Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing Motor Neuron Membran Potential i Live Zebrafish Embryoer

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

In vivo systemisk komponentanalyse giver forskere mulighed for at undersøge cellulær adfærd på den mest pålidelige måde. Dette er især tilfældet, når aktiviteten under kontrol er stærkt påvirket af cellecelleinteraktioner (både kontakt- og ikke-kontaktafhængige) som i nervesystemet, hvor membranspændingsændringer driver kommunikationen blandt spændende celler. Forståelsen af ​​informationen kodet af disse elektriske signaler er nøglen til at forstå den måde nervesystemet virker i både fysiologiske og sygdomstilstande.

For at studere celle elektriske egenskaber i de mest ikke-invasive fysiologiske forhold er der for nylig udviklet flere genetisk kodede spændingsindikatorer 1 . I modsætning til de tidligere generationer af optiske spændingsfølere (primært spændingsfølsomme farvestoffer) 2 giver GEVI'er mulighed for in vivo analyser af det intakte neurale system ogDeres udtryk kan begrænses til specifikke celletyper eller populationer.

Zebrafish embryoet er det valgte in vivo "substrat" ​​for at drage fordel af det store potentiale, der tilskrives GEVI'er. Takket være sin optiske klarhed og dets forenklede, men evolutionært konserverede nervesystem gør Zebrafish-modellen faktisk det muligt at identificere og manipulere hver enkelt cellulær komponent i et netværk. Faktisk har beskæftigelsen af ​​den FRET-baserede GEVI Mermaid 3 ført til identifikation af præ-symptomatiske ændringer i spinalmotor-neuronadfærd i en zebrafiskmodel af amyotrofisk lateralsklerose (ALS) 4 .

Følgende in vivo- protokol beskriver hvordan man overvåger de elektriske egenskaber hos spinalmotorneuroner i intakte zebrafiskembryoner, der udtrykker havfrue på en neuronspecifik måde. Desuden demonstrerer det, hvordan farmakologisk induceret chanGes i sådanne elektriske egenskaber kan være forbundet med ændringer i hyppigheden af ​​embryonale spontane coilings, den stereotype motoriske aktivitet, som karakteriserer zebrafiskens bevægelsesadfærd i meget tidlige udviklingsstadier.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid Plasmid Generation

BEMÆRK: Havfrue er en biosensor udviklet ved at parre det spændingsfølsomme domæne (VSD) af Ciona intestinalis (nu Ciona robusta ) 5 spændingssensor indeholdende fosfatase (Ci-VSP) med FRET-partner fluorophores Umi-Kinoko Green (mUKG: donor) og en monomer version af det orange-emitterende fluorescerende protein Kusabira Orange (mKOk: acceptor). For denne biosensor forøger konformationsændringer af VSD-domænet, induceret ved membran depolarisering, nærheden af ​​donor- og acceptor-fluorescerende proteiner, hvorved energioverførslen mellem dem øges (forøgelse af FRET-forholdet) 3 . VSD sikrer den effektive lokalisering af biosensoren ved plasmamembranen. Den neuronale ekspression af biosensoren (i rygmarven, signalet er detekterbart i både interneuroner og motorneuroner) opnås ved at klone havfruen opEn læseramme (ORF) under den zebrafisk-pan-neurale promotor HuC 6 .

  1. Ampere ved hjælp af polymerasekædereaktion (PCR) havfruen ORF fra pCS4 + Mermaid-plasmidet 3 med Pfu (korrekturlæsning) DNA-polymerase under anvendelse af T3 Universal primeren og Mermaid Sma I primeren (5'TATCCCGGGATTCGACGGTTCAGATTTTA) for at indsætte et Sma I restriktionssted opstrøms Af havfruen ORF.
    1. Brug følgende PCR-blanding: 0,5 μl Pfu DNA-polymerase, 7,5 μl af den specifikke 10x buffer, 1 μl 10 mM dNTP'er, 2,5 μl dimethylsulfoxid (DMSO), 0,5 μl (50 ng) af plasmidpræparatet og 1 ΜL 20 μM stamopløsninger af hver primer i et totalt volumen på 50 μl.
    2. Opvarm PCR-blandingen i 15 s ved 95 ° C, prik den i 15 s ved 50 ° C og forlæng den i 4 minutter ved 72 ° C i i alt 35 cyklusser.
  2. Gel-rens den specifikke stumpPCR-produkt ved anvendelse af et kommercielt gelrensningssæt efter fabrikantens protokol.
  3. Klon DNA fragmentet i pCMV-SC stump vektor efter producentens protokol.
  4. Lineariserer det havfrue-positive plasmid (navngivet pCMV-SC_Mermaid) med Sma I-restriktionsenzymet til følgende insertion af HuC-promotoren.
    1. Indstil begrænsningsreaktionen som følger: 0,5 μL (10 U) Sma I restriktionsenzym, 2 μl af kit 10x buffer og 5 μg plasmid DNA i et totalt volumen på 20 μl. Inkuber reaktionen ved 25 ° C i 1 time.
  5. Gel-oprensning af det fordøjede plasmid under anvendelse af et kommercielt gelrensningssæt efter producentens protokol.
  6. PCR-amplificere HuC-promotoren (pHuC) med Pfu DNA-polymerase og zebrafisk genomisk DNA som skabelon ved anvendelse af et par HuC-specifikke primere (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA og HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) og spænder over en 3,150-bp region opstrøms for ATG.
    1. Opsætning af PCR-blandingen under anvendelse af følgende skema: 0,5 μl Pfu DNA-polymerase, 7,5 μl af den specifikke 10x buffer, 1 μl 10 mM dNTP'er, 2,5 μl DMSO, 200 ng genomisk DNA og 1 μl 20 μM Stamopløsninger af hver primer i et samlet volumen på 50 μl.
    2. Efter et indledende trin på 2 minutter ved 95 ° C opvarmes PCR-blandingen i 15 s ved 95 ° C, primer den i 15 s ved 50 ° C og forlænges i 4 minutter ved 72 ° C i i alt 35 cyklusser .
  7. Gel-oprensning af det specifikke stumpe PCR-produkt ved anvendelse af et kommercielt gelrensningssæt efter producentens protokol.
  8. Ligér en ækvimolær mængde af den oprensede pCMV-SC_Mermaid (trin 1.5) og pHuC-DNA'et (trin 1.7) ved anvendelse af 1 μl T4-DNA-ligase og 1 μl af den specifikke 10X-buffer i et totalt volumen på 10 μl. Inkuber reaktionen i 16 timer ved4 ° C.
  9. Transform en aliquot af kompetente celler med 5 μl ligeringsreaktionen (trin 1.8) efter producentens anvisninger.
  10. Vælg de pHuC-positive kloner (pHuC_Mermaid) med promotoren indsat i den korrekte orientering ved hjælp af en Sal I- Eco RV dobbeltfordøjelse ( Sal I restriktionsstedet er blevet indsat opstrøms for promotorfragmentet i trin 1.6, mens Eco RV restriktionsstedet Er placeret nedstrøms for polyadenyleringsområdet, PolyA, af pCMV-SC plasmidet).
    1. Indstil restriktionsreaktionen som følger: 0,5 μL (10 U) af både Sal I- og Eco RV-restriktionsenzymerne, 2 μl kit10X-bufferen og 1 μg pHuC_Mermaid DNA i et totalt volumen på 20 μl. Inkuber reaktionen ved 37 ° C i 1 time. Kør reaktionerne på en agarosegel.

2. Embryo-mikroinjektion

  1. Overfør den befrugtede f.eksGs opnået fra vildtype (AB-stamme) eller Sod1-G93R voksen zebrafisk 4 til en 10 mm petriskål ved anvendelse af en plastpipette.
  2. Skyl embryoerne i koldt (4 ° C) fiskvand og straks mikroinjektér dem i gylle med 200 pg pHuC_Mermaid plasmid ved hjælp af en mikroinjektor (for en samlet og detaljeret beskrivelse af mikroinjektionsproceduren, se Referencerne 7 og 8).
  3. Brug en plastipipette, overfør embryoerne til en petriskål og inkubér dem i fiskevand ved 28 ° C, indtil de når det ønskede udviklingsstadium (20-24 timer efter befrugtning, hpf) til følgende analyser.

3. Spontan hale-coilanalyse

BEMÆRK: Evaluer den spontane haleudvikling i 20-24 hpf embryoner med eller uden lægemiddelriluzol.

  1. Overfør et embryo til en 90 mm rund petriskål fyldt med fiskvand indeholdende 0,2% DMSO (riluzol-køretøj) og manuelt dekarterer det med toO guldsmedens tang med skarpe spidser. Inkubér embryoet i 5 minutter.
  2. Registrere haleudviklingen ved RT under en 1 min videooptagelse ved hjælp af et digitalkamera monteret på et stereomikroskop. Få tidsserier til en tidsopløsning på 30 billeder / s.
  3. Beregn frekvensen af ​​spontane hale-spoler ved at tælle antallet af bøjninger (både kontralaterale og ipsilaterale) pr. Tidsenhed.
  4. For at evaluere effekten af ​​lægemidlet riluzole skal du forsigtigt bruge en plastisk Pasteur pipette til at overføre embryoet til en ny 90 mm petriskål fyldt med fiskevand indeholdende 5 μM riluzole.
    1. Inkuber embryoet i 5 minutter, før du optager en 1-min-video og udfører adfærdsanalysen som ovenfor.

4. Imaging Setup for Mermaid Biosensor Visualisering i Living Embryos: Samtidig Påvisning af Donor og Acceptor Signaler

  1. Montér 20-24 hpf embryoner i 1% lavmeltning agarose i fiskevand på37 ° C inde i en 35 mm glasbundet billedskål. Orienter embryonerne på deres sider. Vent til agarosen størkner ved stuetemperatur.
  2. Overfør billedskålen til scenen af ​​en inverteret konfokal monteret på et inverteret mikroskop. Identificer motoriske neuroner, der udtrykker biosensoren med et 20X objektiv (0,7 numerisk blænde, NA) ved at spænde mUKG'en med 488 nm argonlaserlinjen og registrere dens emission mellem 495 og 525 nm.
  3. For en FRET-måling exciterer mUKG, donoren fra FRET-parret, med 488 nm laserlinjen. Samtidig detektere, med en resonansscanner, der opererer ved 8.000 Hz i den tovejsede tilstand, fluorescensen udgivet af donoren (mellem 495 og 525 nm) og fluorescensen udsendt af mKOk-acceptoren (mellem 550 og 650 nm, FRET-kanalen). Hvis det er tilgængeligt, skal du bruge 473 nm laseren.
    BEMÆRK: Donatorens exciteringseffektivitet vil blive lidt reduceret (85% i stedet for 93% med 488 nm), men kryds excitationen af ​​acceptoren vilOgså reduceres (fra 17% med 488 nm til 9% med 473 nm laserlinie).
  4. For at reducere fototoksicitet og fluoroforblegning minimeres belysningen af ​​prøven ved at reducere laserlinjens effekt (på køberbjælkevinduet i overtagelsessoftwaren).
  5. Optimer excitationen for at matche gevinst og forskydningsparametre, der er angivet i begyndelsen af ​​eksperimentet og holdt konstant i løbet af sessionen. For at indstille forskydningen skal du ændre billedets farve til intensitetsværdierne (ved hjælp af Q-opslagstabellen), og drej offsetknappen (smart offset), mens du scanner med laseren, så baggrundspixerne har en intensitet lidt Højere end nul. Med samme opslagstabel, ved at tænde laseren, mens du scanner, skal du dreje forstærkerknappen (smart gain) for at maksimere signal / støjforholdet. Pas på at undgå mættede pixels.
  6. Ved hjælp af et åbent pinhole (2 luftige enheder), erhverver 16-bit billeder for at give et tilstrækkeligt dynamisk område for kvantitativE analyser. Undgå gennemsnitsværdi for at øge overtagelseshastigheden og for at minimere photobleaching.
  7. I vinduet til softwareopsamling skal du vælge en billedfeltstørrelse på 512 x 64 pixel (pixelstørrelse: 605 nm) i rullemenuen.
  8. Fra vinduet til opkøbsmodus skal du vælge xyt (tidsforløb på et enkelt xy-plan) f rom drop-down menuen og registrere ændringer i embryo spinal neuron spænding ved at erhverve et enkelt xy-plan, indstilling af opkøbsparametre for at optage et billede hver 30 Ms i 1 min.
  9. For at evaluere effekten af ​​riluzol indgivelse på membran depolarisering i samme neuron, erhverver et nyt datasæt 5 min efter tilsætning af fiskevand indeholdende 5 μM riluzole.
  10. Ved FRET-analysen skal du bruge ImageJ makro Biosensor_FRET (udtrykke single-chain FRET biosensorer.
  11. Evaluer basalmembran FRET-forholdet for hver neuron ved t 1 som ((FRET-middel - FRET-baggrund) / (Donor-middel-Donor-baggrund)), hvor FRET og DonEller gennemsnitlig intensitet er den gennemsnitlige fluorescensintensitet beregnet i samme interesseområde (ROI) trukket rundt om cellen for hver kanal, der er erhvervet, og FRET og Donor-baggrunden er den gennemsnitlige fluorescensintensitet beregnet i et ROI af synsfeltet uden den fluorescerende prøve.
    BEMÆRK: En detaljeret trin-for-trin beskrivelse af brugen af ​​pluginet findes på www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret hjemmeside.
  12. Brug en grafisk software til at sammenligne frekvensen, amplituden og varigheden af ​​depolarisering mellem forskellige eksperimentelle paradigmer. Sammenlign to grupper ved hjælp af en uparget Students t- test og overvej middelværdier som statistisk forskellige, når P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En ekspressionsvektor, der bærer den FRET-baserede havfrue-biosensorkodningssekvens under kontrol af den pHuC-pan-neuronale promotor, som driver proteinets syntese udelukkende i nervesystemet, blev leveret til enkeltcellede befrugtede æg ved hjælp af en mikroinjektion i For at opnå transiente transgene embryoner ( figur 1 , Venstre panel). Efter mastering af mikroinjektionsteknikken var procentdelen af ​​havfrue-positive embryoner tæt på 100%. Blandt disse blev kun embryonerne, der udtrykker den rette mængde af havfrue biosensor ved plasmamembranet, overvejet for FRET analyse / billedkøb.

Spontane spoler, motorresponser, der udelukkende består af en fuldstændig kropskontraktion, der bringer spidsen af ​​halen til hovedet 9 , 10 , blev registreret på et stadium på 20-24 hpf i almindeligt fiskemedium ( Figur 1 , Centerpanel og Video 1 ) og efter inkubation i 5 μM riluzole ( Video 2 ). De statistiske analyser af ændringerne i hyppigheden af ​​de spontane hale-spoler, der udløses af lægemidlet riluzole, rapporteres andre steder 4 .

For at teste om ændringer i den elektriske aktivitet af spinalmotorneuronerne var på grundlag af de riluzol-inducerede ændringer i den spontane coilfrekvens, blev membranpotentialet i embryo-spinalmotorneuroner undersøgt på en ikke-invasiv måde, der måler fluorescensintensiteten Forholdet mellem donor / acceptor FRET par af havfrue biosensor (FRET forhold: Figur 1 , højre panel). Primær spinale motoriske neuroner, der udtrykker biosensoren, blev identificeret ( figur 2A ), og deres basale spontane depolarisationsaktiviteter blev registreret ( Ng> Figur 2B og Video 3 og 4 ). Sammen med reduktionen i hyppighed af hale-coilbevægelser reducerede riluzol administrationen frekvensen af ​​spontane depolariseringshændelser ( figur 2C ).

figur 1
Figur 1: Flowdiagram af eksperimentel procedure. Enkeltcelle-stadium-embryoner opsamles og umiddelbart mikroinjektioneres med pHuC_Mermaid-plasmidet for at udtrykke havfrue-FRET-spændingsbiosensoren på en pan-neuronal måde. Ved 20-24 hkf med inkubering ved 28 ° C overføres enkelte embryoner under et stereomikroskop, og deres spontane hale-spoleaktivitet, med og uden det medikament riluzol, der er til stede i fiskevandet, optages og analyseres video. De samme embryoner gennemgår in vivo FRET analyse for at måle ændringer i motor neuron membran potentiale.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Venligst klik her for at se en større version af denne figur.

Figur 2
Figur 2: FRI-analyse in vivo til måling af ændringer i motor neuron membran potentiale. ( A ) Wild-type zebrafiskembryoner med mosaikudtrykket af den FRET-baserede spændingsbiosensor Mermaid i spinal neuron. (A) Det lyse feltbillede viser området af zebrafiskstammen identificeret af den sorte boks (sc: rygmarv, ms: myoseptum, m: myotom). Ved overlejring på (a) fluorescenssignalet detekteret (b) kan den effektive ekspression af biosensoren i en primær spinalmotorneuron (PM) klart visualiseres. Donoren (c) og FRET (d) -kanalen detekteret, vises med de respektive grønne og magenta opslagstabeller (LUT)På højre side. Alle embryoer er monteret i kranial-til-caudal orientering. Målestang = 10 μm. ( B ) FRET-forholdskortet viser FRET-forholdet beregnet hver 0,03 s i samme motorneuron. Det viser den basale spontane depolariseringsaktivitet, som cellen gennemgår. For Mermaid biosensoren forekommer stigningen i FRET forholdet, når membranpotentialet stiger. Målestang = 10 μm. ( C ) Repræsentativt eksempel på spontane gennemsnitlige FRET-forholdsændringer, der forekommer i en spinalmotor-neuron af et Sod1-G93R-zebrafiskembryo i løbet af 1 minuts optagelse. Riluzole administration reducerer frekvensen af ​​de spontane depolariseringer. Klik her for at se en større version af denne figur.

Film 1
Film 1:Spontan hale coiling i 24-hpf Wild-type kontrol embryoer. Repræsentativ optagelse viser spontan hale coiling i et 24 hpf vildtype kontrol embryo inkuberet i fiskevand. Klik her for at se denne video. (Højreklik for at downloade.)

Film 2
Film 2: Spontan hale coiling i 24-hpf Wild-type riluzole-behandlede embryoer. Repræsentativ optagelse viser spontan hale coiling i et 24 hpf vildtype kontrol embryo inkuberet i 5 μM riluzole (+ R). Sammenlignet med kontroller viste + R-embryoner et signifikant fald i frekvensen af ​​spontan hale-coiladfærd ved 24 hpf. Klik her for at se denne video. (RigHt-klik for at downloade.)

Film 3
Film 3: Basal Spontan Depolariseringsaktivitet af en Primær Motor Neuron i Spinal Cord af en Wild-type Zebrafish Embryo ved 20 hpf. Mermaid biosensoren er så følsom, at den kan detektere de hurtige ændringer i motor neuron membran potentiale i spinalkabler af intakte embryoner. Klik her for at se denne video. (Højreklik for at downloade.)

Film 4
Film 4: Spontan depolarisationsaktivitet er koblet til muskelkontraktion. En sekundær motor neuron i rygmarven af ​​et vildtype zebrafisk embryo ved 20 hpf undergår spontan depolarisering. I dette tilfælde, hver dePolarisering er forbundet med en sammentrækning af zebrafiskmusklerne, organiseret i et funktionelt synkroniseret syncytium på dette udviklingsstadium. Klik her for at se denne video. (Højreklik for at downloade.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Protokollen, der præsenteres her, tillod os at undersøge sammenhængen mellem de elektriske egenskaber af zebrafisk embryon spinalmotor neuroner og spontan coiling opførsel, den tidligste stereotypiske motor aktivitet, der vises omkring 17 hpf embryonale udvikling og varer indtil 24 hpf 10 .

Vores tilgang giver forskere et værktøj til at studere neurale systemet af intakte embryoner, der fuldt ud bevarer kompleksiteten af ​​interaktionerne mellem celler i et udviklende funktionelt netværk. In vivo billeddannelsen af ​​zebrafiskembryoner er blevet udført ved simpelthen at immobilisere dem gennem nedsænkning i lavmeltende agarose. Undersøgelsen af ​​ændringer i cellemembranpotentialet ved brug af en biosensor er en af ​​hovedfordelene ved denne metode. Kanoniske elektrofysiologiske tilgange, hvor neuroner skal være fysisk tilgængelige ved at fjerne de omsluttende væv 11 , er procedurSom kan ændre de elektriske egenskaber hos de celler, der undersøges. Desuden giver den FRET-baserede biosensor tilgang mulighed for undersøgelse af celleelektriske egenskaber uden brug af anæstetika ( dvs. Tricaine, en natriumkanalblokker), hvilket undgår enhver mulig forstyrrelse i forbindelse med indgivelse af kemikalier ( dvs. riluzole her), hvilket Kan være afgørende i forsøgsplanen. Denne metode tillod os at fokusere på moduleringen af ​​både den elektriske aktivitet og frekvensen af ​​de spontane hale-spoler, et adfærdsmæssigt svar, som i de fleste tilfælde forhindrer elektrofysiologiske optagelser uden administration af anæstetika. Endelig tilbyder beskæftigelsen af ​​GEVI'er den højeste tidsmæssige eksperimentelle kontrol, fordi det tillader arbejde på et bestemt embryonisk udviklingsstadium. Vores billeddannelses- / optagelsessessioner spænder over et meget begrænset tidsvindue, der giver os mulighed for præcist at sammenligne udviklingsstadierne i de forskellige embryoner i realtid. AlleDe konventionelle elektrofysiologiske optagelser sker derimod normalt i større og mindre præcise tidsforløb.

Måling af spændingsændringer ved billeddannelsesteknikker er imidlertid iboende vanskelig på grund af selve signalet, som kan variere i hastighed, i frekvens og i størrelsen af ​​ændringer i membranpotentiale. En ideel spændingssensor bør kombinere hurtig respons, høj følsomhed og høj fotonemission. For de fleste FRET-baserede GEVI'er varierer forholdsændringer som en funktion af membranspændingsvariationer, men amplitude af fluorescensforholdets ændringer er tæt forbundet med varigheden af ​​depolariseringshændelserne. For nylig blev nye GEVI'er udviklet og karakteriseret, hvilket gør det muligt at vælge den bedste probe i forhold til typen af ​​eksperimentelle problem, model og billeddannelsesenhed.

Spændingsbiosensorer er integrerede membranproteiner. Når transficeres i dyrkede celler eller udtrykkesD i levende organismer vil fluorescensen af ​​den plasmamembran-lokaliserede sensor i en vis grad være associeret med sensorens fluorescens i andre intracellulære rum - hvor proteinet kan mislokaliseres eller aggregeres, hvilket således frembringer et baggrundssignal. Udtryksniveauet og den korrekte membranlokalisering af hver konstruktion skal overvåges i forenklede eksperimentelle modeller ( dvs. transfektion af cellelinier eller primære kulturer), før biosensorerne anvendes i levende organismer.

I den foreliggende eksperimentelle opsætning kan et andet potentielt kritisk trin af protokollen være repræsenteret ved effektiviteten af ​​transgeneseproceduren. Om nødvendigt kan procentdelen af ​​plasmid-positive celler øges drastisk ved anvendelse af Tol2 transposonsystemet 12 . Et yderligere afgørende aspekt, der skal overvejes, er tabet af fluorescensemission i donorfluorforen og tabet i FRET sigNal forekommer under billedbehandling sessions på grund af den intense belysning. Dette bør undgås ved at minimere belysningen af ​​prøven og reducere effekten af ​​den anvendte laserlinie. På samme måde skal forstærkningen og forskydningen af ​​fotomultiplikatorerne indstilles omhyggeligt i begyndelsen af ​​hver optagesession for at opnå det bedste signal-støjforhold i de overtagne billeder samt for at undgå mættede pixels. Alle disse parametre kan variere afhængigt af typen af ​​celle, der undersøges, biosensorens egenskaber og de instrumenter, der anvendes til billedoptagelse (brede feltfluorescensmikroskoper, kan også anvendes som for nylig beskrevet 13 ). Forskeren bør dog altid overveje, at under in vivo billeddannelse kan støjniveauet interferere med sensorens specifikke signal mere end i in vitro- optagelser. Endelig vil kontrolmålinger, der bruger mutantprober, som ikke svarer til spænding, være tilgængelige, hvis det er tilgængeligtAt evaluere niveauet af systemspecifik støj og / eller artefakter.

Beskæftigelsen af ​​zebrafiskembryoner udgør et centralt element i denne tilgang takket være deres lydhørhed over for genetisk manipulation og mikroskopisk undersøgelse. Faktisk gør disse egenskaber transient transgenese og den FRET-baserede analyse af neuronelle elektriske egenskaber gennemførlige. Efter vores mening vil det med den bedst egnede promotor- og biosensorkombinationer potentielt være muligt at selektivt analysere den elektriske aktivitet af en hvilken som helst celletype af interesse og til parallel sådan aktivitet med den embryonale fænotype.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing Motor Neuron Membran Potential i Live Zebrafish Embryoer
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter