Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Medicine

Deneysel Kolit sırasında Bağırsak epitel Bariyer Fonksiyonları Üzerine Ek Beslenme Faydalı Etkileri Analizi

doi: 10.3791/55095 Published: January 5, 2017

Summary

enflamatuvar bağırsak hastalığı (IBD) Mevcut tedaviler, hastalığın semptomlarını hafifletmek amaçlamaktadır, ancak ciddi yan etkilere neden olabilir. Böylece, alternatif stratejiler hayvan kolit modellerinde araştırılmaktadır. Burada, klinik IBD işaretleri diyet takviyeleri yararlı etkileri böyle bir kolit modelinde analiz edilmektedir açıklar.

Abstract

Crohn hastalığı ve ülseratif kolit de dahil olmak üzere inflamatuvar bağırsak hastalığı (İBH), bağırsak, kronik olarak tekrarlayan bozukluklarıdır. Onlar etkilenen bireylerde bu tür karın krampları, kanlı ishal ve kilo kaybı gibi ciddi sorunlara, neden olur. Ne yazık ki, hiçbir tedavi henüz yoktur ve tedaviler sadece semptomları hafifletmek için hedefliyoruz. Mevcut tedaviler, ciddi yan etkilere neden olabilir, anti-enflamatuar ve bağışıklık bastırıcı ilaçlardır. Bu yan etkilere neden yok böyle besin takviyeleri gibi alternatif tedavi seçenekleri, aramaya garanti eder. Klinik çalışmalarda da Kullanımdan önce, bu tip bileşikler titizlikle hayvan modellerinde etkinlik ve güvenlik açısından test edilmelidir. Güvenilir bir deneysel model insanlarda ülseratif kolit klinik belirtileri birçok üretir farelerde dekstran sülfat sodyum (DSS) kolit modelidir. Son zamanlarda ihtiva eden bir besin takviyesi yararlı etkilerini test etmek için, bu model tatbikC ve E vitaminleri, L-arginin ve ω3-çoklu doymamış yağ asitleri (PUFA). Biz çeşitli hastalık parametrelerini analiz ve bu ek hastalık aktivite indeksi genel bir iyileşme lider, ödem oluşumu, doku hasarı, lökosit infiltrasyonu, oksidatif stres ve pro-inflamatuar sitokinlerin üretimini iyileştirmek mümkün olduğunu gördük. Bu yazıda, detaylı, doğru C57BL / 6 farelerde DSS kolit modelini kullanarak besin takviyeleri uygulama, hem de nasıl gibi histoloji, oksidatif stres ve inflamasyon gibi hastalık parametreleri değerlendirilir açıklar. Farklı diyet takviyeleri yararlı etkileri analiz ardından sonunda İBH belirtileri hafifletmek ve / veya ciddi yan etkilere neden olmadan remisyon aşamalarını uzatmak alternatif tedavi stratejilerinin geliştirilmesi için yeni yollar açabilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kolit ishal ve karın ağrısına neden olabilir kolonun inflamatuar bir durumdur. Kolit enfeksiyon ya da strese yanıt olarak, akut olabilir, ya da enflamatuvar bağırsak hastalığı (IBD) grubuna ait ülseratif kolit (ÜK) 'deki gibi, kronik bir hastalık olarak ortaya çıkabilir. UC klinik bulguları iyi tanımlanmış olmasına karşın, patogenezi hala tam olarak 1 anlaşılmaktadır. UC önemli bir rol oynayan 2 genetik mutasyonlar ve anormal bağışıklık tepkilerinin ile, multifaktöriyel bir hastalık olduğunu uzmanlar arasında kabul edilmektedir. Ancak, bu tür yaşam ve beslenme tarzı gibi çevresel faktörler, aynı zamanda hastalık gelişimi ve ilerlemesi 3 katkıda bulunur.

Ne yazık ki, İBH tedavi edilebilir değildir, ancak klinik semptomları hafifletmek amacı birçok tedavi seçeneği vardır. Güncel tedaviler gibi sulfasalazin ve kortikosteroidler gibi anti-inflamatuar ilaçlar, arasında; Bu azathio gibi imünosupresanlar,Prine; İntegrinler gibi tümör nekroz faktörü-a (TNF-α) ya da blok adezyon molekülleri gibi yakalama pro-enflamatuar sitokinler, aşırı lökosit azaltmak için tek klonlu antikorları; ve Janus kinaz (JAK) 4 gibi pro-enflamatuar yolları, tetik kinazları hedef inhibitörleridir. Tüm hastalar tüm tedavilere yanıt, bu nedenle tedavi stratejileri 5 kişiye göre ayarlanmalıdır. Ayrıca, bu tedavi edici ilaçlar çoğu zaman ciddi yan etkilere yol, metabolizma ve bağışıklık tepkilerinin engeller. Bu nedenle, alternatif tedavi incelenmiştir.

Alternatif tedaviler probiyotikler ve başarı 6,7 çeşitli düzeylerde ile hayvan modellerinde ve klinik çalışmalarda uygulanmış olan besin takviyeleri içerir. Son zamanlarda bulunan bu tür anti-oksidatif vitamin ya da ω3-poli-doymamış yağ asitleri gibi farklı tek besin takviyeleri, uygulama (pUFAS), kolit ve kardiyovasküler hastalık semptomlarını 8,9 hafifletilmesi gibi ek bir kombinasyonunun uygulanması altındadır. Bu çalışmalar, farelerde gerçekleştirilmiştir, bu yüzden, klinik çalışmalar, bu bulgular, insanlar için geçerli olup olmadığını belirlemek için insanlarda gerçekleştirilmelidir. klinik çalışmalar başlatılmış önce, yeni tedavi etkinliği ve güvenliği hayvan modellerinde değerlendirilmelidir.

İBH için dekstran sülfat sodyum (DSS) modeli yaygın hastalık gelişimi mekanizmaları ve uyuşturucu ve besin takviyeleri 6,10 yararlı etkilerini incelemek için kullanılır olmuştur. Birçok çalışmada, indüklenen yedi günlük bir süre boyunca, sadece akut hastalığı; Bununla birlikte, bu hayvanlarda gözlenen klinik belirtiler yakın İBH hastalarda gözlenen benzeyen (örneğin, kanlı ishal, kilo kaybı, epitelyal disfonksiyon ve bağışık hücre içi filtratı) 10. DSS, mukozada erozyonlar neden olurbariyer disfonksiyonu ve artmış intestinal epitel geçirgenliği 11 ile sonuçlanır. tam mekanizması bilinmemektedir. Bununla birlikte, bir çalışma DSS epitelyal hücrelere girmek için ve enflamatuar sinyal 12 geçiş yolu uyarabildiği nano lipocomplexes oluşturmak üzere, orta zincir uzunluğunda yağ asitlerinin etkileşim göstermektedir. Bu yazıda kaynaklı ve her hayvanın bir sabit doz sağlamak için sonda ile nasıl uygulandığını besin takviyeleri farelerde, analiz edilir kolit nasıl ayrıntılı olarak tarif ve çeşitli kolit belirtileri üzerine bu tür takviyeleri etkileri nasıl incelenmiştir.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Tüm hayvan deneyleri Cinvestav Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından onaylanmıştır.

1. DSS İçme Suyu Hazırlanması ve Kolit indüksiyonu

  1. otoklavlanmış içme suyu içinde% 3.5 a / h dekstran sülfat sodyum (DSS) çözeltisi hazırlayın. DSS kolayca çözünür ve nihai çözelti filtre etmek için gerekli değildir.
    Not: DSS tedavisi 7 gün ciddi kolit oluştu. Hafif kolit uyarılması için, 3 - Tedavi 4 gün tavsiye edilir. Sürece DSS içme suyu berrak kalır gibi, suyu değiştirmek için gerekli değildir. o bulanık dönerse Ancak, değiştirilmesi gerekir.
  2. erkek farelerde bazal ağırlığı kaydedin. 12 hafta yaş ve 21 aralığında - - 25 gr vücut ağırlığı onlar 8 olduğundan emin olun.
    NOT: Uygun DSS konsantrasyonu her laboratuvarda optimize edilmelidir. Sonuçlar büyük ölçüde konut koşullarına bağlı olarak değişebilir. 2,5 ila Konsantrasyonları -% 5 genellikle güçlü c uyardığı bildirilmektedirC57BL / 6J WT farelerinde 10 olitis. sonuçları da DSS farklı kaynaklardan değişebilir gibi farklı şirketler ve farklı sürü DSS, test edilmelidir.
  3. Su ad libitum sağlamak ve gerekirse taze% 3.5 DSS su ile değiştirin.

Sonda ile beslenme takviyeleri 2. Uygulama

  1. uygun bir çözücü içinde, istenen besin takviyeleri bir "boşluğundan dışarı çekilebilir" çözelti hazırlayın. Bu çalışma için, 200 mg / kg L-arginin, 83 mg / kg vitamin C, 46 mg / kg E vitamini, 77 mg / kg, eikosapentaenoik asit (EPA), ve 115 mg / kg dokosaheksaenoik asit ihtiva eden bir karışım (DHA kullanılan a), 1: su ve aspur yağı 1 çözeltisi.
  2. Bir sonda iğnesine bağlanır 1 ml şırınga doldurun besin takviyesi karışımı ile (15 g 50 mm x). iğne dışında herhangi bir bileşiği kaldırmak için ve uygun doz uygulanmasını sağlamak için gavaj iğnesi dışında silin.
  3. kuyruk tabanı ile tutarak fare kısıtlamaktadırBir yandan diğer elinizle baş ve işaret parmağı ile boyun arkasındaki bir cilt kat kavrayarak. üçüncü parmak ve boyun tutan aynı elin başparmak tabanı arasındaki kuyruk yerleştirin.
  4. dik bir pozisyonda fare korurken, hayvanın ağzının sol tarafında içine iğne takın ve dikkatlice yemek borusu bulmak için ağız çatı izleyin. Hiçbir direnç ise, mide doğru iğne ilerlemek.
    NOT: Hayvan geçmeden önce düzgün nefes emin olun.
  5. Yavaş karışımı yönetmek yavaş yavaş şırınga çekerek tüp kaldırmak ve fareyi bırakın. kolit deney sırasında sonda ile günde bir kez beslenme takviyeleri uygulanır.

Hastalık Aktivite İndeksi 3. Belirlenmesi

NOT: hastalık aktivite indeksi ob olan kilo kaybı, perianal kanama ve dışkı kıvamı için puanları kombinasyonuGünlük 13 tained.

  1. günlük vücut ağırlığı ölçün ve kilo kaybı yüzdesine göre 0 ile 4 arasında bir puan atamak (0: 0%, 1: 1 -% 5, 2: 5 - 10%, 3: 10 -% 20, ve 4:> 20 %).
    Not: Vücut ağırlığı kaybı DSS-kolit ve gerçek ağırlık öncesi taban ağırlığı arasındaki yüzde farkı hesaplayarak belirlenir.
  2. Perianal kanama seviyesini belirlemek için, taze dışkı örneği toplamak ve bir guaiac dışkıda gizli kan testi kiti bir slayt üzerinde ince yayma uygulamak için sağlanan aplikatör kullanın. Her bir örnek için yeni bir uygulama aleti kullanmak.
    1. önündeki kapağını kapatın ve slayt arkasındaki penceresini açın. Örnek yerde arkasına geliştirici çözüm iki damla uygulayın.
    2. 30 saniye sonra sonuç okuyun. Mavi rengin herhangi iz gizli kan için olumludur. Pozitif guaiac dışkıda gizli kan testi (sinyal gücü bağlı olarak), ve 3 - 4: - 2.5 hiçbiri, 0.5: 0 ila 4 (0 puan atama gross kanama).
      NOT: Dışkıda kan görülüyorsa, guaiac dışkıda gizli kan testi yapılması gerekir, ve 3 bir puan, 3.5 veya 4 görünür kan miktarına bağlı olarak atanır değildir.
  3. taze dışkı örneği gözlemleyerek dışkı kıvamını belirleyin. (Ishal 0: Normal / katı, 0.5 -: - 2,5 4 hamurumsu dışkı, ve 3) 4 0 puan atayın.

Evans Blue Tahlili tarafından In Vivo Bağırsak epitel geçirgenliği Belirlenmesi 4.

  1. tuzlu su çözeltisi (% 0.9 NaCl) içinde seyreltilmiş bir ketamin karışımı (vücut ağırlığı 100 mg / kg) ve ksilazin (13 mg / kg vücut ağırlığı) ile karın içinden enjekte edilerek hayvanların anestezisi ve tutam izleyerek anestezi derinliğinin değerlendirmek geri çekilme refleksi.
  2. Bir yatar pozisyonda anestezi hayvanların koyun ve bağırsakları ortaya çıkarmak için bir laparotomi gerçekleştirin.
  3. Çekum bulun ve kolon a proksimal bölümünde küçük bir kesi yapmakscendens (çekum ideal olarak, hemen bitişik).
  4. Bir besleme iğne (G22) takın ve ortak bir ipek iplik kullanarak bir ligature ile sabitleyin. Dikkatle tüp aracılığıyla bol PBS gömme kolon tüm dışkı dışarı durulayın. o anüs ulaşana kadar kolon içine Evans mavisi çözeltisi (w% 1.5 / PBS v) aşılamak.
  5. 15 dakika boyunca, Evans mavisini inkübe edin. Perianal yıkama netleşene kadar bol PBS ile tüp temizlenerek boya yıkayın.
  6. servikal dislokasyon ile hayvan Euthanize.
  7. kolon tüketim ve bol PBS ile tekrar yıkayın. Kolon mukus yapışmasını bir boya ortadan kaldırmak için PBS içinde 6 mM N -acetylcysteine 1 mL bir kez yıkayın.
  8. Uzunlamasına kolon kesin ve PBS ve 6 mM N -acetylcysteine 1 mL kez daha durulayın.
  9. ağırlık ve uzunluk kaydedin. Yumuşak agitatio oda sıcaklığında gece boyunca, N, 2 mL N-dimetilformamid kolon yerleştirmek, Evans mavisi boya elde etmek içinn. 610 nm'de spektrofotometrik boya konsantrasyonu ölçün.

5. Doku Toplama

  1. tuzlu su çözeltisi (% 0.9 NaCl) içinde seyreltilmiş bir ketamin karışımı (vücut ağırlığı 100 mg / kg) ve ksilazin (13 mg / kg vücut ağırlığı) ile karın içinden enjekte edilerek hayvanların anestezisi ve tutam izleyerek anestezi derinliğinin değerlendirmek geri çekilme refleksi.
  2. servikal dislokasyon ile hayvan Euthanize.
  3. Bir yatar pozisyonda hayvanları yerleştirin ve karın boşluğuna maruz laparotomi gerçekleştirin.
  4. makas kullanarak, tüm kolon incelemek ve uzunluğunu kaydedin.
  5. dışkı çıkarmak için soğutulmuş PBS Colon dikkatle birkaç kez yıkayın. Doku ağırlığı kaydedin ve adımları 5.6 de tarif edildiği gibi, aşağıdaki deneyler için hazırlamak - 5.8.
  6. RNA izolasyonu ve miyeloperoksidaz (MPO) deneyleri için (100 mg, genellikle yeterlidir), bir tüp içine yerleştirin ve SNA bir uygun boyutlu bir doku örneği kesilmişsıvı azot içinde p-dondurmak. ileride kullanmak için -80 ° C 'de dokuları saklayın.
  7. immünofloresan boyama ve oksidatif stres belirlenmesi (aşağıya bakınız), bir küçük kolon örneği kesmek (0,5-1 cm) ve optimal kesme ısısı (OCT) bileşiği ile dolu küçük alüminyum kaplar içinde daldırılması. kuru buz üzerinde bardak yerleştirin ve onları kabarcık oluşumunu önlemek için, yavaş yavaş donmasına izin. Dondurulmuş doku örnekleri ileride kullanılmak üzere -80 ° C'de muhafaza edilebilir.
  8. İsviçre 14 rulo için uzunlamasına kolon açın ve dikkatlice forseps kullanarak dışkı çıkarmak. mukoza ince uçlu forseps veya ince, yuvarlak tahta sopa kullanarak, içe dönük ile, o kadar yuvarlayın. Dikkatle gömme kaset içine yerleştirin ve adım 6.1 ile devam edin.
    NOT: DSS kolonda hasar neden olur. Ancak, hasar dağılımı genellikle distal kolon ve rektumda görülen en zararla, distal kolon proksimal değişir. Böylece, uzak col ya histoloji analiz tavsiyeya da bütün kalın bağırsağın İsviçre rolleri.

Hematoksilen-eozin boyanması ile Colon Histoloji 6. Analizi

  1. Doku hazırlanması
    1. histolojik analiz için, uygun bir sabitleme elde etmek için, oda sıcaklığında (RT) 48 saat boyunca% 10 formaldehid 5 mL İsviçre rulo ya da kontrol belirli kolon bölgeleri küçük doku parçaları ve tedavi edilen fareler, ya daldırın.
      NOT: Aksi belirtilmedikçe aşama 6'da ilave bütün adımları, oda sıcaklığında gerçekleştirilmektedir.
    2. 18 saat musluk suyu ile yıkayın.
    3. 1 saat boyunca 1 saat, 1 saat için% 96 ve mutlak etanol,% 70 etanol, 15 mL ile kurutmak. Bir sonraki konsantrasyona geçmeden önce taze alkol ile her adımı yineleyin.
    4. mutlak etanol, 7.5 mL ve 1 saat boyunca mutlak ksilen 7.5 mL karışımında dehidratasyon devam edin. 1 saat boyunca saf ksilen 15 mL numune geçirmeden önce bir kez tekrarlayın. Taze ksilen kez bu adımı yineleyin.
    5. Parafin Colon Doku Örnekleri gömülmesi
      1. 17 saat sıvı parafin, 50 mL numune bırakın. ama bir kez sadece 3 saat için bu adımı yineleyin.
      2. sıvı parafin 810 ml: küp numuneleri (22 x 22 x 22 mm plastik, kare kalıp, boyut) daldırın.
      3. Kolon doku örnekleri parafin oda sıcaklığında 24 saat boyunca katılaşmaya izin verin.
    6. Bir Mikrotom kullanarak Doku Çapraz bölümleri kesme
      1. 5 um'lik bir kalınlıkta, üreticinin talimatlarına uygun olarak, bir mikrotom kullanılarak kolon örnekleri kesin.
      2. % 0.3 jelatin içeren bir su banyosu (1 L) 'de kesik toplayın. Bu doku kesitlerinin katlanmasını önler. Doku bölümleri kurtarmak ve cam slaytlar takar.
    7. Doku Çapraz bölümlerin Hematoksilen ve Eosin Boyama
      1. Bir inkübatör içerisinde 60 ° C'de 18 saat boyunca örnekleri Deparaffinize. Bu amaç için, cam s kullanımılide kulplu raf.
      2. Parafinden arındırmadan sonra, 5 dakika süre ile çok saf ksilen 70 mL slaytlar bırakın. Taze ksilen kez bu adımı yineleyin.
      3. 1 dakika boyunca mutlak alkol 70 ml örnekleri aktarın. Taze alkol ile bir kez bu adımı yineleyin.
      4. 1 dakika için etanol,% 96 70 mL kolon doku numuneleri inkübe edin. Taze alkol ile bir kez bu adımı yineleyin.
      5. 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın.
      6. 7 dakika Harris hematoksilen dokuları kuluçkaya yatmaktadır.
      7. 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın.
      8. Asidik alkol örnekleri (etanol% 70, 70 mL, 1 M hidroklorik asit, 700 uL) 7 saniye boyunca inkübe edin.
      9. 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın.
      10. lityum karbonat 7 sn için (distile su ve 100 mL lityum karbonat 1 g) 70 mL doku örnekleri inkübe edin.
      11. 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın.
      12. etanol 80 70 mL örnekleri inkübe1 dakika için%.
      13. 15 saniye için 70 mL Eozin-Y içine örnekleri aktarın.
      14. 1 dakika boyunca% 96 etanol içinde 70 mL inkübe. Taze alkol ile bir kez bu adımı yineleyin.
      15. 1 dakika boyunca mutlak etanol (etil alkol, mutlak susuz) 70 mL doku örnekleri inkübe edin. Taze alkol ile bir kez bu adımı yineleyin.
      16. Bir mutlak alkol, 35 ml karışımı ve 1 dakika boyunca mutlak ksilen 35 mL 70 mL numune inkübe edin.
      17. 1 dakika boyunca mutlak ksilen 70 mL numuneleri aktarın. Taze çok saf ksilen 70 mL, 5 dakika için bu adımı tekrarlanır.
      18. , Kolon doku örnekleri sentetik reçine 80 uL ekleyin lamelleri ile onları karşılamak ve oda sıcaklığında 24 saat süreyle kurumaya bırakın. Son olarak, parlak alan mikroskobu 8 kullanarak örnekleri analiz.

    İmmünofloresan tarafından 7. incelendiğinde Kavşağı Kompozisyon

    1. Adım 5.7 açıklandığı gibi doku hazırlayın ve 8 mikron kalınlığında kesitler kesmekBir kriyostat kullanarak.
    2. Saptamak ve 20 dakika boyunca -20 ° C'de% 96 etanol ile kolon kesitler geçirgenliği.
      NOT: Aksi belirtilmedikçe Bundan sonraki bütün inkübasyonlar kurutma ve florokrom solmasının engellenmesi için nemli bir karanlık kutu içinde, oda sıcaklığında gerçekleştirilmelidir.
    3. Hava kuru numuneler ve sonra 1x PBS ile onlara 5 dakika boyunca 3 kez her durulama
    4. 2 saat boyunca (PBS,% 0.01 Tween ile yıkandı ve% 2 BSA içeren) bloke etme çözeltisi ile inkübe edin.
    5. engelleme çözeltisi çıkarın ve 10 dakika süre ile PBS,% 0.01 Tween ile durulayın.
    6. Bu süre boyunca, PBS-% 0.01 Tween içerisinde arzu edilen konsantrasyonlarda birincil antikor seyreltin.
    7. Yıkama suyu çıkarmak önceki adımda elde edilen antikor solüsyonu uygulanır ve nemlendirilmiş kutu içinde, 4 ° C'de bir gece boyunca inkübe edilir.
    8. Antikor çözeltisi çıkarın ve çok yumuşak çalkalama ile 10 dakika boyunca iyonu giderilmiş su ile bir kez her biri 5 dakika için PBS-% 0.01 Tween ile 3 kez yıkayın.
    9. yıkama, santrifüj flor ikenochromeconjugated, türe özel, 4 ° C'de 20 dakika 14,000 xg'de ikincil antikorlar.
    10. PBS-% 0.01 Tween sağlayıcı tarafından gösterildiği gibi, çökeltiler olmayan ikincil antikorlar seyreltilir uygulamak ve oda sıcaklığında 1 saat inkübe edilir.
    11. Adımı yineleyin 7.8 ve mümkün olduğunca tamamen yıkama çözüm kaldırmak.
    12. Pipet 4 mcL slayt her numune üzerinde ajan, anti-solma.
    13. bir lamel ile örnekleri örtün.
    14. 1 saat boyunca hava kuru.
    15. oje ile mühür slayt. Slaytlar, ileride analize kadar -20 ° C'de muhafaza edilebilir.
    16. Bir konfokal lazer mikroskobu 8 analiz edin.

    Etidiyum oksidasyonu ile Oksidatif Stresin 8. Belirlenmesi

    1. 5 um kalınlığında bir kriyostat kolon bölümleri aşama 5.7'de tarif edilen ve kesme şekilde DSS kolit 7 gün sonra, doku hazırlanması. Cam slaytlar üzerine monte kesitleri poli-L-lizin çözeltisi ile muamele edilmiş ve numuneler wit inkübeH 5 karanlıkta 30 dakika için 37 ° C sıcaklıkta su içinde dihydroethidium (DHE) uM.
    2. PBS (pH 7.6), oda sıcaklığında yumuşak çalkalama ile 15 dakika her biri için üç kez numune yıkanır. Hava örnekleri, kuru ve floresan korumak için montaj orta bir damla ekleyin. okside bir lazer tarama konfokal mikroskop etidyum (40X büyütme, 568 nm dalga boyu) floresan gözlemleyin.

    MPO Testi ile Lökosit istihdamı 9. Analizi

    1. DSS kolit 7 gün sonra, kolon dokusu toplamak ve örnekleri homojenize - buz üzerinde bir homojenleştirici kullanılarak heksadesiltrimetilamonyum 1 mL (YSEK) tampon (50 mM% 0.5 YSEK fosfat tamponu, pH 6.0) ile (200, 400 mg) eklenmiştir.
    2. 10 sn her% 40 genlik beş kez lizat tüm doku dahil ve ses dalgalarına maruz için 1 ml YSEK tampon ile iki kez homojenleştirici ucu durulayın. sıvı azot üç kez donma-çözülme.
    3. 15 dakika için 14,000 x g'de santrifüjleyin ve supernatant toplanır.sodyum sitrat (su içinde 1 M), hidrojen peroksit 0.1 mL ABTS, 5 mL karıştırılarak 2,2'-azino-bis (3-etilbenzotiazolin-6-sülfonik asit) (ABTS) çözeltisi hazırlayın ve bi 45 mi -arıtılmış su.
    4. 96-gözlü düz dipli levhanın içinde 0.1 ml ABTS çözeltisi ile her bir süpernatanın 0.1 mL karıştırın. 10 dakika sonra, bir spektrofotometre kullanılarak 460 nm'de absorbans ölçümü.

    10. PCR ile Pro-inflamatuar Sitokinlerin Anlatım değerlendirilmesi

    1. doku Homojenizasyon
      1. Bir güç homojenleştirici kullanılarak bir asit guanidinyum tiyosiyanat-fenol-kloroform karışımı 1 mL kolon doku örnekleri 50 ila 100 mg homojenize edilir.
      2. 15 dakika oda sıcaklığında inkübe edin.
    2. Faz Ayırma
      1. kloroform 0.2 ml ekleyin ve 30 saniye kuvvetlice çalkalanır.
      2. 30 dakika boyunca 4 ° C'de inkübe edin.
      3. 4 ° C'de 60 dakika boyunca 12,000 x g'de santrifüjleyin.
      4. u aktaryeni bir tüpe (~ 500 uL) içinde pper sulu faz.
    3. RNA Yağış ve Tekrar Süspansiyonu
      1. izopropil alkol, 0.5 ml ilave edilir ve 60 dakika boyunca 4 ° C'de inkübe örnekleri.
      2. 4 ° C'de 30 dakika için 12,000 x g'de santrifüjleyin.
      3. tamamen süpernatantı.
      4. Etanol% 75 ve vorteks 1 ml ekleyin.
      5. 4 ° C'de 30 dakika için 12,000 x g'de santrifüjleyin.
      6. süpernatantı.
      7. 3-5 dakika süreyle kurumaya kalan etanol izin verin.
        NOT: büyük ölçüde çözünürlüğünü azalacak gibi RNA pelet tamamen kurumasına izin vermeyin önemlidir.
      8. dietilpirokarbonat 0.3 mL (DEPC) ile tedavi edilen suyun pelet yeniden çözülür. Hemen -80 ° C'de veya mağaza (adım 10.5 Daha fazla kararlı) cDNA içine RNA örnekleri yazıya.
    4. RNA ölçümü
      1. DEPC arıtılmış su 99 ul RNA 1 mcL seyreltin.
      2. inci oku260 nm ve örnek konsantrasyonu ve saflığı belirlemek için, bir UV / VIS spektrofotometre kullanılarak 280 nm'de e OD.
    5. cDNA sentezi
      1. RNaz içermeyen steril tüplerde 1 Oligo uL (dT) 12-18 (0.5 mg / ml) ve DEPC ile muamele edilmiş su (12 uL toplam hacim) RNA numuneleri (1-5 ug) karıştırın.
      2. 10 dakika boyunca 70 ° C'de inkübe edin.
      3. 10X PCR tampon maddesinin 2 uL, MgCI2, 50 mM 1 uL, 10 mM dNTP karışımı 1 ul ve 0.1 M ditiyotreitol ve 2 ul (DTT) ekleyin.
      4. 5 dakika boyunca 4 ° C'de inkübe edin.
      5. ters transkriptazın 1 uL ilave edilir ve 5 dakika boyunca 42 ° C'de inkübe edin.
      6. 15 dakika boyunca 70 ° C'de inkübe edin.
      7. 15 dakika boyunca 4 ° C'de inkübe edin. cDNA, bir sonraki kullanıma kadar -20 ° C'de muhafaza edilebilir.
    6. PCR
      1. 10x PCR Tamponu 2.5 uL, 25 mM, 1.5 uL MgCl2 karıştırın, 10 mM dNTP 0.5 ul, mix 0.25 μ25 uL'lik bir toplam hacme Taq DNA polimeraz, 0.25 her bir primer uL (10 uM) ve cDNA (100 ng) ve steril su L.
      2. 96 oyuklu bir termal döngü örnekleri çalıştırın. ileri, genomik DNA amplifikasyon önlemek ve primerler farklı ekzon bulunmalıdır ters çevirmek için: IL1β-FW: GCAACTGTTCCTGAACTCAACT ve IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL-6-FW: CCTTCCTACCCCAATTTCCAA ve IL 6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT ve KC-RE: CCTGAGGGCAACACCTTCA; ve Aktin-FW: TATCCACCTTCCAGCAGATGT ve Aktin-RE: AGCTCAGTAACAGTCCGCCTA. 15 s, 30 s için 58 ° C ve 30 sn için 72 ° C, artı 72 ° C'de 10 dakika boyunca son bir uzatma, 95 ° C 'de 95 ° C, 5 dakika için 30 döngü izledi: Aşağıdaki PCR koşulları kullanarak .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Diyet Takviyeler DSS Kolit koruyunuz Can

vitamin C, vitamin E, nitrik oksit (NO) -Source L-arginin ve ω3-doymamış yağ asitleri (ω3-PUFA'lar) gibi anti-enflamatuar ve anti-oksidatif beslenme takviyeleri, hayvanda değişen başarı ile kullanılmıştır modeller enflamatuar hastalıklar 3,6,15 belirtileri hafifletmek için. Yetersiz beslenme, oksidatif stres ve pro-inflamatuar sitokinlerin üretimi hem akut hem de kronik kolit 3 tetikleyebilir. Önceki bir çalışmada, mikro bir kombinasyonu in vivo DDS ile indüklenen kolit karşı koruyucu etkiler gösterdiğini kanıtladı. Burada, bu etkilerin 8 ölçüldü konusunda ayrıntılı protokolleri sağlar. İlk olarak, kilo kaybı üç parametre oluşan hastalık aktivite indeksi (DAI) belirleyerek hastalığın ilerlemesi üzerinde beslenme takviyeleri etkilerini analizdışkı kıvamı ve perianal kanama. Temsilcisi sonuçları DSS tedavi gün yedi (Şekil 1A) 8,2 ± 0.46 maksimum ulaşan, beklendiği gibi, sürekli artan DAI yol açtığını gösterdi. Anti-inflamatuar diyet takviyesi kolit başlangıcı gecikmiş, ancak kolit çok güçlü iken, daha sonra zaman noktalarında, koruyucu etkisi kolit henüz çok güçlü olmadığı zaman diyet takviyeleri tek etkili olan düşündüren, marjinal ve artık istatistiksel olarak anlamlı idi. Önemli olarak, diyet müdahalesi kolit önemli bir özellik (Şekil 1B) olan intestinal epitel geçirgenliğinde DDS ile indüklenen artışı önleyebilir. DSS kolit, indirgenmiş kolon uzunlukları yol açmış ve bu katı yağ, aynı zamanda anti-enflamatuar ve anti-oksidatif diyet takviye (Şekil 1C) ile zayıflatıldığı edildi. Bu nedenle, kolitin klinik semptomlar gerçekten de beslenme bileşimi değişiklikleri ile kontrol altına alınabilir.

ilerleme bir diyet takviyesi alan hayvanlarda daha az şiddetli olduğu kolit neden analiz etmek, doku morfolojisi hematoksilin / eozin (H / S) parafine gömülmüş uzak kolon dokularının boyandıktan sonra araştırılmıştır. (Şekil 2A, orta panel, yani lökosit infiltrasyonunun, ödem oluşumu, kript displazi ve ülserler)% 3.5 DSS ile tedavi edilen hayvanlar kolit tipik belirtileri gösterdi, oysa kontrol örnekleri, normal morfoloji (Şekil 2A, üst panel) göstermiştir. Not, kontrol grubuna (Şekil 2A, alt panel) daha karşılaştırılabilir bir genel morfolojisi ile diyet takviyesi açıkça hafifletmiş kolit kaynaklı morfolojik değişiklikler ile paralel tedavinin. Bu gözlemler olmuştur ne çok benzerProbiyotik bakteriler 13 ve açıkça ile birlikte tedavi için rapor diyet değişiklikleri kolit gelişimini karşı olduğunu göstermektedir.

O kolit kaynaklı bağırsak epitel geçirgenlik diyet takviyesi ile etkisiz olabilir zaten biliyordum. Artan geçirgenlik İBH bir özelliğidir ve stabilize adherens kavşaklar (AJ) ve sıkı kavşaklar (TJ) sökme kaynaklanan büyük bir kısmı yer almaktadır. Birleşim proteinlerin içselleştirme epitel hücre kontaktların destabilizasyonu bol kolit 16 içinde üretilen ön-iltihabik sitokinler tarafından uyarılır. Bu TJ molekülü zonula occludens-1 (ZO-1) ve AJ molekülü E-kadherin DDS ile indüklenen kolit esnasında içsel ve bu proteinlerin co-lokalizasyon, kısmen kayıp olduğunu distal kolon dokusunun immünofloresan boyama ile bulunduğu crypt epitel hücre kişileri de (Şekil 2B). benmportantly, E-kadherin ve DSS ile tedavi edilen fareler, ko-muamele edilmiş bir anti-enflamatuar ve anti-oksidatif diyet takviye (Şekil 2B) sahip iken ZO-1 indirgenerek içselleştirilmesi. Genel olarak, kript ve bağlantı yapısı gözlenen koruyucu etki, en azından kısmen bağlı doku mimarisinin korunması olduğunu düşündüren, diyet takviyesi uygulanmıştır kontrol karşılaştırılabilir olmuştur.

İltihaplı Nötrofil İşe, Oksidatif Stres ve Pro-inflamatuar sitokinlerin üretimini mücadele ederken Can Diyet Müdahale

IBD başka damgasını kontrolsüz nötrofil infiltrasyonu olduğunu. Araştırmada, nötrofiller, üretim ve reaktif oksijen türleri (ROS) ve proteazları 17 serbest doku hasarına katkıda bulunur. Bir MPO aktivitesi deneyi kullanılarak, biz counteracted edildi DSS, cevaben kolonda güçlü nötrofil işe bulundudiyet takviyesi ile (Şekil 3A).

Oksidatif stres işe nötrofillerden ROS salgılanmasıyla kaynaklanan kolit diğer bir önemli özelliğidir. Böylece, kolon kesitlerde ROS üretimini analiz edilmiştir. Şekil 3B DSS tedavi kuvvetle oksidatif stresi artırdığını göstermektedir. Not, diyet değişiklikleri tamamen büyük olasılıkla nötrofil işe (Şekil 3A) bir sonucudur DSS-kaynaklı oksidatif stresi (Şekil 3B), engelledi.

Pro-inflamatuar sitokinler ve kemokinler güçlü kolit 18 içinde çeşitli hücre tipleri tarafından üretilir. Böyle inflamatuvar mediatörler zaten diyet değişiklikleri ile zayıflatılmış olabilir biliyordu nötrofil göçünü ve kavşak protein içselleştirilmesi-özellikleri katkıda bulunur. RT-PCR ile mRNA ekspresyonunun analizi DSS ortayaIL1β ekspresyonunu, IL-6, artan ve keratinosit türetilmiş kemokin (KC) (Şekil 3C), beklendiği gibi, ve anti-inflamatuar bir diyet takviyesi DSS bağlı artışı (Şekil 3C) azaldı. Bu veriler diyet takviyeleri gerçekten IBD klinik belirtilerini ortadan kaldırmak için hizmet edebilir ima etmektedir.

Şekil 1
Şekil 1. Beslenme takviyeleri Hastalık Aktivite İndeksi, Bağırsak epitel geçirgenliği ve Kolon kısaltılması hafifletmek Can. (A) hastalık aktivite indeksi (DAI, 0 değerleri - 12) + kilo kaybı, dışkı kıvamı ve perianal kanama üç parametreden oluşan ve kontrol (ctrl), kolit ve kolit deney gruplarında günlük olarak kaydedildi besin takviyesi (kolit + ek.). Kontrol grubu, 0 throughou bir DAI sonuçlanan kolit herhangi bir belirti göstermemiştirDeneysel dönemi t. Grup başına n = 5. (B) intestinal epitel geçirgenliği yukarıda belirtilen deney gruplarındaki Evans mavisi sızıntı ile ölçüldü ve doku gramı başına 620 nm'de absorpsiyon olarak ifade edilmiştir. Grup başına n = 8. Tüm veriler ortalama (SDM) ve ortalama ± standart sapma olarak gösterilmiştir. * P <0.05; ** P <0.01; *** P <0.001. İstatistikler tek yönlü ANOVA ile hesaplanmıştır. (C) 7 günlük bir tedaviden sonra ilgili deney grubu bütün kolonların Örnek ve görüntüler. Soldaki ölçek cm olduğunu. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

şekil 2
Şekil 2. Doku Morfoloji ve Kavşak Mimarlık iyi Beslenme Su'yu uygulanması sırasında Kolit sırasında korunurpplements. (A), söz konusu deney grubu distal kolon doku biyopsisi, 5-um parafine kesiti, hematoksilin / eozin ile boyandı ve ödem oluşumu (oklar), lökosit infiltrasyonunun (ok başları) ve kolit tipik belirtileri için incelendi ve ülserasyon (*). kolit + Özel Sayı genel doku morfolojisi. Daha fazla grup DSS kolit karşı genel bir koruyucu etkisinin kanıtlayan, o kolit grubuna göre kontrol benzemektedir. Çıkan grup başına 3 bağımsız doku preparatları temsil etmektedir. Görüntüler 10X objektif kullanılarak alındı. Çubuk = 100 um. (B) ilgili grup 8 um kolon kriyo-bölümleri ZO-1'e karşı antikorlar (yeşil) ve E-kadherin (kırmızı) ile boyanmıştır. (Birleştirilmiş görüntülerde sarı, oklar) co-lokalizasyon kolit sırasında kaybolur kript epitel hücre kişileri de E-kaderin ve ZO-1, ve, çoğunlukla kolit + suppl korunur. grubudur. Çıkan 3 temsilcisibağımsız doku preparatları. Çubuk = 50 um. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3. Nötrofil İşe Alım, Oksidatif Stres ve Pro-inflamatuar Sitokinler üretimi Beslenme Takviyeler tarafından İndirimli edilebilir. (A) Myeloperoksidaz (MPO) aktivitesi deney gruplarında kolon dokulara lökosit işe miktarını analiz etmek ölçüldü: Kontrol (ctrl), kolit ve kolit + besin takviyesi (kolit + suppl.). Grup başına n = 5'tir; * P <0.05. Veri SDM ortalama ± olarak gösterilmiştir. İstatistikler tek yönlü ANOVA ile hesaplanmıştır. CO 8 mikron cryo-bölümler oksidatif stresin ölçüsü olarak kırmızı edilen (B), oksitlenmiş etidyum floresan,lon dokular, lazer konfokal mikroskobu ile kaydedildi. Fotoğraflar, 3 bağımsız doku preparatları temsil etmektedir. Çubuk = 100 um. (C), pro-enflamatuar sitokinlerin IL1β ve IL-6, KC, bir% 1.5 agaroz jeli içinde, yarı nicel RT-PCR ile tespit edilmiştir kemokin üretimi (siyah ve beyaz açıklık gayesi ile döndürülür edilmiştir). β-aktin temizlik geni olarak görev yaptı. Üç bağımsız cDNA preparatlarının Örnek görüntüler gösterilir. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Klinik çalışmalarda besin takviyeleri kullanmak için, yararları ve bu tür ek güvenlik dikkatle hayvan çalışmalarında, in vivo olarak değerlendirilmelidir. kolit durumunda, IBD klinik belirtilerini benzeyen bazı uygun hayvan modelleri DSS, TNBS ya da asetik asit kullanılarak kimyasal modelleri dahil olmak üzere, oluşturulmuştur; knock-out gibi IL10-KO olarak (KO) modelleri; ve evlat edinen T hücre transferi 19-21 kullanılarak kolit immün hücre aracılı. Kolit DSS modeli, insan IBD birçok hastalık semptomlarını andıran ve kolit 22 moleküler mekanizmaları araştıran çalışmaların bir bolluk kullanılmaktadır Kolit oluşturulmadan bir hızlı ve güvenilir bir yöntemdir. Ayrıca, DSS kolit tersine çevrilebilir ve colitogenic uyaran çıkarıldıktan sonra bu nedenle de doku iyileşmesinin çalışma sağlar. Sağlanan protokol ayrıntılı olarak önceden laboratuarımızda 8 optimize edilmiştir DSS kolit model tanımlamaktadır.

23 etkiler beri DSS konsantrasyonunun optimizasyonu, her laboratuarda yapılmalıdır olmasıdır. kolit başlatmak için 50 kDa - Buna ek olarak, DSS 40 bir molekül ağırlığı aralığı içinde olması gerekmektedir. tecrübesiz araştırmacı için, dışkı kıvamı ve perianal kanama DAI parametrelerinin tarafsız bir değerlendirme bir göz geliştirmek için önemli olacaktır. Değerlendirme bir tecrübesiz araştırmacı tarafından yapılırsa, bir meslektaşım ideal bir kör moda, değerlendirme onaylamak için tavsiye edilir.

Burada açıklandığı gibi, Evans mavisi deneyi;: makromoleküllerin için bağırsak epitel geçirgenliğini analiz etmek, üç büyük yöntemler literatürde kullanılmış bir intestinal döngüde 4 kDa FITC-dekstran insillasyonu; ve 4-kDa FITC-dekstran 13,24,25 beslenmesi. İkinci deneyde, FITC-dekstran gavaj yoluyla beslenirVe epitel geçti ve kan akışına sızan FITC dekstran miktarı serum örneklerinden florometrik ölçülür. izleyici tüm yol rektum yemek borusu geçer ve izleyicinin en çok kolon ulaşmadan önce geçecek çünkü bu deneyde, tüm gastrointestinal sistem geçirgenliği, ölçülür. Köprüsü modelinde, geçirgenlik döngüsü (genellikle ince bağırsak) 25 için kullanılan kapalı bağırsak bölgesinde ölçülür. Bunun aksine, Evans mavisi deney izleyici doğrudan tüm kolon damlatılır yana kolonda sadece epitel geçirgenliği ölçülür avantajına sahiptir. Bu durumda, bu analizi kullanarak, kolon epitel diyet takviyesi ile korunmaktadır olduğu sonucuna varabiliriz.

Bazı veriler (örneğin, geçirgenlik assa mavi Evans sızan çünkü, çekimi sonrası ve diğer tahliller için dokular kullanmadan önce kolon ağırlık ve uzunluk kaydetmek için her zaman önemlidiry) doku gramı başına ifade edilmiştir. Ayrıca, ağırlık-uzunluk oranı, doku hasarı 26 bağımsız bir okuma çıktı. Burada tarif edilen genel olarak doku morfolojisi, hematoksilin ve eozin ile boyanmış parafin gömülmüş dokular kullanılarak analiz edilir. Parafin gömme doku morfolojisi, diğer yerleştirme yöntemlerine göre çok daha iyi korunmuş olması avantajına sahiptir. Bu mukoza içinde farklı hücre tipleri, şüphe götürmez teşhisini sağlayan (yani, bağışıklık hücreleri, epitel, goblet hücreleri, vb) bu tür ödem oluşması, lökosit infiltrasyonunun ve epitelial apikal erozyon gibi kolit sırasında doku değişimlerinin incelenmesi. Öte yandan, parafın immünofloresan boyama yalnızca zaman alıcı epitop kurtarma sonra gerçekleştirilebilir dezavantajı vardır. Bu nedenle, her zaman OCT bileşiği gömülü farklı dondurulmuş doku biyopsi hazırlar. Bu tür doku örnekleri kolayca kriyostat kullanarak bölümlere ve aut düşük seviyelerini göstermektedir edilebilirofluorescence. (Metanol gibi) o aktin filamentler müdahale etmez ne çünkü dehidratasyon ile tespit için etanol kullanımı, ne de (PFA yaptığı gibi) otofloresans tetikler yok. Bu teknikler kullanılarak, bir anti-enflamatuar ve anti-oksidatif diyet takviye kolit (Şekil 2 ile karşılaştırınız) boyunca doku morfolojisi ve bağlantı mimarisinin geliştirebildiği bulunmuştur.

Aşırı nötrofil çoğalması iltihabı 17 tepki olarak chemoattractants üretimi ile indüklenen kolit esnasında kritik bir olgudur. Nötrofiller inflamatuar işaret kaldırılmasına ve sonraki yara iyileşmesine katkıda çünkü Nötrofil işe fizyolojik bir olaydır. Bu doğal immün yanıt şekilde kontrol edilmesinin ve sona değilse, ancak, mukozada nötrofil serbest proteaz ve reaktif oksijen türleri tarafından doku hasarına katkıda bulunabilir. Nötrofiller kolaylıkla ölçülebilir MPO, içeren ve kullanılarak ölçülürMPO miktarı nötrofil sayısı ile doğru orantılıdır kolorimetrik deneyi. Şekil 3A kolit ve diyet müdahale sırasında nötrofil göçünü artar, bu aşırı ve kontrolsüz immün yanıtı önleyebilir göstermektedir. Mukoza bol nötrofil varlığında uygun olarak, oksidatif stres kolit (Şekil 3B) boyunca artar.

Bizim diyet takviyesi açıkça büyük olasılıkla nötrofil işe bir sonucudur oksidatif stres, mukoza korur. belirtildiği gibi, nötrofil kemokin tarafından çekilir ve kemokinlerin üretimi kolit esnasında çeşitli hücre tipleri tarafından salgılanan pro-enflamatuar sitokinler tarafından oluşturulur. Böylece, düşük nötrofil çoğalması azaltılmış sitokin ve kemokin üretiminin bir sonucu olduğu varsayılmıştır. Şekil 3C gösteriyor ki pro-enflamatuar sitokinler, IL-1β ve IL-6, hem dekemokin KC, DSS-kaynaklı kolit sırasında düzenlenen edilmektedir. diyet takviye seviyesini kontrol etmek için tekrar IL-6 seviyeleri ters ve IL-1 p ve KC'nin üretiminde artış iyileştirilebilir. Not, KC farelerde nötrofiller için en önemli kemoatraktan olduğunu.

Bu nedenle, bu doku morfolojisi gözlenen koruma da olduğu nötrofil infiltrasyonu, bağlı olduğu kurgulanabilir, KC, indirgenmiş bir üretim sonucu. Kalıntı DSS izole RNA içinde mevcut olduğunda, RT-PCR ile DSS ile tedavi edilen doku analiz etme RNA üretimi sorunludur. DSS ters transkriptazlar ve Taq-polimerazlar hem inhibe olmasıdır. Resim amplifikasyonu elde edilebilir ise, başka bir yerde tarif edildiği gibi 27, ayrıca LiCİ aracılı çökeltme RNA örnekleri saflaştırmak için gerekli olacaktır.

Özetle, biz doku hasarının analizi için detay farklı yöntemler DSS kolit sırasında ve nasıl bu d tarifAmage diyet takviyeleri ile iyileştirilebilir. Bilgi insan IBD analiz takviyesi koruyucu etkilerini araştırmak amacıyla hasta gruplarını kurulmasını haklı böyle hayvan deneylerinde elde edilen. Klinik çalışmalardan elde edilen veriler daha sonra IBD yönetimi için alternatif tedavi stratejileri geliştirmek için yeni yollar açabilir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa hiçbir şey yok.

Acknowledgments

Bu çalışma Meksika Bilim ve Teknoloji Konseyi (Conacyt, 207268 ve 233395 Michael Schnoor kadar) hibe tarafından desteklenmiştir. KFCO yüksek lisans derecesi elde etmek için bir Conacyt stipend (396260) bir alıcı.

Materials

Name Company Catalog Number Comments
0.3% of gelatin  Bioxon 158
10% formaldehyde J.T. Baker 2106-03
96-well plate with flat bottom Corning 3368
Absolute ethanol  J.T. Baker 9000-03
Absolute xylene J.T. Baker 9490-03
ABTS Sigma Aldrich H5882
Bovine Serum Albumin Sigma-Aldrich 9048-46-8
ColoScreen Helena Laboratories 5072
Corabion (Kindly provided by Merck, Naucalpan, Mexico) Merck
Dextran Sulfate Sodium Salt Affymetrix 9011-18-1 (M.W. 40,000-50,000)
Dihydroethidium Life Technology D11347
Eosin-Y  J.T. Baker L087-03
Evans blue Sigma-Aldrich 314-13-6
Feeding  needle Cadence Science Inc. 9921
Glass slide rack with handle Electron Microscopy 70312-16
Glass Slides Corning 2947
Harris hematoxylin  Sigma-Aldrich H3136
Hexadecyltrimethyammonium (HTAB) Sigma Aldrich H6269
Histosette (Embedding cassette) Simport M498.2
Hydrochloric acid 1 M J.T. Baker 9535-62
Hydrogen peroxide Sigma Aldrich H3410
Ketamine PiSA Agropecuaria Q-7833-028
Liquid paraffin  Paraplast 39501-006
Lithium carbonate  Sigma-Aldrich 2362
N,N-dimethylformamide J.T. Baker 68-12-2
N-acetylcysteine Sigma-Aldrich A9165
Plastic cubes Electron Microscopy 70181
Poly-L-Lysine Solution Sigma-Aldrich 25988-63-0
Prism 5 statistical software GraphPad Software Prism 5
Saline Solution 0.9% NaCl CS PiSA Q-7833-009
Sodium citrate Sigma-Aldrich W302600
Synthetic resin  Poly Mont 7987
Taq DNA polymerase Invitrogen 11615-010
Tissue-tek. O.C.T Compound Sakura Finetek 4583
Tuberculine Syringe BD Plastipak 305945
Tween 20 Sigma-Aldrich 9005-64-5
VECTASHIELD Antifade Mounting Medium with DAPI Vector Laboratories H-1200
Xylazine PiSA Agropecuaria Q-7833-099

DOWNLOAD MATERIALS LIST

References

  1. Souza, H. S., Fiocchi, C. Immunopathogenesis of IBD: current state of the art. Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).
  2. Xavier, R. J., Podolsky, D. K. Unravelling the pathogenesis of inflammatory bowel disease. Nature. 448, 427-434 (2007).
  3. Neuman, M. G., Nanau, R. M. Inflammatory bowel disease: role of diet, microbiota, life style. Transl Res. 160, 29-44 (2011).
  4. Lowenberg, M., D'Haens, G. Next-Generation Therapeutics for IBD. Current Gastroenterol Rep. 17, 21 (2015).
  5. Bernstein, C. N. Does everyone with inflammatory bowel disease need to be treated with combination therapy. Curr Opin Gastroenterol. (2016).
  6. Nanau, R. M., Neuman, M. G. Nutritional and probiotic supplementation in colitis models. Dig Dis Sci. 57, 2786-2810 (2012).
  7. Yamamoto, T. Nutrition and diet in inflammatory bowel disease. Curr Opin Gastroenterol. 29, 216-221 (2013).
  8. Vargas Robles, H., et al. Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage. Ox Med Cell Longev. 8473242 (2016).
  9. Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice. Ox Med Cell Longev. 2015, 467471 (2015).
  10. Perse, M., Cerar, A. Dextran sodium sulphate colitis mouse model: traps and tricks. J Biomed Biotechnol. 2012, 718617 (2012).
  11. Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 104, Unit 15 25 (2014).
  12. Laroui, H., et al. Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon. PLoS One. 7, 32084 (2009).
  13. Mennigen, R., et al. Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis. Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).
  14. Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding. J Microsc. 145, 115-120 (1987).
  15. Shen, W., Gaskins, H. R., McIntosh, M. K. Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes. J Nutr Biochem. (2013).
  16. Bruewer, M., et al. Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process. FASEB J. 19, 923-933 (2005).
  17. Fournier, B. M., Parkos, C. A. The role of neutrophils during intestinal inflammation. Muc Immunol. 5, 354-366 (2012).
  18. Yan, Y., et al. Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis. PLoS One. 4, 6073 (2009).
  19. Maxwell, J. R., Viney, J. L. Overview of mouse models of inflammatory bowel disease and their use in drug discovery. Curr Prot Pharmacol, S.J. Enna. Chapter 5, Unit 5.57 (2009).
  20. Ostanin, D. V., et al. T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade. Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).
  21. Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. A review on chemical-induced inflammatory bowel disease models in rodents. Kor J Physiol Pharmacol. 18, 279-288 (2014).
  22. Whittem, C. G., Williams, A. D., Williams, C. S. Murine Colitis modeling using Dextran Sulfate Sodium (DSS). JoVE. (2010).
  23. Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. Chemically induced mouse models of intestinal inflammation. Nat Prot. 2, 541-546 (2007).
  24. Naydenov, N. G., et al. Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis. Sci Rep. 6, 24161 (2016).
  25. Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment. Muc Immunol. 7, 905-915 (2014).
  26. Laukoetter, M. G., et al. JAM-A regulates permeability and inflammation in the intestine in vivo. J Exp Med. 204, 3067-3076 (2007).
  27. Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA. BMC Res Notes. 6, 360 (2013).
Deneysel Kolit sırasında Bağırsak epitel Bariyer Fonksiyonları Üzerine Ek Beslenme Faydalı Etkileri Analizi
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).More

Vargas Robles, H., Castro Ochoa, K. F., Nava, P., Silva Olivares, A., Shibayama, M., Schnoor, M. Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis. J. Vis. Exp. (119), e55095, doi:10.3791/55095 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter