kosttilskudd (kolitt + suppl.). n = 5 pr gruppe; * P <0,05. Data er vist som gjennomsnitt ± SDM. Statistikk ble beregnet ved enveis ANOVA. (B) Fluorescensen av oksidert etidium, avbildet i rødt som mål på oksidativt stress i 8-um kryo-deler av kolon vev, ble registrert av laser konfokalmikroskopi. Bildene er representativ for 3 uavhengige vev forberedelser. Bar = 100 mikrometer. (C) Fremstillingen av pro-inflammatoriske cytokiner IL1β og IL-6 og kjemokin KC ble bestemt ved semi-kvantitativ RT-PCR i en 1,5% agarosegel (svart og hvit ble tilbakestilt for klarhets skyld). β-actin fungert som husholdningsgenet. Representative bilder av tre uavhengige cDNA forberedelsene vises. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

For å bruke kosttilskudd i kliniske studier, må fordelene og sikkerheten av slike tilskudd vurderes nøye in vivo i dyrestudier. I tilfelle av kolitt, har flere egnede dyremodeller som ligner de kliniske symptomer på IBD er etablert, inkludert kjemiske modeller ved hjelp av DSS, TNBS, eller eddiksyre; knock-out (KO) modeller som IL10-KO; og immun-celle-mediert kolitt ved hjelp av adoptiv T-celle overføring 19-21. DSS modell av kolitt er en hurtig og pålitelig metode for å indusere kolitt som ligner på mange sykdomssymptomer av human IBD og har vært brukt i en mengde studier som undersøker de molekylære mekanismer på kolitt 22. Videre er DSS kolitt reversibel og således også gjør det mulig for studium av vev helbredelse etter at colitogenic stimulus er fjernet. Den oppgitte protokollen beskriver i detalj DSS kolitt modell som tidligere er blitt optimalisert i vårt laboratorium 8.

23. I tillegg DSS må være i et molekylvektområde på 40 - 50 kDa for å indusere kolitt. For den uerfarne forsker, vil det være viktig å utvikle et øye for en objektiv vurdering av DAI parametere av avføring konsistens og perianal blødning. Dersom vurderingen er utført av en uerfaren forsker, er det tilrådelig å ha en kollega bekrefte vurdering, helst i en blindet mote.

For å analysere intestinal epithelial permeabilitet for makromolekyler, har tre hovedmetoder vært brukt i hele den litteratur: det Evans blå fargestoff assay, som beskrevet her; instillering av 4-kDa FITC-dekstran i en tarmsløyfe; og foring av 4-kDa FITC-dekstran 13,24,25. I det sistnevnte analysen er FITC-dekstran matet ved tvangsforing, Og mengden av FITC-dekstran som krysset epitelet og lekket inn i blodstrømmen måles fluorometrisk fra serumprøver. I denne analysen blir permeabiliteten av hele mage-tarmkanalen måles, ettersom sporstoffet passerer hele veien fra spiserøret til rektum og mesteparten av sporstoffet vil passere før den når tykktarmen. I løkken modellen, blir permeabiliteten målt på et avgrenset område tarm anvendes for sløyfen (vanligvis tynntarmen) 25. I motsetning til dette, har den Evans blå-analysen den fordel at det bare epitelisk permeabiliteten i tykktarmen blir målt, ettersom sporstoffet er direkte dryppes i det hele tykktarmen. Således, ved bruk av denne analysen, kan vi konkludere med at kolonepitelet er beskyttet av diett supplement.

Det er alltid viktig å registrere kolon vekt og lengde etter ekstraksjon og før du bruker vev for andre analyser, fordi noen data (f.eks lekket Evans blå i permeabilitet assay) er uttrykt pr g vev. Videre er vekt-til-lengde-forholdet en uavhengig avlesing av vevsskade 26. Generelt er vevet morfologi analysert ved hjelp av parafininnstøpte vev farget med hematoksylin og eosin, som beskrevet her. Parafin forankring har den fordel at vevet morfologi er mye bedre bevart i forhold til andre integreringsmetoder. Dette gjør det mulig å entydig identifikasjon av forskjellige celletyper i slimhinnene (dvs. immune celler, epitel, slimceller, etc.) og analyse av vev-forandringer i løpet av kolitt, så som ødemdannelse, leukocytt infiltrering, og epiteliale apikale erosjoner. På den annen side, har parafin den ulempe at immunofluorescerende flekker kan bare utføres etter tidkrevende epitop utvinning. Derfor har vi alltid forberede ulike frosne vev biopsi innebygd i oktober sammensatte. Slike vevsprøver lett kan seksjoneres ved hjelp av en cryostat og viser lave nivåer av autofluorescence. Vi bruker etanol for fiksering av dehydrering fordi heller ikke det forstyrrer aktin filamenter (som metanol gjør), og heller ikke utløse autofluorescence (som PFA gjør). Ved hjelp av disse teknikkene, fant vi at en anti-inflammatorisk og anti-oksidativ diett supplement kan forbedre vev morfologi og krysset arkitektur under kolitt (sammenlign figur 2).

Overdreven neutrofil rekruttering er en kritisk hendelse i løpet av kolitt som er indusert ved fremstilling av kjemoattraktanter som respons på inflammasjon 17. Neutrofil rekruttering er et fysiologisk hendelse fordi nøytrofiler bidra til fjerning av den inflammatoriske kø og for påfølgende sårheling. Men hvis dette medfødte immunrespons ikke er ordentlig kontrollert og terminert, nøytrofiler i slimhinnen kan bidra til vevsskade ved å slippe proteaser og reaktive oksygenarter. Nøytrofile inneholde MPO, som lett kan måles og kvantifiseres ved hjelp av enkolorimetrisk assay, hvor mengden av MPO er direkte proporsjonal med antallet nøytrofiler. Figur 3A viser at nøytrofile rekrutterings øker under kolitt og som kosttilskudd intervensjon kan forhindre dette overdreven og ukontrollert immunrespons. I samsvar med rikelig nøytrofile tilstedeværelse i slimhinnene, øker oksidativt stress under kolitt (figur 3B).

Vår diett-tilskudd tydelig beskytter mucosa fra oksidativt stress, som er mest sannsynlig en konsekvens av redusert neutrofil rekruttering. Som nevnt, er neutrofiler tiltrukket av kjemokiner, og produksjonen av kjemokiner er indusert av pro-inflammatoriske cytokiner som utskilles av forskjellige celletyper i løpet av kolitt. Således antok vi at redusert neutrofil rekruttering er en konsekvens av redusert cytokin og kjemokin produksjon. Figur 3C viser at de pro-inflammatoriske cytokinene IL-1β og IL-6, så vel somchemokine KC, er oppregulert i løpet av DSS-indusert kolitt. Dietten supplement reverserte nivåer av IL-6 tilbake til kontrollnivåer og lindret økt produksjon av IL-1β og KC. Av notatet, er KC den viktigste kjemotiltrekkende for nøytrofile hos mus.

Det er således fristende å spekulere at den observerte bevaring av vev morfologi skyldes redusert nøytrofil infiltrasjon, som er i sin tur en konsekvens av redusert produksjon av KC. Å analysere RNA-produksjon i DSS-behandlede vev ved RT-PCR er problematisk når rest DSS er til stede i det isolerte RNA. Dette er fordi DSS hemmer både revers transskriptaser og Taq-polymerase. Hvis ingen amplifikasjon kan oppnås, vil det være nødvendig å ytterligere rense RNA prøver av LiCl-mediert utfelling, som beskrevet andre steder 27.

Oppsummert beskriver vi i detalj ulike metoder for analyse av vevsskade under DSS kolitt og hvordan dette dAmage kan bedres ved kosttilskudd. Kunnskap fra slike dyreforsøk kan rettferdiggjøre opprettelsen av pasient kohorter å undersøke den beskyttende effekten av de analyserte kosttilskudd i human IBD. Data fra kliniske studier kan åpne nye veier for å utvikle alternative behandlingsstrategier for forvaltning av IBD.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noe å avsløre.

Acknowledgments

Dette arbeidet ble støttet med tilskudd fra den meksikanske Council for Science and Technology (Conacyt, 207 268 og 233 395 til Michael Schnoor). KFCO er en mottaker av en Conacyt stipend (396260) for å få en MSc grad.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Analysere gunstige effektene av kosttilskudd på Intestinal Epitelial barrierefunksjoner Under Experimental kolitt
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter