Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Biosensing מוטורית נוירון פוטנציאל ממברנה עוברי דג הזברה חיים

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

ב vivo ניתוח מרכיב מערכתית מאפשרת למדענים לחקור התנהגות הסלולר בצורה האמינה ביותר. הדבר נכון במיוחד כאשר הפעילות הנבדקת מושפעת במידה רבה מהאינטראקציות של תאי-התא (הן מגע והן ללא קשר), כמו במערכת העצבים, שבה שינויים בממברנה יוצרים את התקשורת בין תאים נרגשים. הבנת המידע המקודד על ידי אותות חשמליים אלה היא המפתח להבנת האופן שבו פועלת מערכת העצבים במצבים פיזיולוגיים ומחלות כאחד.

על מנת ללמוד תכונות חשמליות התא בתנאים פיזיולוגיים לא פולשנית ביותר, כמה אינדיקטורים מתח מקודד גנטית פותחו לאחרונה 1 . בניגוד לדורות הקודמים של חיישני מתח אופטי (בעיקר צבעים רגישים למתח) 2 , GEVIs מאפשרים ניתוחי vivo של מערכת העצבים השלמה,הביטוי שלהם יכול להיות מוגבל סוגי תאים ספציפיים או אוכלוסיות.

העובר דג הזברה הוא ב "המצע" vivo של בחירה כדי לנצל את הפוטנציאל הגדול המיוחס GEVIs. למעשה, הודות לבהירותה האופטית ולמערכת העצבים הפשוטה אך המשופעת שלה, מודל דג הזברה מאפשר זיהוי ומניפולציה פשוטים של כל רכיב סלולרי ברשת. ואכן, התעסוקה של FRET מבוססי בתולת הים GEVI 3 הובילה לזיהוי שינויים טרום סימפטומטיים בהתנהגות נוירון מוטורי עמוד השדרה במודל דג הזברה של טרשת לרוחב amyotrophic (ALS) 4 .

להלן בפרוטוקול vivo מתאר כיצד לפקח על המאפיינים החשמליים של נוירונים מוטוריים בעמוד השדרה של עוברי דג הזברה שלם להביע בתולת ים בצורה ספציפית נוירונים. יתר על כן, הוא מדגים כיצד chan המושרה pharmacologicallyגזים אלה תכונות חשמליות יכול להיות קשור שינויים בתדר של עובריים ספונטנית עובריים, פעילות מוטורית סטריאוטיפית המאפיינת את התנהגות התנועה של דג הזברה בשלבים מוקדמים מאוד של פיתוח.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. pHuC_Mermaid דור פלסמיד

הערה: בת הים היא biosensor שפותחה על ידי זיווג מתח חישה מתח (VSD) של Ciona intestinalis (עכשיו Ciona rubusta ) 5 חיישן מתח המכיל phosphatase (Ci-VSP) עם השותף FRET fluorophores Umi-Kinoko גרין (mUKG: התורם) ואת גרסה מונומריים של חלבון פלואורסצנטי פולטת כתום Kusabira Orange (mKOk: acceptor). עבור biosensor זה, שינויים קונפורמטיביים של תחום VSD, המושרה על ידי depolarization ממברנה, להגדיל את הקרבה של התורם ו acceptor פלואורסצנטי חלבונים, ובכך להגדיל את העברת האנרגיה ביניהם (הגדלת יחס FRET) 3 . ה- VSD מבטיח את לוקליזציה יעילה של biosensor על קרום הפלזמה. הביטוי העצבני של biosensor (בעמוד השדרה, האות הוא לזיהוי הן interneurons ו נוירונים המנוע) מושגת על ידי שיבוט האופרה בת היםEn מסגרת הקריאה (ORF) תחת מקדם דג הזברה פאן עצבית HuC 6 .

  1. להגביר על ידי תגובת שרשרת פולימראז (PCR) ORF בתולת הים מ pCS4 + בת הים פלסמיד 3 עם PFU (הגהה) פולימראז דנ"א באמצעות פריימר יוניברסל T3 ואת בת הים Sma אני פריימר (5'TATCCCGGGATTCGACGGTTCAGATTTTA) על מנת להכניס סמה אני הגבלה האתר במעלה הזרם של ORF בת הים.
    1. השתמש בתערובת ה- PCR הבאה: 0.5 μL של פולימרז DNA PFu, 7.5 μL של חיץ 10x ספציפי, 1 μL של dNTPs 10 מ"מ, 2.5 μL של sulfoxide דימתיל (DMSO), 0.5 μL (50 ng) של הכנה פלסמיד, ו 1 ΜL של 20 מניות מניות פתרונות של כל פריימר בהיקף כולל של 50 μL.
    2. מחממים את תערובת ה- PCR עבור 15 s ב 95 מעלות צלזיוס, הממשלה אותו 15 S ב 50 מעלות צלזיוס, ו להאריך אותו במשך 4 דקות ב 72 מעלות צלזיוס עבור סכום כולל של 35 מחזורים.
  2. ג 'ל לטהר את בוטה ספציפימוצר PCR באמצעות ערכת טיהור ג'ל מסחרי, בעקבות פרוטוקול של היצרן.
  3. לשכפל את קטע ה- DNA לתוך וקטור pCMV-SC קהה בעקבות פרוטוקול של היצרן.
  4. לינאריזציה של פלסמיד חיובי בת הים (בשם pCMV-SC_Mermaid) עם אנמה סמה אני הגבלה עבור הכניסה הבאה של האמרגן HuC.
    1. הגדר את תגובת ההגבלה כדלקמן: 0.5 μL (10 U) של אנמה הגבלה סמה אני, 2 μL של חיץ 10x קיט, ו 5 מיקרוגרם של DNA פלסמיד בנפח כולל של 20 μL. דגירה התגובה ב 25 מעלות צלזיוס במשך 1 ח.
  5. ג'ל לטהר את פלסמיד מתעכל באמצעות ערכת טיהור ג'ל מסחרי בעקבות פרוטוקול של היצרן.
  6. PCR-להגביר את האמרגן HuC (pHuC), עם פולימרז DNA Phenu דג הזברה הדנומית דג הזברה כמו בתבנית, באמצעות זוג primers ספציפיים HuC (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA ו HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) ו פורש 3,150-bp במעלה הזרם של ATG.
    1. הגדרת תערובת ה- PCR באמצעות ערכת הבאה: 0.5 μL של פולימראז DNA Pfu, 7.5 μL של חיץ 10x מסוים, 1 μL של dNTPs 10 מ"מ, 2.5 μL של DMSO, 200 ng של DNA גנומי, ו 1 μL של 20 מיקרומטר פתרונות מלאי של כל פריימר בהיקף כולל של 50 μL.
    2. לאחר צעד ראשוני של 2 דקות ב 95 מעלות צלזיוס, לחמם את תערובת ה- PCR עבור 15 s ב 95 מעלות צלזיוס, הממשלה אותו במשך 15 שניות ב 50 מעלות צלזיוס, ו להאריך אותו במשך 4 דקות ב 72 מעלות צלזיוס עבור סכום כולל של 35 מחזורים .
  7. ג'ל לטהר את המוצר PCR בוטה ספציפי באמצעות ערכת טיהור ג'ל מסחרי בעקבות פרוטוקול של היצרן.
  8. לקשר כמות שווה של pcmv-SC_Mermaid (שלב 1.5) ואת ה- DNA pHuC (שלב 1.7) באמצעות 1 μL של ליגז DNA T4 ו 1 μL של חיץ 10X ספציפי בנפח כולל של 10 μL. דגירה התגובה עבור 16 שעות ב4 ° C.
  9. להפוך aliquot של תאים המוסמכות עם 5 μL של התגובה קשירת (שלב 1.8) בעקבות הוראות היצרן.
  10. בחר את שיבוטים חיובי pHuC (pHuC_Mermaid) עם היזם מוכנס בכיוון הנכון על ידי עיכול סאל I- אקו RV פעמיים (האתר סאל אני הגבלה הוכנס במעלה הזרם של מקדם שבר בשלב 1.6, בעוד Eco RV הגבלת האתר ממוקם במורד הזרם של אזור polyadenylation, PolyA, של pCMV-SC פלסמיד).
    1. הגדר את תגובת ההגבלה כדלקמן: 0.5 μL (10 U) של שניהם אני סאל אני ואנזים RV הגבלה, 2 μL של חיץ kit10X, ו 1 מיקרוגרם של ה- DNA pHuC_Mermaid בנפח כולל של 20 μL. דגירה התגובה ב 37 מעלות צלזיוס למשך 1 שעות. הפעל את התגובות על גבי ג'ל agarose.

2. עוברי Microinjection

  1. להעביר את מופרית למשלGS המתקבל wild-type (זן AB) או דג הזברה Sod1-G93R מבוגר 4 כדי צלחת 10 מ"מ פטרי באמצעות פיפטה פלסטיק.
  2. שוטפים את העוברים במים קרים (4 מעלות צלזיוס) דגים ו microinject אותם מיד חלמון עם 200 pg של pHuC_Mermaid פלסמיד באמצעות microinjector (לתיאור כולל ומפורט של הליך microinjection, ראה הפניות 7 ו - 8).
  3. באמצעות פיפטה פלסטיק, להעביר את העוברים לצלחת פטרי דגירה אותם במי הדגים על 28 מעלות צלזיוס עד שהם מגיעים לשלב ההתפתחותי הרצוי (20-24 שעות לאחר ההפריה, hpf) עבור הניתוחים הבאים.

3. ספונטנית זנב סליל ניתוח

הערה: להעריך את התנהגות זנב ספונטנית זנב ב 20-24 עוברים hpf עם או בלי riluzole התרופה.

  1. העברת העובר לצלחת פטרי 90 מ"מ עגול מלא מים דגים המכילים 0.2% DMSO (רכב riluzole) ו ידנית dechorionate זה באמצעות twמלקחיים של תכשיטן עם טיפים חדים. לדגור את העובר במשך 5 דקות.
  2. זיהוי הזנב פיתול ב RT במהלך הקלטה וידאו 1 דקות באמצעות מצלמה דיגיטלית רכוב על stereomicroscope. לרכוש סדרה בזמן ברזולוציה של 30 מסגרות / s.
  3. חישוב תדירות של זנב ספונטנית coilings על ידי ספירת מספר bends (הן contralateral ו ipsilateral) ליחידת זמן.
  4. כדי להעריך את ההשפעה של riluzole התרופה, בעדינות להשתמש פיפטה פסטר פלסטיק להעביר את העובר לצלחת פטרי 90 מ"מ חדש מלא מים דגים המכילים 5 מיקרון riluzole.
    1. דגירה העובר במשך 5 דקות לפני הקלטה של ​​1 דקות וידאו וביצוע ניתוח התנהגותי כאמור.

4. הדמיה ההתקנה של הדמיית Biosensor בת הים בעוברים חיים: זיהוי סימולטני של אותות התורם ו acceptor

  1. הר העוברים 20 - 24 hpf ב 1% נמוך נמס agarose נקודת במים דגים ב37 ° C בתוך 35 מ"מ זכוכית בתחתית הדמיה צלחת. אוריינט את העוברים על צדם. המתן עד agarose מתקשה בטמפרטורת החדר.
  2. מעבירים את צלחת הדמיה לשלב של confocal הפוך רכוב על מיקרוסקופ הפוך. זיהוי נוירונים מוטוריים להביע את biosensor עם מטרה 20X (0.7 צמצם המספרי, NA) על ידי מרגש mUKG עם 488 ננומטר קו לייזר ארגונית הקלטה ההקלטה שלה בין 495 ו 525 ננומטר.
  3. עבור מדידה סריג, לעורר mUKG, התורם של זוג סריג, עם קו לייזר 488 ננומטר. במקביל לזהות, עם סורק התהודה ההפעלה ב 8,000 הרץ במצב דו כיווני, הקרינה הנפלטת על ידי התורם (בין 495 ו 525 ננומטר) ואת הקרינה הנפלטת על ידי המקבל mKOk (בין 550 ו 650 ננומטר, ערוץ סריג). אם זמין, להשתמש לייזר 473 ננומטר.
    הערה: יעילות העירוי של התורם תהיה קטנה במקצת (85% במקום 93% עם 488 ננומטר), אבל את עירור צולבת של acceptor יהיהיופחת גם (מ 17% עם 488 ננומטר ל 9% עם 473 ננומטר קו לייזר).
  4. כדי להפחית phototoxicity ו הלבנה fluorophore, למזער את הארה של המדגם על ידי הפחתת כוחו של קו לייזר (על חלון הנתיב קרן של תוכנת הרכישה).
  5. לייעל את עירור כדי להתאים רווח הפרמטרים לקזז שנקבעו בתחילת הניסוי ונשמר קבוע לאורך כל הפגישה. כדי להגדיר את ההיסט, שנה את צבע התמונה לעוצמת העוצמה (באמצעות טבלת החיפוש Q), ובזמן שסורק את הלייזר, סובב את כפתור ההיסט (אופסט חכם) כך שלפיקסלי הרקע יש מעט עוצמה גבוה מאפס. עם אותו שולחן נראה, על ידי החלפת הלייזר בזמן סריקה, להפוך את כפתור הרווח (רווח חכם) כדי למקסם את יחס אות לרעש, נזהר להימנע פיקסלים רוויים.
  6. באמצעות פתח פתח (2 יחידות אוורירי), לרכוש תמונות 16 סיביות כדי לספק טווח דינמי מספיק quantitativE מנתח. הימנע ממוצעים כדי להגדיל את מהירות הרכישה כדי למזער photobleaching.
  7. בחלון רכישת התוכנה, בחר גודל שדה תמונה של 512 x 64 פיקסלים (גודל פיקסל: 605 ננומטר) מהתפריט הנפתח.
  8. מ חלון מצב הרכישה, בחר xyt (זמן לשגות על מטוס Xy יחיד) f ROM את התפריט הנפתח ורשום את השינויים העובר מתח הנוירון השדרה על ידי רכישת מטוס Xy יחיד, הגדרת פרמטרים הרכישה כדי להקליט תמונה אחת בכל 30 Ms במשך 1 דקות.
  9. כדי להעריך את ההשפעה של הממשל riluzole על המפולת הממברנה של נוירון אותו, לרכוש מערך נתונים חדש 5 דקות לאחר תוספת של מים דגים המכילים 5 מיקרון riluzole.
  10. לניתוח FRET, השתמש ב- BIOSensor_FRET מאקרו של ImageJ (הבעת חיישנים מסוג FRET של שרשרת אחת.
  11. להעריך את יחס הממברנה הבסיסית של כל נוירון ב t 1 כמו ((משמעות FRET - רקע רקע) / (התורם אומר - רקע התורם)), שבו FRET ו Donאו בעוצמה הממוצעת היא עוצמת הקרינה מתכוון מחושב באותו אזור של עניין (ROI) נמשך סביב התא עבור כל ערוץ רכשה ו סריג רקע התורם היא עוצמת הקרינה מתכוון מחושב ההחזר על ההשקעה של שדה הראייה ללא מדגם פלואורסצנטי.
    הערה: תיאור מפורט שלב אחר שלב של השימוש בפלאגין ניתן למצוא באתר האינטרנט www.med.unc.edu /microscopy/resources/imagej - plugins - and - macros/biosensor - fret .
  12. השתמש בתוכנת גרפים כדי להשוות את תדירות, משרעת ומשך של קוטביות בין פרדיגמות ניסוי שונות. השווה בין שתי קבוצות באמצעות t- test של תלמיד לא מזוהה ולשקול ערכים ממוצעים כפי שונה סטטיסטית כאשר P <0.05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

וקטור הביטוי נושא את קידוד ה- BIOSensor המבוסס על תרכובת ה- Mermaid ביולוגית, תחת שליטתו של האמרגן הפאן-נוירוני של ה- pHuC, המניע את הסינתזה של החלבון באופן בלעדי במערכת העצבים, נמסר לתוך ביצים מופרות של תא בודד באמצעות מיקרו- כדי לקבל עוברי מהונדס חולף ( איור 1 , לוח שמאל). לאחר מאסטרינג הטכניקה microinjection, אחוז עוברים חיובי בת הים היה קרוב ל 100%. בין אלה, רק את העוברים להביע את הכמות הנכונה של biosensor בת הים על קרום פלזמה נחשבו ניתוח FRET / רכישת התמונה.

ספונטים ספונטניים, תגובות מוטוריות הכוללות אך ורק התכווצות של גוף מלא המביאה את קצה הזנב לראש 9 , 10 , נרשמו בשלב של 20-24 hpf במדיום דגים רגילים ( איור 1 , לוח מרכז ווידאו 1 ) ולאחר הדגירה ב 5 מיקרומטר riluzole ( וידאו 2 ). ניתוח סטטיסטי של השינויים בתדירות של זנב זנב ספונטנית מופעלות על ידי התרופה riluzole מדווחים במקומות אחרים 4 .

כדי לבדוק אם שינויים בפעילות החשמלית של נוירונים מוטוריים בעמוד השדרה היו בבסיס השינויים riluzole- המושרה בתדר סלילה ספונטנית, פוטנציאל הממברנה של נוירונים מוטוריים עמוד השדרה נחקרו בצורה פולשנית, מדידת עוצמת הקרינה יחס של התורם / מקדם FRET זוג של biosensor בת הים (יחס FRET: איור 1 , פאנל מימין). ראשי נוירונים מוטוריים בעמוד השדרה להביע את biosensor זוהו ( איור 2 א ) ואת הפעילות שלהם depolarization ספונטנית בסיסית נרשמו ( Ng> איור 2 ב וסרטונים 3 ו 4 ). יחד עם הירידה בתדירות של זנב תנועות פיתול, הממשל riluzole הפחית את התדירות של אירועים depolarization ספונטני ( איור 2 ג ).

איור 1
איור 1: תרשים זרימה של הנוהל הניסויי. עוברים תא שלב אחד נאספים ומיד microinjected עם pHuC_Mermaid פלסמיד להביע את biosensor מתח- FRET מתח באופנה פאן עצבי. ב 20-24 hpf עם הדגירה על 28 מעלות צלזיוס, עוברים בודדים מועברים תחת stereomicroscope ואת זנב ספונטנית שלהם סליל פעילות, עם ובלי נוכחות סמים riluzole במים הדגים, הוא הקליט וידאו ונותחו. עוברים אותו לעבור ניתוח VIVO FRET כדי למדוד שינויים פוטנציאל הממברנה נוירון המנוע.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> אנא לחץ כאן כדי להציג גרסה גדולה יותר של נתון זה.

איור 2
איור 2: ב VIVO סריג ניתוח למדוד שינויים פוטנציאל הממברנה מנוע נוירון. ( א ) Wild-type עוברי דג הזברה עם הביטוי פסיפס של המתח מבוסס מבוסס biosensor biosensor נוירון השדרה. (א) התמונה בשדה בהיר מראה את האזור של גזע דג הזנה מזוהה על ידי הקופסה השחורה (sc: חוט השדרה, ms: myoseptum: m: myotome). על ידי על גבי (א) אות הקרינה זוהה (ב), הביטוי היעיל של biosensor ב נוירון המנוע השדרה הראשית (PM) ניתן דמיינו בבירור. התורם (c) והערוץ FRET (d) שזוהו מוצגים עם השולחנות המתאימים הירוקים והמגנטיים (LUT)בצד ימין. כל העוברים מותקנים באוריינטציה גולגולתי-אל-הזנב. סולם בר = 10 מיקרומטר. ( ב ) מפת יחס סריג מציג יחס סריג מחושב כל 0.03 שניות של נוירון המנוע אותו. הוא מראה את פעילות הדולריזציה הספונטנית הבסיסית שהתא עובר. עבור biosensor בת הים, הגידול היחס סריג מתרחשת כאשר פוטנציאל הממברנה עולה. סולם בר = 10 מיקרומטר. ( C ) נציג דוגמה של ספונטני ממוצע יחס יחס סריג המתרחשים נוירון מוטורי של עמוד השדרה של עובר דג הזברה Sod1-G93R במהלך הקלטה 1 דקות. ממשל רילוזול מקטין את תדירות ההדללות הספונטנית. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

סרט 1
סרט 1:זנב ספונטני סלילה ב 24-hpf Wild-type שליטה עוברים. הקלטה נציג מראה זנב ספונטנית פיתול בתוך 24 hpf wild-type שליטה העובר מודגרת במי הדגים. לחץ כאן כדי לצפות בסרטון זה. (לחץ באמצעות לחצן העכבר הימני כדי להוריד).

סרט 2
סרט 2: זנב ספונטנית זנב ב 24-hpf Wild-type riluzole מטופלים עוברים. הקלטה נציג מראה זנב ספונטנית פיתול בתוך hpf 24 עוברי שליטה wild-type מודגרות 5 riluzole מיקרומטר (+ R). בהשוואה לבקרות, R + עוברי הראו ירידה משמעותית בתדירות של התנהגות זנב ספונטנית זנב ב 24 hpf. לחץ כאן כדי לצפות בסרטון זה. (לבושHt-click כדי להוריד.)

סרט 3
סרט 3: Basular ספונטנית דפולריזציה פעילות של נוירון מוטורי ראשי בחוט השדרה של עובש דג הזברה wild-type ב 20 hpf. Biosensor בת הים הוא כל כך רגיש כי הוא יכול לזהות את השינויים המהירים פוטנציאל הממברנה נוירון המנוע בחוט השדרה של עוברי שלם. לחץ כאן כדי לצפות בסרטון זה. (לחץ באמצעות לחצן העכבר הימני כדי להוריד).

סרט 4
סרט 4: פעילות דפולריזציה ספונטני הוא מצמידים התכווצות שרירים. נוירון מוטורי משני בחוט השדרה של עובש דג הזברה wild-type ב 20 hpf עובר depolarization ספונטני. במקרה זה, כל דהקיטוב קשורה התכווצות של שרירי דג הזברה, מאורגן syncytium מסונכרן מבחינה תפקודית בשלב התפתחותי זה. לחץ כאן כדי לצפות בסרטון זה. (לחץ באמצעות לחצן העכבר הימני כדי להוריד).

Subscription Required. Please recommend JoVE to your librarian.

Discussion

הפרוטוקול המוצג כאן אפשר לנו לחקור את הקשר בין התכונות החשמליות של עוברי דג הזברה נוירונים מוטוריים עמוד השדרה ואת ההתנהגות סלילה ספונטנית, הפעילות הסטריאוטיפית המוקדם המוקדם ביותר, אשר מופיע סביב 17 hpf של התפתחות עובריים ונמשך עד 24 hpf 10 .

הגישה שלנו מספקת לחוקרים כלי לבדיקת המערכת העצבית של העוברים השלמים, תוך שמירה מלאה על המורכבות של האינטראקציות בין תאים ברשת תפקודית מתפתחת. ההדמיה vivo של עוברי דג הזברה בוצעה על ידי פשוט immobilizing אותם דרך טבילה נמוכה agroose המסה. המחקר של שינויים פוטנציאל קרום התא באמצעות שימוש biosensor מייצג את אחד היתרונות העיקריים של שיטה זו. גישות אלקטרוניות קנוניקל, שבו נוירונים חייב להיות נגיש פיזית על ידי הסרת רקמות עוטף 11 , הם פרוצדוראלאשר עשוי לשנות את התכונות החשמליים של התאים הנבדקים. יתר על כן, הגישה מבוסס biosensor מבוסס מאפשרת לחקור את תכונות החשמל התא ללא שימוש בהרדמה ( כלומר, Tricaine, חוסם ערוץ הנתרן), הימנעות כל הפרעה פוטנציאלית הקשורים וניהול של כימיקלים ( כלומר, riluzole כאן), אשר עשוי להיות מכריע בתוכנית הניסוי. שיטה זו אפשרה לנו להתמקד אפנון של הפעילות החשמלית ואת התדירות של זנב ספונטנית coilings, תגובה התנהגותית שמונעת, ברוב המקרים, הקלטות אלקטרו בלי ניהול של הרדמה. לבסוף, התעסוקה של GEVIs מציעה את השליטה הניסויית הזמני הגבוהה ביותר משום שהיא מאפשרת עבודה בשלב התפתחותי עוברי מסוים. ההדמיה שלנו / ההקלטה הפעלות נמתח חלון זמן מוגבל מאוד, המאפשר לנו להשוות במדויק את שלבי ההתפתחות של העוברים השונים בזמן אמת. את כלההקלטות האלקטרוניות הקונבנציונליות, להיפך, נעשות בדרך כלל במרחבי זמן גדולים ומדויקים פחות.

מדידת מתח על ידי טכניקות הדמיה היא, עם זאת, קשה באופן מהותי בשל אופיו של האות עצמו, אשר יכול להשתנות במהירות, בתדירות, ובגודל השינויים פוטנציאל הממברנה. חיישן מתח אידיאלי צריך לשלב היענות מהירה, רגישות גבוהה, פליטת פוטון גבוהה. עבור רוב GEVIs מבוססי FRET, שינויים היחס להשתנות כפונקציה של וריאציות מתח קרום, אבל משרעת השינויים הקרינה יחס קשורה קשר הדוק עם משך האירועים depolarization. לאחרונה פותחו ומאופיינים GEVIs חדשים, המאפשרים לבחור את החללית הטובה ביותר ביחס לסוג הבעיה, המודל ומכשיר ההדמיה.

מתח biosensors הם חלבונים ממברנה אינטגרלי. כאשר transfected לתוך תאים בתרבית או להביע(D) באורגניזמים חיים, הקרינה של החיישן הממוקד בקרום הפלסמה תהיה קשורה במידה מסוימת לפלואורסצנציה של החיישן בתאים תאיים אחרים - שבהם החלבון יכול להיות מוטעה או מצטבר - ובכך יוצר אות רקע. רמת הביטוי ואת לוקליזציה הממברנה הנכון של כל מבנה צריך להיות פיקוח על מודלים ניסיוניים פשוטים ( כלומר, transfecting שורות תאים או תרבויות העיקרי) לפני השימוש biosensors באורגניזמים חיים.

בשנת ההתקנה הניסוי הנוכחי, צעד קריטי פוטנציאלי נוסף של הפרוטוקול עשוי להיות מיוצג על ידי היעילות של הליך transgenesis. במידת הצורך, אחוז של תאים חיוביים פלסמיד ניתן להגדיל באופן דרסטי על ידי העסקת מערכת transposon Tol2 12 . היבט חיוני נוסף שצריך לשקול הוא אובדן פליטת הקרינה ב fluorophore התורם ואת ההפסד ב SIG FRIGNal מתרחשת במהלך הפגישה הדמיה בגלל תאורה אינטנסיבית. זה צריך להימנע על ידי מזעור הארה של המדגם, הפחתת כוחו של קו לייזר בשימוש. באופן דומה, את הרווח ואת היסט של photomultipliers חייב להיות מכוון היטב בתחילת כל מפגש הקלטה כדי להשיג את הטוב ביותר יחס אות לרעש בתמונות שנרכשו וכן כדי למנוע פיקסלים רוויים. כל הפרמטרים הללו יכולים להשתנות בהתאם לסוג התא שנבדק, המאפיינים של biosensor, ואת המכשירים המשמשים לרכישת תמונות (שדה רחב מיקרוסקופ פלואורסצנטי ניתן להשתמש גם, כפי שתואר לאחרונה 13 ). החוקר צריך תמיד לשקול, עם זאת, כי במהלך ההדמיה vivo , רמת הרעש עלול להפריע האות הספציפי של החיישן יותר מאשר בהקלטות חוץ גופית . לבסוף, אם זמין, מדידות בקרה באמצעות בדיקות מוטציה, אשר אינם מגיבים למתח, תהיה דרך נוחהכדי להעריך את הרמה של רעש ספציפי למערכת ו / או חפצים.

התעסוקה של עוברי דג הזברה מייצג מאפיין מפתח של גישה זו בזכות התגובה שלהם למניפולציה גנטית חקירה מיקרוסקופית. למעשה, מאפיינים אלה להפוך transgenesis חולף וניתוח מבוסס FRET של תכונות חשמליות נוירונים ריאלי. לדעתנו, עם האמרגן המתאים ביותר ושילוב biosensor, זה יהיה אפשרי ניתן באופן סלקטיבי לנתח את הפעילות החשמלית של כל סוג התא של עניין במקביל פעילות כזו עם פנוטיפ עוברי.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Biosensing מוטורית נוירון פוטנציאל ממברנה עוברי דג הזברה חיים
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter