Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing Motor Neuron Membran Potenzial in Live Zebrafisch Embryos

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

In-vivo- systemische Komponentenanalyse ermöglicht es Wissenschaftlern, zelluläres Verhalten auf die zuverlässigste Weise zu untersuchen. Dies trifft besonders dann zu, wenn die zu prüfende Aktivität stark durch Zell-Zell-Wechselwirkungen (sowohl kontakt- als auch berührungsabhängig) beeinflusst wird, wie im Nervensystem, wo Membranspannungsänderungen die Kommunikation zwischen erregbaren Zellen antreiben. Das Verständnis der Informationen, die von diesen elektrischen Signalen codiert werden, ist der Schlüssel zum Verständnis der Art und Weise, wie das Nervensystem sowohl in physiologischen als auch in Krankheitszuständen arbeitet.

Um zelle elektrische Eigenschaften in den meisten nicht-invasiven physiologischen Bedingungen zu untersuchen, wurden vor kurzem mehrere genetisch codierte Spannungsindikatoren entwickelt 1 . Im Gegensatz zu den bisherigen Generationen von optischen Spannungssensoren (hauptsächlich spannungsempfindlichen Farbstoffen) 2 erlauben GEVIs in vivo Analysen des intakten neuronalen Systems undIhre Expression kann auf bestimmte Zelltypen oder Populationen beschränkt sein.

Der Zebrafisch-Embryo ist der in vivo "Substrat" ​​der Wahl, um das große Potenzial zu nutzen, das GEVIs zugeschrieben wird. Tatsächlich ermöglicht das Zebrafisch-Modell dank seiner optischen Klarheit und seines vereinfachten, aber dennoch evolutionär konservierten Nervensystems die einfache Identifikation und Manipulation jeder zellularen Komponente in einem Netzwerk. In der Tat führte die Beschäftigung der FRET-basierten GEVI Mermaid 3 zur Identifizierung von prä-symptomatischen Veränderungen im Wirbelsäulenmotor-Neuron-Verhalten in einem Zebrafisch-Modell der amyotrophischen Lateralsklerose (ALS) 4 .

Das folgende in vivo- Protokoll beschreibt, wie die elektrischen Eigenschaften von Wirbelsäulenmotor-Neuronen in intakten Zebrafisch-Embryonen, die Meerjungfrau in einer neuronalspezifischen Weise exprimieren, überwacht werden. Darüber hinaus zeigt es, wie pharmakologisch induzierte chanGes in solchen elektrischen Eigenschaften können mit Veränderungen in der Häufigkeit der embryonalen Spontanspulen verbunden sein, die stereotypische motorische Aktivität, die das Bewegungsverhalten des Zebrafischs in sehr frühen Entwicklungsstadien charakterisiert.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid-Plasmid-Erzeugung

HINWEIS: Meerjungfrau ist ein Biosensor, der durch die Paarung der spannungsempfindlichen Domäne (VSD) der Ciona intestinalis (jetzt) ​​entwickelt wurde Ciona robusta ) 5 Spannungssensor mit Phosphatase (Ci-VSP) mit dem FRET-Partner Fluorophoren Umi-Kinoko Green (mUKG: Donor) und einer monomeren Version des orange emittierenden fluoreszierenden Proteins Kusabira Orange (mKOk: Akzeptor). Für diesen Biosensor erhöhen Konformationsänderungen der VSD-Domäne, die durch Membrandepolarisation induziert werden, die Nähe der Donor- und Akzeptor-Fluoreszenzproteine, wodurch die Energieübertragung zwischen ihnen erhöht wird (Erhöhung des FRET-Verhältnisses) 3 . Die VSD sichert die effiziente Lokalisierung des Biosensors an der Plasmamembran. Die neuronale Expression des Biosensors (im Rückenmark, das Signal ist sowohl bei Interneuronen als auch bei motorischen Neuronen nachweisbar) wird durch Klonierung der Meerjungfrau opEn Leserahmen (ORF) unter dem Zebrafisch-pan-neuronalen Promotor HuC 6 .

  1. Amplifizierung durch die Polymerasekettenreaktion (PCR) des Mermaid-ORF aus dem pCS4 + Meerjungfern-Plasmid 3 mit Pfu (Korrekturlesen) DNA-Polymerase unter Verwendung des T3 Universal-Primers und des Mermaid Sma I-Primers (5'TATCCCGGGATTCGACGGTTCAGATTTTA), um eine SmaI- Restriktionsstelle stromaufwärts einzuführen Der Meerjungfrau ORF.
    1. Verwenden Sie die folgende PCR-Mischung: 0,5 μl Pfu-DNA-Polymerase, 7,5 μl des spezifischen 10x Puffers, 1 μl 10 mM dNTPs, 2,5 μl Dimethylsulfoxid (DMSO), 0,5 μl (50 ng) des Plasmidpräparates und 1 ΜL von 20 & mgr; M Stammlösungen von jedem Primer in einem Gesamtvolumen von 50 & mgr; l
    2. Die PCR-Mischung für 15 s bei 95 ° C erhitzen, für 15 s bei 50 ° C betragen und für 4 min bei 72 ° C für insgesamt 35 Zyklen verlängern.
  2. Gel-reinigen die spezifischen stumpfPCR-Produkt unter Verwendung eines handelsüblichen Gelreinigungskits nach dem Protokoll des Herstellers.
  3. Klonen Sie das DNA-Fragment in den pCMV-SC-stumpfen Vektor nach dem Protokoll des Herstellers.
  4. Linearisieren Sie das Mermaid-positive Plasmid (genannt pCMV-SC_Mermaid) mit dem Sma I Restriktionsenzym für die folgende Insertion des HuC-Promotors.
    1. Stellen Sie die Restriktionsreaktion wie folgt ein: 0,5 μl (10 U) Sma I Restriktionsenzym, 2 μl des Kit 10x Puffers und 5 μg Plasmid DNA in einem Gesamtvolumen von 20 μl. Inkubieren Sie die Reaktion bei 25 ° C für 1 h.
  5. Gel-reinigen des verdauten Plasmids unter Verwendung eines handelsüblichen Gelreinigungskits nach dem Protokoll des Herstellers.
  6. PCR-amplifizieren den HuC-Promotor (pHuC) mit Pfu-DNA-Polymerase und Zebrafisch-Genom-DNA als Matrize unter Verwendung eines Paares von HuC-spezifischen Primern (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA und HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) und überspannt eine 3,150-bp-Region stromaufwärts des ATG.
    1. Stellen Sie die PCR-Mischung nach folgendem Schema ein: 0,5 μl Pfu-DNA-Polymerase, 7,5 μl des spezifischen 10x-Puffers, 1 μl 10 mM dNTPs, 2,5 μl DMSO, 200 ng genomische DNA und 1 μl 20 μM Stammlösungen von jedem Primer in einem Gesamtvolumen von 50 μl.
    2. Nach einem anfänglichen Schritt von 2 min bei 95 ° C wird die PCR-Mischung für 15 s bei 95 ° C erhitzt, für 15 s bei 50 ° C vorgelegt und für 4 min bei 72 ° C für insgesamt 35 Zyklen verlängert .
  7. Gel-reinigen Sie das spezifische stumpfe PCR-Produkt unter Verwendung eines handelsüblichen Gelreinigungskits nach dem Protokoll des Herstellers.
  8. Ligat eine äquimolare Menge des gereinigten pCMV-SC_Mermaid (Schritt 1.5) und der pHuC-DNA (Schritt 1.7) unter Verwendung von 1 μl T4-DNA-Ligase und 1 μl des spezifischen 10X-Puffers in einem Gesamtvolumen von 10 μl. Inkubieren Sie die Reaktion für 16 h bei4 ° C
  9. Umwandlung eines Aliquots kompetenter Zellen mit 5 μl der Ligationsreaktion (Schritt 1.8) nach den Anweisungen des Herstellers.
  10. Wählen Sie die pHuC-positiven Klone (pHuC_Mermaid) mit dem in die richtige Orientierung eingeführten Promotor durch eine Sal I- Eco RV-Doppelverdauung (die Sal I-Restriktionsstelle wurde stromaufwärts des Promotorfragments in Schritt 1.6 eingefügt, während die Eco RV-Restriktionsstelle Ist stromabwärts der Polyadenylierungsregion, PolyA, des pCMV-SC-Plasmids angeordnet).
    1. Stellen Sie die Restriktionsreaktion wie folgt ein: 0,5 μl (10 U) sowohl der Sal I als auch der Eco RV Restriktionsenzyme, 2 μl des Kit10X Puffers und 1 μg pHuC_Mermaid DNA in einem Gesamtvolumen von 20 μl. Inkubieren Sie die Reaktion bei 37 ° C für 1 h. Führen Sie die Reaktionen auf ein Agarosegel.

2. Embryo Mikroinjektion

  1. Übertragen Sie den befruchteten zBGs, erhalten aus Wildtyp (AB-Stamm) oder Sod1-G93R erwachsenen Zebrafisch 4 zu einer 10 mm Petrischale unter Verwendung einer Plastikpipette.
  2. Spülen Sie die Embryonen in kaltem (4 ° C) Fischwasser und mischen Sie sie sofort in das Eigelb mit 200 pg pHuC_Mermaid-Plasmid unter Verwendung eines Mikroinjektors (für eine Gesamt- und detaillierte Beschreibung des Mikroinjektionsprozesses siehe Literatur 7 und 8).
  3. Mit einer Plastikpipette die Embryonen in eine Petrischale überführen und in Fischwasser bei 28 ° C inkubieren bis sie die gewünschte Entwicklungsstufe (20-24 h nach der Befruchtung, hpf) für die folgenden Analysen erreichen.

3. Spontane Tail Coiling Analyse

HINWEIS: Bewerten Sie das spontane Schwanzaufwicklungsverhalten in 20-24 hpf Embryonen mit oder ohne Drogenriluzol.

  1. Übertragen Sie einen Embryo auf eine 90-mm-Runde Petrischale mit Fischwasser mit 0,2% DMSO (Riluzol-Träger) gefüllt und manuell dechorionieren mit twO Juwelier Pinzette mit scharfen Spitzen. Den Embryo für 5 min inkubieren.
  2. Erkennung der Schwanzaufwicklung bei RT während einer 1-minütigen Videoaufnahme mit einer Digitalkamera, die auf einem Stereomikroskop montiert ist. Erwerben Sie Zeitreihen zu einer Zeitauflösung von 30 Bildern / s.
  3. Berechnen Sie die Häufigkeit der spontanen Schwanzwicklungen, indem Sie die Anzahl der Biegungen (sowohl kontralateral als auch ipsilateral) pro Zeiteinheit zählen.
  4. Um die Wirkung des Medikamenten-Riluzols zu bewerten, verwenden Sie vorsichtig eine Plastik-Pasteur-Pipette, um den Embryo auf eine neue 90-mm-Petrischale zu bringen, die mit Fischwasser mit 5 μM Riluzol gefüllt ist.
    1. Inkubieren Sie den Embryo für 5 Minuten, bevor Sie ein 1-minütiges Video aufzeichnen und die Verhaltensanalyse wie oben durchführen.

4. Imaging-Setup für Meerjungfrau Biosensor Visualisierung in lebenden Embryonen: Simultane Erkennung von Spender- und Akzeptorsignalen

  1. Montieren Sie die 20 - 24 hpf Embryonen in 1% niedrigschmelzender Agarose in Fischwasser bei37 ° C in einer 35 mm Glasboden-Aufnahmeschale. Orientiere die Embryos an ihren Seiten. Warten Sie, bis die Agarose bei Raumtemperatur erstarrt.
  2. Übertragen Sie die bildgebende Schale auf die Bühne eines umgekehrten konfokalen auf einem invertierten Mikroskop montiert. Identifizieren Sie Motorneuronen, die den Biosensor mit einem 20X-Objektiv (0,7 numerische Apertur, NA) ausdrücken, indem Sie das mUKG mit der 488 nm Argon-Laserlinie anregen und seine Emission zwischen 495 und 525 nm aufzeichnen.
  3. Für eine FRET-Messung wird mUKG, der Spender des FRET-Paares, mit der 488 nm Laserlinie angeregt. Gleichzeitig mit einem Resonanzscanner, der bei 8000 Hz im bidirektionalen Modus arbeitet, die von dem Donor emittierte Fluoreszenz (zwischen 495 und 525 nm) und die vom mKOk-Akzeptor emittierte Fluoreszenz (zwischen 550 und 650 nm, FRET-Kanal). Falls vorhanden, verwenden Sie den 473 nm Laser.
    HINWEIS: Die Erregungseffizienz des Spenders wird leicht reduziert (85% statt 93% bei 488 nm), aber die Kreuzerregung des Akzeptors wirdAuch reduziert werden (von 17% bei 488 nm bis 9% bei 473 nm Laserlinie).
  4. Um die Phototoxizität und die Fluorophor-Bleiche zu reduzieren, minimieren Sie die Beleuchtung der Probe durch Verringerung der Leistung der Laserlinie (auf dem Strahlengangfenster der Erfassungssoftware).
  5. Optimieren Sie die Erregung, um den Verstärkungs- und Offset-Parametern zu entsprechen, die zu Beginn des Experiments eingestellt sind und während der gesamten Sitzung konstant gehalten werden. Um den Offset einzustellen, ändern Sie die Farbe des Bildes in Intensitätswerte (mit der Q-Look-Up-Tabelle) und drehen Sie beim Scannen mit dem Laser den Offset-Regler (smart offset), so dass die Hintergrundpixel eine Intensität haben Höher als null. Mit der gleichen Nachschlagtabelle, durch Umschalten des Lasers beim Scannen, drehen Sie den Verstärkungsknopf (intelligente Verstärkung), um das Signal-Rausch-Verhältnis zu maximieren, wobei darauf geachtet wird, dass gesättigte Pixel vermieden werden.
  6. Mit einem geöffneten Pinhole (2 luftige Einheiten) erwerben 16-Bit-Bilder, um einen ausreichenden Dynamikbereich für quantitativ zu liefernE analysiert. Vermeiden Sie die Mittelung, um die Erfassungsgeschwindigkeit zu erhöhen und das Photobleichen zu minimieren.
  7. Wählen Sie im Software-Erfassungsfenster aus dem Dropdown-Menü eine Bildfeldgröße von 512 x 64 Pixel (Pixelgröße: 605 nm) aus.
  8. Wählen Sie aus dem Erfassungsmodus-Fenster xyt (Zeitraffer auf einer einzelnen xy-Ebene) aus dem Dropdown-Menü und notieren Sie die Änderungen der Embryo-Wirbelsäulenneuronspannung durch Erfassen einer einzelnen xy-Ebene, indem Sie die Erfassungsparameter einstellen, um jeweils ein Bild aufzuzeichnen Ms für 1 min.
  9. Um die Wirkung der Riluzol-Verabreichung auf die Membrandepolarisation im selben Neuron zu bewerten, erhält man nach der Zugabe von Fischwasser, das 5 μM Riluzol enthält, einen neuen Datensatz.
  10. Für die FRET-Analyse verwenden Sie den ImageJ-Makro Biosensor_FRET (Ausdrücken von einkettigen FRET-Biosensoren.
  11. Bewerte das Basalmembran-FRET-Verhältnis jedes Neurons bei t 1 als ((FRET mean - FRET-Hintergrund) / (Donor mean - Donor Hintergrund)), wo FRET und DonOder mittlere Intensität ist die mittlere Fluoreszenzintensität, die in der gleichen Region von Interesse (ROI) berechnet wird, die um die Zelle für jeden erworbenen Kanal gezogen wird, und der FRET- und Donorhintergrund ist die mittlere Fluoreszenzintensität, die in einem ROI des Gesichtsfeldes ohne die Fluoreszenzprobe berechnet wird.
    HINWEIS: Eine detaillierte Schritt-für-Schritt-Beschreibung der Verwendung des Plugins finden Sie auf der Website www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret .
  12. Verwenden Sie eine Grafiksoftware, um die Frequenz, die Amplitude und die Dauer der Depolarisation zwischen verschiedenen experimentellen Paradigmen zu vergleichen. Vergleichen Sie zwei Gruppen mit einem ungepaarten Student's t- test und betrachten Mittelwerte als statistisch anders, wenn P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ein Expressionsvektor, der die FRET-basierte Mermaid-Biosensor-codierende Sequenz unter der Kontrolle des pHuC-pan-neuronalen Promotors trägt, der die Synthese des Proteins ausschließlich im Nervensystem antreibt, wurde mittels einer Mikroinjektion in Einzelzell-befruchtete Eier zugeführt Um transiente transgene Embryos zu erhalten ( Abbildung 1 , Linke Tafel). Nach der Beherrschung der Mikroinjektionstechnik lag der Prozentsatz der Meerjungfrau-positiven Embryonen bei nahezu 100%. Unter diesen wurden nur die Embryonen, die die richtige Menge an Mermaid-Biosensor an der Plasmamembran exprimierten, für die FRET-Analyse / Bildaufnahme betrachtet.

Spontane Spulen, motorische Reaktionen, die ausschließlich aus einer Ganzkörperkontraktion bestehen, die die Spitze des Schwanzes zum Kopf 9 , 10 bringt, wurden im Stadium von 20 aufgezeichnet-24 hpf im regulären Fischmedium ( Abbildung 1 , Mitteltafel und Video 1 ) und nach Inkubation in 5 μM Riluzol ( Video 2 ). Die statistischen Analysen der Veränderungen der Häufigkeit der spontanen Schwanzwicklungen, die durch das Medikament Riluzol ausgelöst werden, werden an anderer Stelle 4 genannt .

Um zu testen, ob Veränderungen in der elektrischen Aktivität der Wirbelsäulenmotor-Neuronen auf der Grundlage der Riluzol-induzierten Veränderungen in der spontanen Coiling-Frequenz waren, wurde das Membranpotential in Embryo-Wirbelsäulenmotor-Neuronen auf nicht-invasive Weise untersucht, wobei die Fluoreszenzintensität gemessen wurde Verhältnis des Donor / Acceptor-FRET-Paares des Mermaid-Biosensors (FRET-Verhältnis: Abbildung 1 , rechte Tafel). Primäre spinale Motorneuronen, die den Biosensor exprimierten, wurden identifiziert ( Abbildung 2A ) und ihre basalen spontanen Depolarisationsaktivitäten wurden aufgezeichnet ( Ng> Abbildung 2B und Videos 3 und 4 ). Zusammen mit der Verringerung der Häufigkeit der Schwanzaufwickelbewegungen reduzierte die Riluzoladministration die Häufigkeit von spontanen Depolarisationsereignissen ( Abbildung 2C ).

Abbildung 1
Abbildung 1: Flussdiagramm des experimentellen Verfahrens. Einzelzellstadium-Embryos werden gesammelt und sofort mit dem pHuC_Mermaid-Plasmid mikroinjiziert, um den Meerjungfrau-FRET-Spannungs-Biosensor in einer pan-neuronalen Weise zu exprimieren. Bei 20-24 hpf bei Inkubation bei 28 ° C werden einzelne Embryos unter einem Stereomikroskop übertragen und ihre spontane Schwanzaufwicklung mit und ohne die im Fischwasser vorhandene Drogenriluzole wird aufgezeichnet und analysiert. Die gleichen Embryonen unterliegen in vivo FRET-Analyse, um Veränderungen im motorischen Neuron-Membranpotential zu messen.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: In-vivo- FRET-Analyse zur Messung von Änderungen im Motor-Neuron-Membranpotential. ( A ) Wildtyp-Zebrafisch-Embryos mit dem Mosaik-Ausdruck des FRET-basierten Spannungs-Biosensors Meerjungfrau im Spinal-Neuron. (A) Das helle Feldbild zeigt den Bereich des Zebrafischstammes, der durch die schwarze Schachtel identifiziert wurde (sc: Rückenmark, ms: myoseptum; m: myotome). Durch Überlagern (a) des detektierten Fluoreszenzsignals (b) kann die effiziente Expression des Biosensors in einem primären Spinalmotorneuron (PM) deutlich sichtbar gemacht werden. Der Spender (c) und der erkannte FRET (d) -Kanal werden mit den jeweiligen grünen und magentafarbenen Nachschlagtabellen (LUT)auf der rechten Seite. Alle Embryos sind in einer kranial-to-kaudalen Orientierung montiert. Maßstab = 10 μm. ( B ) Die FRET-Verhältniskarte zeigt das FRET-Verhältnis an, das alle 0,03 s im gleichen Motorneuron berechnet wurde. Es zeigt die basale spontane Depolarisationsaktivität, die die Zelle erfährt. Für den Mermaid-Biosensor tritt die Zunahme des FRET-Verhältnisses auf, wenn das Membranpotential zunimmt. Maßstab = 10 μm. ( C ) Repräsentatives Beispiel für spontane mittlere FRET-Verhältnisänderungen, die bei einem spinalen Motorneuron eines Sod1-G93R-Zebrafisch-Embryos während einer 1-minütigen Aufzeichnung auftreten. Die Riluzol-Verabreichung reduziert die Häufigkeit der spontanen Depolarisationen. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Film 1
Film 1:Spontane Tail Coiling in 24-hpf Wildtyp- Kontrolle Embryonen. Repräsentative Aufzeichnung mit spontanem Schwanzaufwickeln in einem 24 hpf Wildtyp-Kontroll-Embryo, der in Fischwasser inkubiert wurde. Bitte klicken Sie hier um dieses Video anzusehen. (Rechtsklick zum Download).

Film 2
Film 2: Spontane Tail Coiling in 24-hpf Wild-Typ Riluzol-behandelten Embryonen. Repräsentative Aufzeichnung mit spontanem Schwanzaufwickeln in einem 24 hpf Wildtyp-Kontroll-Embryo, inkubiert in 5 μM Riluzol (+ R). Im Vergleich zu den Kontrollen zeigten die + R-Embryos eine signifikante Abnahme der Häufigkeit des spontanen Schwanzwicklungsverhaltens bei 24 hpf. Bitte klicken Sie hier um dieses Video anzusehen. (TakelageHt-Klick zum Download.)

Film 3
Film 3: Basale spontane Depolarisationsaktivität eines primären motorischen Neurons im Rückenmark eines Wildtyp-Zebrafisch-Embryos bei 20 hpf. Der Mermaid-Biosensor ist so empfindlich, dass er die raschen Veränderungen des motorischen Neuronmembranpotentials in den Rückenmarken intakter Embryonen nachweisen kann. Bitte klicken Sie hier um dieses Video anzusehen. (Rechtsklick zum Download).

Film 4
Film 4: Spontane Depolarisation Aktivität ist gekoppelt, um Muskelkontraktion. Ein sekundärer motorischer Neuron im Rückenmark eines Wildtyp-Zebrafisch-Embryos bei 20 hpf unterliegt einer spontanen Depolarisation. In diesem Fall ist jeder deDie Polarisation ist mit einer Kontraktion der Zebrafischmuskeln verbunden, die in einem funktional synchronisierten Syncytium in diesem Entwicklungsstadium organisiert ist. Bitte klicken Sie hier um dieses Video anzusehen. (Rechtsklick zum Download).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Das hier vorgestellte Protokoll erlaubte es uns, die Assoziation zwischen den elektrischen Eigenschaften von Zebrafisch-Embryo-Wirbelsäulenmotor-Neuronen und dem spontanen Wickelverhalten zu erforschen, die früheste stereotypische motorische Aktivität, die um 17 hpf der embryonalen Entwicklung auftritt und bis 24 hpf 10 dauert.

Unser Ansatz bietet Forschern ein Werkzeug, um das neuronale System der intakten Embryonen zu studieren, wobei die Komplexität der Wechselwirkungen zwischen Zellen in einem sich entwickelnden funktionalen Netzwerk vollständig erhalten bleibt. Die in vivo- Bildgebung von Zebrafisch-Embryonen wurde durchgeführt, indem sie einfach durch Eintauchen in niedrigschmelzende Agarose immobilisiert wurde. Die Untersuchung von Veränderungen des Zellmembranpotentials durch die Verwendung eines Biosensors stellt einen der Hauptvorteile dieser Methode dar. Kanonische elektrophysiologische Ansätze, bei denen Neuronen physisch zugegriffen werden müssen, indem man die umhüllenden Gewebe 11 entfernt , sind VerfahrensweiseDie die elektrischen Eigenschaften der untersuchten Zellen verändern könnten. Darüber hinaus ermöglicht der FRET-basierte Biosensor-Ansatz die Untersuchung von zell-elektrischen Eigenschaften ohne Verwendung von Anästhetika ( dh Tricaine, einem Natriumkanalblocker), wobei jegliche mögliche Störung, die mit der Verabreichung von Chemikalien ( dh Riluzol hier) verbunden ist, vermieden wird Könnte im experimentellen Plan entscheidend sein. Diese Methode erlaubte uns, uns auf die Modulation sowohl der elektrischen Aktivität als auch der Häufigkeit der spontanen Schwanzwicklungen zu konzentrieren, eine Verhaltensreaktion, die in den meisten Fällen elektrophysiologische Aufnahmen ohne die Anästhesieverwaltung verhindert. Schließlich bietet die Beschäftigung von GEVIs die höchste zeitliche experimentelle Kontrolle, da sie die Arbeit in einem bestimmten embryonalen Entwicklungsstadium ermöglicht. Unsere Bild- / Aufnahmesitzungen erstreckten sich auf ein sehr zeitlich begrenztes Zeitfenster, so dass wir die Entwicklungsstadien der verschiedenen Embryonen in Echtzeit genau vergleichen konnten. AlleDie konventionellen elektrophysiologischen Aufnahmen werden im Gegenteil meist in größeren und weniger präzisen Zeitspannen durchgeführt.

Die Messung von Spannungsänderungen durch bildgebende Verfahren ist jedoch aufgrund der Art des Signals selbst, das in der Geschwindigkeit, in der Frequenz und in der Größe der Änderungen des Membranpotentials variieren kann, jedoch intrinsisch schwierig. Ein idealer Spannungssensor sollte schnelles Ansprechverhalten, hohe Empfindlichkeit und hohe Photonenemission kombinieren. Für die meisten FRET-basierten GEVIs variieren die Verhältnisänderungen in Abhängigkeit von Membranspannungsschwankungen, aber die Amplitude der Fluoreszenzverhältnisänderungen ist eng mit der Dauer der Depolarisationsereignisse verbunden. In letzter Zeit wurden neue GEVIs entwickelt und charakterisiert, so dass es möglich ist, die beste Sonde in Bezug auf die Art der experimentellen Problem-, Modell- und Abbildungsvorrichtung zu wählen.

Spannungsbiosensoren sind integrale Membranproteine. Wenn sie in kultivierte Zellen transfiziert oder exprimiert werdenD in lebenden Organismen wird die Fluoreszenz des Plasmamembran-lokalisierten Sensors bis zu einem gewissen Grad mit der Fluoreszenz des Sensors in anderen intrazellulären Kompartimenten assoziiert - wo das Protein falsch lokalisiert oder aggregiert werden kann - wodurch ein Hintergrundsignal erzeugt wird. Der Grad der Expression und die richtige Membranlokalisierung jedes Konstruktes sollten in vereinfachten experimentellen Modellen ( dh Transfizierung von Zelllinien oder Primärkulturen) überwacht werden , bevor die Biosensoren in lebenden Organismen verwendet werden.

In dem vorliegenden experimentellen Aufbau könnte ein weiterer potentieller kritischer Schritt des Protokolls durch die Effizienz des Transgeneseverfahrens dargestellt werden. Falls erforderlich, kann der Prozentsatz an Plasmid-positiven Zellen durch Verwendung des Tol2-Transposonsystems drastisch erhöht werden. Ein weiterer entscheidender Aspekt, der berücksichtigt werden muss, ist der Verlust der Fluoreszenzemission im Spenderfluorophor und der Verlust in FRET sigWährend der Bildgebung aufgrund der intensiven Beleuchtung. Dies sollte durch Minimierung der Beleuchtung der Probe vermieden werden, wodurch die Leistung der verwendeten Laserlinie reduziert wird. In ähnlicher Weise müssen die Verstärkung und der Versatz der Photomultiplier sorgfältig am Anfang jeder Aufzeichnungssitzung abgestimmt werden, um das beste Signal-Rausch-Verhältnis in den aufgenommenen Bildern zu erzielen sowie gesättigte Pixel zu vermeiden. Alle diese Parameter können je nach Art der untersuchten Zelle, den Eigenschaften des Biosensors und den für die Bildaufnahme verwendeten Instrumenten variieren (Weitfeld-Fluoreszenzmikroskope können auch verwendet werden, wie bereits beschrieben 13 ). Der Forscher sollte jedoch immer berücksichtigen, dass bei der In-vivo- Bildgebung der Rauschpegel das spezifische Signal des Sensors mehr als in In-vitro- Aufnahmen stören könnte. Schließlich wäre, wenn verfügbar, Kontrollmessungen mit Mutanten-Sonden, die nicht auf Spannung reagieren, ein bequemer WegUm das Niveau von systemspezifischen Geräuschen und / oder Artefakten zu bewerten.

Die Beschäftigung von Zebrafisch-Embryonen stellt ein wichtiges Merkmal dieses Ansatzes dar, dank ihrer Reaktionsfähigkeit auf genetische Manipulation und mikroskopische Untersuchung. Tatsächlich machen diese Eigenschaften eine vorübergehende Transgenese und die FRET-basierte Analyse von neuronalen elektrischen Eigenschaften möglich. Unserer Meinung nach wäre es mit den am besten geeigneten Promotor- und Biosensorkombinationen möglich, die elektrische Aktivität eines beliebigen Zelltyps selektiv zu analysieren und eine solche Aktivität mit dem embryonalen Phänotyp parallel zu machen.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing Motor Neuron Membran Potenzial in Live Zebrafisch Embryos
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter