Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Gestroomlijnd eencellige TCR isolatie en generatie van retrovirale vectoren voor In Vitro en In Vivo expressie van menselijke TCRs

doi: 10.3791/55379 Published: September 10, 2017

Summary

De huidige protocol combineert eencellige gekoppeld menselijke TCR alpha en beta keten sequencing met gestroomlijnd generatie van retrovirale vectoren compatibel met in vitro en in vivo TCR expressie.

Abstract

Hoewel verschillende methoden voor het rangschikken van gepaarde T-cel receptor (TCR) Alfa en bèta ketens uit één T cellen hebben ontwikkeld, zijn geen tot nu toe bevorderlijk voor downstream in vivo functionele analyse van TCR heterodimers. We hebben een verbeterde protocol op basis van een tweestaps multiplex-genest PCR, wat resulteert in een PCR product dat omspant de hele variabele regio's van een menselijke TCR Alfa en bèta ketens ontwikkeld. Door het unieke beperkingsplaatsen identificeren en hen op te nemen in de PCR inleidingen, hebben we het PCR product compatibel gemaakt met directe sub-kloont in de sjabloon retrovirale vector. De resulterende retrovirale construct codeert een chimeer mens/muis TCR met een muis intracellulaire domein, die functioneel in muis cellen of in vivo Muismodellen. Over het algemeen combineert het protocol hier beschreven menselijke eencellige gekoppeld TCR Alfa en beta keten identificatie met gestroomlijnde generatie van retrovirale vectoren gemakkelijk aanpasbaar voor in vitro en in vivo TCR expressie. De video en het begeleidende materiaal zijn ontworpen om een zeer gedetailleerde beschrijving van de eencellige PCR, zodat de kritische stappen gevolgd en potentiële valkuilen vermijden worden kunnen. Daarnaast bieden wij een gedetailleerde beschrijving van de klonen stappen die nodig zijn voor het genereren van de expressie-vector. Eenmaal onder de knie, kon de hele werkwijze vanaf één cel Sorteren op expressie van de TCR worden uitgevoerd in een korte periode van twee weken.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De T-cel receptor (TCR) dicteert T Celgedrag tijdens ontwikkeling, steady-state/homeostase en antigene stimulatie in de periferie1,2,3. Recente uitbreiding van diepe sequencing technologieën heeft ontdekt een eerder ondergewaardeerde TCR diversiteit binnen antigeen specifieke T cel reacties. TCR diversiteit suggereert een potentieel voor functioneel brede T cel reacties. Teneinde de TCR sequentieanalyse repertoire met TCR functionele testen, moeten de sequencing-benaderingen worden ontworpen om verenigbaar met experimentele systemen en in vivo modellen gebruikt voor latere functionele analyse van select TCRs. We hebben een efficiënte aanpak voor menselijke TCR volgorde isolatie ontwikkeld en gestroomlijnd sub-kloont in een chimeer mens/muis TCR sjabloon vector compatibel met TCR expressie in HLA-gehumaniseerd muizen4. Isolatie van overeenkomstige Alfa en bèta ketens van heterodimeric TCRs vereist PCR versterking van beide ketens van een enkele cel. Hoewel verscheidene eencellige TCR klonen protocollen zijn ontwikkeld en gebruikt, zijn geen tot nu toe gemakkelijk compatibel met high-throughput gestroomlijnde directe klonen van onbekende Vα/Vβ TCRs in retrovirale vectoren nodig voor opnieuw uitdrukking in vivo 4,5,6,7. Eerdere studies hebben gebruikt twee belangrijke benaderingen, hetzij om selectief versterken een beperkt gedeelte van de TCR voldoende te extrapoleren de volgorde of te versterken van de gehele TCR reeks4,5,6 , 7. downstream functionele analyse van TCR sequenties verkregen via de eerste benadering vereist kostbaar in silico vergadering en DOVO bouw van de TCR. Terwijl de tweede benadering de volledige sequentie van de TCR biedt, is de menselijke constante regio niet compatibel met in vivo uitdrukking van de gekloonde TCRs in muismodellen. Onze aanpak is speciaal ontworpen om compatibel met in vivo functionele analyse van TCRs in muismodellen. We ontwikkelden een efficiënte en gestroomlijnde eencellige PCR protocol dat zorgt voor directe sub klonen van PCR fragmenten in de sjabloon expressie vector.

Onze aanpak maakt gebruik van een hooggevoelige multiplex-genest PCR-reactie die is uitgevoerd in twee stappen. In de eerste reactie van de multiplex stap een zwembad van 40 primers specifiek voor alle V-beta-ketens en een zwembad van 44 primers specifiek voor alle de V-alpha-ketens worden gebruikt voor het versterken van de TCR-alpha of TCR-beta zonder de voorkennis van de reeks (tabel 1). De voorwaartse primer heeft een adapter-reeks, die is opgenomen in de 5' van het PCR-product. De omgekeerde primer is gebaseerd op de constante regio van de TCR. We hebben geconstateerd dat unieke beperkingsplaatsen die afwezig uit menselijke variabele of junction TCR gebieden en verwerkt deze in nieuw ontworpen TCRα en TCRβ inleidingen (Figuur 1). In de tweede geneste reactie, worden een primers specifiek voor de opeenvolging van de adapter en een geneste omgekeerde primer binnen de constante regio gebruikt voor het verder versterken van de TCR kettingen met hogere specificiteit (tabel 1, Figuur 1). Na enkele cel isolatie, twee rondes van PCR (eerste reactie met een pool van zowel Vα als Vβ inleidingen, en ten tweede met adapter inleidingen) resulteren in een PCR product dat kan worden direct sub gekloond in de sjabloon retrovirale vector. De uiteindelijke constructie van de TCR codeert, in een enkele open leesraam (ORF), menselijke variabele regio's gecombineerd met muis constant regio's verbonden via het 'zelf verbrijzelen' eiwit sequentie, P2A (hVα-mCα-P2A-hVβ-mCβ)8. De volgorde van P2A is gebruikt in meerdere systemen, en is uitgebreid getest speciaal voor de expressie van TCRs8,9,10,11. Hoewel, na vertaling allermeest naar de P2A volgorde blijft gekoppeld aan de C-terminus van de alpha keten verbonden door een flexibele linker, terwijl de bèta keten signaal reeks een extra proline, deze wijziging heeft heeft geen nadelig effect op de TCR functie. De muis constant regio wordt gebruikt in de constructie in plaats van de mens om te voorkomen dat eventuele gewijzigde interacties met stroomafwaartse signalering onderdelen wanneer opnieuw uitgedrukt in muis cellen. De één ORF zal resulteren in stoichiometrische aparte expressie van Alfa en bèta ketens9,11. Het huidige protocol is gebaseerd op de reagentia en benaderingen die wijd beschikbaar zijn, en is ontworpen om te worden uitgevoerd in een gestroomlijnde en efficiënte manier. Hoewel we specifiek deze techniek gebruikt hebben om te TCRs uit zelfontledende T cellen betrokken bij auto-immuunziekte diabetes assay, verwachten wij dat dit protocol kan zijn breed toepasbaar voor identificatie en beoordeling van de functionele van menselijke TCRs specifiek voor auto-immune epitopes, kanker epitopes of reacties op pathogenen en vaccins.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identificeren van de T-celpopulatie belangenverstrengeling.

Opmerking: antigeen specifieke proliferatie in combinatie met celdeling kleurstof (zoals Carboxyfluorescein succinimidyl ester, CFSE) kan worden gebruikt voor het isoleren van T-cellen op basis van hun verspreiding in reactie op antigene stimulatie. Als vanaf PBMCs, een 7-daagse in vitro uitbreiding moet voldoende zijn om te identificeren van een antigeen specifieke CFSE dunbevolkte 12.

  1. Mix PBMCs 1:1 met MHC-matched feeder cellen, en label met 5 µM CFSE celdeling kleurstof.
  2. Plaat 2-2.5 x 10 5 cellen per putje in een 96-Wells ronde-bodem plaat in 200 µL 10% FCS volledige RPMI media cultuur.
    Opmerking: Complete RPMI bevat 2 mM l-glutamine, 1 mM natrium pyruvaat, 100 µM MEM niet-essentiële aminozuren, 5 mM HEPES, 5.5 × 10 − 5 eenheden van 2-mercaptoethanol, 100 U mL − 1 penicilline en 100 µg mL − 1 streptomycine.
  3. Cellen met 25 µM peptide-antigeen stimuleren.
  4. Op de vierde dag van cultuur, zorgvuldig verwijderen en vervangen van 100 µL van media.
    Opmerking: Een meer optimale aanpak voor antigeen-specifieke T cel identificatie is het gebruik van peptide-HLA tetramers 13. Tetrameer kleuring zorgt voor de gelijktijdige evaluatie van antigeen specificiteit, evenals HLA-beperking.

2. De soort eencellige.

  1. Voer alle procedures in een kap of een daarvoor aangewezen gedeelte gratis van versterkte sjabloon. Aliquot de reagentia te voorkomen, schoon alle oppervlakken van het werk en, indien mogelijk, apparatuur met 10% bleekwater voorafgaand aan PCR setup. Gebruik filter tips, RNAse en DNAse gratis reagentia en kunststoffen in alle PCR en vector stappen klonen. Belangrijkste reagentia kunnen worden gevonden in de Tabel of Materials.
    Opmerking: De multiplex PCR reactie is hoogst-gevoelig, en lage niveaus van besmetting kunnen leiden tot versterkte product.
  2. Genereren de master mix van omgekeerde transcriptie door het combineren van 10 x RT reactie buffer, 25 X DNTPs, 9 U RT enzym, 0,01% Triton-X, 0.7 U RNAse remmer, en 383 nM voor elke primer van de RT-TCR (vermeld in tabel 1) in een steriele pipetting reservoir. Voor elke 96-wells-plaat, make-up genoeg master mix voor 10 extra Reacties (totaal 106), om verlies te compenseren van vloeistof tijdens pipetteren. Zie tabel 2 voor reactie componenten en bedragen per putje.
  3. Voorbereiden een 96-Wells PCR collectie plaat voor cel Sorteren op pipetting 6 µL van de omgekeerde transcriptie master mix per putje met een meerkanaalspipet. Houd de plaat op het ijs of in een koud blok.
  4. Label cellen met antilichamen tegen cel oppervlakte gegevensmarkeringen (bijvoorbeeld in CD4 en CD3, of CD8 en CD3, elk op 2 µg/mL, in combinatie met celdeling kleurstof of tetrameer kleuring).
  5. Sorteren T cellen in één cel per putje, de twaalfde rij, die als een negatieve besturingselement dienen zal skipping.
    Opmerking: De efficiëntie van de soort zal afhangen van nauwkeurige collectie uitlijning van de plaat in de houder plaat, evenals het behoud van de cellen en de platen bij een lage temperatuur voorafgaand aan cDNA reactie. Collectie platen moeten worden gehouden op het ijs te allen tijde, behalve bij het sorteren, wanneer ze worden opgelost binnen de koeling plaat. Niet alle sorteerders zijn uitgerust met een temperatuur gereglementeerde plaat houder; echter is het gebruik van een sterk aanbevolen. Aangezien de soort in het algemeen ongeveer 10-15 min per plaat duurt, is er een toegenomen potentieel voor aantasting van het RNA als de plaat niet wordt gehandhaafd op een lage temperatuur.
  6. Als positieve controle, een groter aantal cellen (100 cellen) handmatig met een pipet op een van de putten in dit stadium toevoegt. U kunt ook eerder geïsoleerde RNA van gegroepeerde cellen kan worden gebruikt als positieve controle op 10 ng per putje.
    Opmerking: Pipetteer gezuiverde controle RNA met precisie en zorg om kruisbesmetting van andere wells en vals-positieve resultaten voorkomen.
  7. Zegel van de plaat met kleeffilm, en spin down bij 1000 x g gedurende 5 min bij 4 ° C.
  8. Onmiddellijk transcriberen RNA aan cDNA door het broeden van de plaat bij 25 ° C gedurende 10 min, 45 min, 37 ° C en 85 ° C gedurende 10 minuten
    Opmerking: Om ervoor te zorgen efficiënte PCR reactie, is het aanbevolen dat de eerste PCR reactie dezelfde dag worden uitgevoerd. U kunt ook de getranscribeerde platen kunnen worden bewaard in-80 ° C voor maximaal 2 maanden.

3. Uitvoeren van multiplex-genest PCR

Opmerking: bereiden van alle master mixen in een schone sjabloon-vrije zone om verontreiniging te voorkomen.

  1. Reconstrueren elke variabele regio primer aan 100 µM met DNAse en RNAse gratis H 2 O. Vervolgens combineren 20 µL van elk van de 44 inleidingen voor het genereren van het V-alpha primer zwembad. Voor het genereren van de V-beta primer zwembad combineren 20 µL van elk van de 40 V-beta inleidingen plus 80 µL van DNAse en RNAse gratis H 2 O. Primer sequenties zijn vermeld in tabel 1. Zodra gebundeld, de concentratie van elke primer in de mix is 2.3 µM.
  2. Reconstrueren de constante regio inleidingen tot 100 µM-stockoplossing met DNAse en RNAse gratis H 2 O. Dilute de constante regio inleidingen te 10 µM werkoplossing aliquot voor gebruik.
  3. Bereiden twee aparte master mixen voor TCR-Alfa en TCR-beta versterking. Genereren van de master mixen door de combinatie van 5 X buffer, 80 µM dNTPs, 3% DMSO, 2 µM primer zwembad (eindconcentratie van 46 nM voor elke primer), 200 nM TCR-constante regio omgekeerde primer, 1 U DNA-polymerase, en DNAse en RNAse gratis H 2 O (tabel 2 < / strong >). Voor elke 96-wells-plaat, make-up genoeg master mix voor 10 extra Reacties (totaal 106), ter compensatie voor het verlies van vloeistof tijdens pipetteren.
    Opmerking: De berekeningen zijn gebaseerd op het uiteindelijke volume van de PCR van 25 µL per putje, waar 22.5 µL master PCR mix wordt gecombineerd met 2,5 µL cDNA sjabloon.
  4. Houden de plaat met cDNA op ijs of in een koud blok. Hiermee kunt u dat een multichannel Pipetteer 22.5 µL van TCR-beta reactie in een nieuwe 96-Wells PCR plaat. Gebruik vervolgens een meerkanaals 2.5 µL van cDNA overbrengen naar de plaat PCR.
  5. Een meerkanaals kunt Pipetteer 22.5 µL van TCR-alpha reactie rechtstreeks in de plaat met de rest van de cDNA.
  6. Zegel van de platen met lijm, zachtjes vortex, en spin naar beneden bij 1000 x g gedurende 5 min bij 4 ° C.
  7. De multiplex PCR reactie worden uitgevoerd met de volgende cycli: 5 min bij 95 ° C gevolgd door 34 cycli van 20 bij 95 ° C, 30 s s op 54 ° C en 1 min bij 72 ° C, gevolgd door 7 minuten op 72 ° C.
  8. Carry uit de geneste PCR-reactie in een eindvolume van 25 µL, 2.5 µL van het multiplex PCR mengsel als sjabloon gebruiken.
    1. Reconstrueren van de interne en adapter inleidingen tot 100 µM met DNAse en RNAse gratis H 2 O. maken 10 µM aliquots voor de werkende voorraad.
    2. Voorbereiden TCR-Alfa en TCR-beta ampl twee aparte master mixenification. Mix 5 X buffer, 25 X DNTP, 3% DMSO, 200 nM voorwaartse adapter primer, 200 nM omgekeerde geneste primer, 1 U DNA-polymerase, en DNA-polymerase en nuclease-vrije H 2 O voor een eindvolume van 22,5 µL (tabel 2). Voor elke 96-wells-plaat, make-up genoeg master mix voor 10 extra Reacties (totaal 106), om verlies te compenseren van vloeistof tijdens pipetteren.
      Opmerking: In het tweede PCR reactie gebruik de 5 X PCR van de buffer met laden kleurstof om agarose gel laden.
    3. De meester mixen voor de TCR-Alfa en TCR-beta reacties op 22,5 µL per putje in twee nieuwe 96-Wells-PCR platen met behulp van een meerkanaals, Pipetteer.
    4. De multiplex PCR reactie sjabloon toevoegen op 2,5 µL per putje.
      Opmerking: De resterende eerste PCR reactie moet worden verzegeld en opgeslagen bij-20 ° C om te dienen als een bron van extra sjabloon, als het noodzakelijk wordt (Zie stap 4.3 Opmerking).
    5. Zegel de platen, zachtjes vortex, en spin down bij 1000 x g gedurende 5 min bij 4 ° C.
    6. De geneste PCR reactie worden uitgevoerd met de volgende cycli: 5 min bij 95 ° C gevolgd door 34 cycli van 20 bij 95 ° C, 30 s bij 56 ° C s en 1 min bij 72 ° C, gevolgd door 7 minuten op 72 ° C.
    7. Run 5 µL van de uiteindelijke reactie uit op een 1% agarose gel met ethidiumbromide (met inbegrip van de negatieve en positieve controles putten).
      Opmerking: De verwachte band moet worden uitgevoerd op ongeveer 500 bp grootte. Een voorbeeld-reactie is afgebeeld in Figuur 2.
    8. Zuiveren van de rest van de tweede reactie (20 µL) met behulp van een 96-Wells-indeling PCR zuivering kit Elueer met 15 µL van 70 ° C H 2 O per putje en uitvoeren van Sanger sequencing. Gebruik de juiste TCR-alpha of TCR-beta adapter voorwaartse primer voor sequencing (tabel 1).
      Opmerking: Sequenties kunnen worden geanalyseerd met software online beschikbaar Immunogenetica.

4. Alfa en bèta ketens van PCR sub-kloont.

Opmerking: de pool van de voorwaartse primers gebruikt in de eerste reactie, en de omgekeerde inleidingen in de tweede PCR reactie worden gebruikt om op te nemen beperkingsplaatsen. Dus, de verkregen Alfa en beta keten PCR producten zijn klaar om te worden opeenvolgend sub gekloonde in de sjabloon retrovirale vector ( Figuur 1).

  1. Digest de gezuiverde PCR producten vanuit naar de beta genest reactie met BstbI en MfeI (tabel 3).
    Opmerking: Niet meer dan 5 µg invoegen.
  2. Parallel, verteren de sjabloon vector met BstbI en MfeI (tabel 3). Gebruik de sjabloon vector per TCR µg 1-2. De verteerd vector worden uitgevoerd op een agarose gel en isoleren van de grotere band (~ 7500 bp). Zuiveren van de vector met een gel DNA zuivering kit.
    Opmerking: Tijdens de restrictie-enzym digest, lymfkliertest TCR-beta variabele gebied van de sjabloon wordt verwijderd, rekening houdend met de toevoeging van de menselijke TCR-beta variabele regio.
  3. Zuiveren het verteerd PCR producten met behulp van een PCR zuivering kit.
    Opmerking: Controleer of de capaciteit van de zuivering DNA van de kolommen in de kit; Gebruik meerdere kolommen indien nodig. Het minimumbedrag voor een gezuiverde invoegen die nodig zijn voor een succesvolle afbinding reactie is 50 ng bij een minimumconcentratie van 10 ng/µL. Als het bedrag van de gezuiverde invoegen niet voldoende voor een succesvolle Afbinding is, de tweede PCR reactie kan worden herhaald.
  4. Behandeling van de sjabloon vector met 10 U CIP enzym gedurende 1 uur bij 37 ° C om te voorkomen dat de zelf-Afbinding, gevolgd door warmte inactivatie voor 10 min op 75 ° C. zuiveren het DNA met PCR zuivering kit (tabel 3).
  5. Ligate TCR-beta invoegen en vector DNA ligase met een totaal volume van 20 µL op 6 molaire overmaat van het donormateriaal gedurende 30 minuten bij kamertemperatuur.
    Opmerking: In totaal, de afbinding reactie moet bevatten ongeveer 150 ng van DNA (tabel 3).
  6. Voor transformaties, meng 8 µL van de afbinding reactie met 80 µL van chemisch bevoegde E.coli DH5α cellen (Tabel van materialen) en incubeer op ijs voor 30 min. warmte schok bij 42 ° C gedurende 45 s. toevoegen 500 µL Super Optimale bouillon met omzettingsproducten onderdrukking (S.O.C.) medium en schud gedurende 1,5 uur op 37 ° C.
  7. Plaat uit 250 µL van bacteriële cultuur op een ampicilline met lysogenie Bouillon (LB) agarplaat. De plaat 's nachts (~ 16 h) Incubeer bij 37 ° C.
  8. De volgende dag Kies bacteriële kolonies, en ze opgroeien in 3 mL LB opslagmedium met ampicilline 's nachts. Isoleren van de plasmide-DNA met behulp van DNA plasmide zuivering kit.
  9. Bevestigen de succesvolle invoeging van de bèta keten door een kleine test-digest met de enzymen van de beperking BstbI en MfeI. Combineren in een 12 µL totale reactie volume, 200-500 µg plasmide DNA, 0,25 µL van elk enzym en 10 X enzym buffer (tabel 3). De reactie die worden uitgevoerd op een 1% agarose gel met ethidiumbromide om te bevestigen de grootte van de band invoegen (~ 500 bp).
  10. Na de bevestiging van de aanwezigheid van de insert, het volgnummer van de TCR-bèta-sectie van de vector met behulp van de IRES omgekeerde primer (tabel 1).
  11. Na de bevestiging van de sequentie van de insert TCR-bèta, het uitvoeren van een soortgelijk proces voor het inbrengen van de alpha variabele regio. Verteren de gezuiverde PCR producten van de reactie van de alpha geneste, en de nieuw gegenereerde TCR-beta invoegen met vector, met SnaBI en SacII.
    Opmerking: Tijdens de restrictie-enzym digest, lymfkliertest TCR-alpha variabele gebied van de sjabloon wordt verwijderd, rekening houdend met de toevoeging van de menselijke TCR-alpha variabele regio.
  12. Ligate alpha TCR vectoren codering van de bijbehorende bèta variabele regio met behulp van DNA-ligase in een totaal volume van 20 µL op 6 molaire overmaat van het donormateriaal gedurende 30 minuten bij kamertemperatuur ingevoegd.
    Opmerking: In totaal, de afbinding reactie moet bevatten ongeveer 150 ng van DNA (tabel 3).
  13. Voor transformaties, meng 8 µL van de afbinding reactie met 80 µL van chemisch bevoegde E.coli DH5α cellen (Tabel van materialen) en incubeer op ijs voor 30 min. warmte schok bij 42 ° C gedurende 45 s. toevoegen 500 µL S.O.C. middellange en schud gedurende 1,5 uur op 37 ° C.
  14. Plaat uit 250 µL van bacteriële cultuur op een ampicilline met lysogenie Bouillon (LB) agarplaat. De plaat 's nachts (~ 16 h) Incubeer bij 37 ° C.
  15. De volgende dag Kies bacteriële kolonies, en ze opgroeien in 3 mL LB opslagmedium met ampicilline 's nachts. Isoleren van de plasmide-DNA met behulp van DNA plasmide zuivering kit.
  16. Bevestigen de succesvolle invoeging van de alpha keten door een kleine test-digest met de enzymen van de beperking SnaBI en SacII. In een 12 µL totale reactie volume combineren 200-500 µg plasmide DNA, 0,25 µL van elk enzym en 10 x enzym buffer (tabel 3). De reactie die worden uitgevoerd op een 1% agarose gel met ethidiumbromide om te bevestigen de grootte van de band invoegen (~ 500 bp).
  17. Na de bevestiging van de aanwezigheid van de insert, het volgnummer van de TCR-alpha-sectie van de vector met behulp van de MSCV2-forward primer (tabel 1).
  18. Nadat de volgorde van Alfa keten is gevalideerd, controleert u of de volledige TCR invoegen door sequentiebepaling van TCR-bèta-reverse en IRES-reverse primer (tabel 1).

5. Controleer of TCR cel oppervlakte expressie en specificiteit.

Opmerking: HEK293T cellen worden gebruikt voor het testen van succesvolle TCR keten paring en cel oppervlakte expressie ( figuur 3A) 8. Peptide-MHC tetrameer kleuring kan ook worden uitgevoerd op de transfected cellen van de HEK293T om te testen voor het bewaren van antigene specificiteit post TCR gene isolatie ( figuur 3B).

  1. Plaat HEK293T cellen in 12-well weefselkweek platen op 1 x 10 5 cellen per putje in 1 mL volledige DMEM media met 5% FCS en cultuur 's nachts op 37 ° C. plaat uit voldoende cellen aan te wijzen voor elke nieuwe TCR aparte putten , besturingselement sjabloon TCR vector, CD3 vector alleen, controle Nou TCR vector alleen, en een niet-transfected.
    Opmerking: Transfectie met een volledig muis sjabloon TCR vector (mTCR-pMIA) in combinatie met mCD3εγδζ-pMIG vector, mTCR-pMIA vector alleen, en mCD3εγδζ-pMIG vector alleen worden gebruikt als de positieve en negatieve controles.
    Opmerking: Complete DMEM bevat 2 mM L-glutamine, 1 mM natrium pyruvaat, 100 µM niet-essentiële aminozuren, 5 mM HEPES-buffer, 5.5 x 10 -5 eenheden van 2-mercaptoethanol, 100 U/ml penicilline/streptomycine.
  2. De volgende dag, de cellen met 1 µg chimeer h/mTCR-pMIA vector, 1 µg muis GFP-pMSCVII-CD3εγδζ (pMIG) vector en een liposoom gebaseerde transfectiereagens instructies van de fabrikant transfect.
  3. Voor elke TCR, 6 µL transfectiereagens aan 100 µL kamertemperatuur, serumvrij DMEM toevoegen. Kort vortex, en Incubeer bij kamertemperatuur gedurende 15 minuten
  4. In aparte 1,5 mL buizen combineren 1 µg van TCR-pMIA vector met 1 µg muis GFP-pMSCVII-CD3εγδζ (pMIG) vector of 1 µg voor elke afzonderlijke voor besturingselementen vector.
  5. Dropwise, de transfectie reagens/DMEM oplossing aan de buizen met de vector DNA toevoegen. Incubeer bij kamertemperatuur gedurende 15 minuten
  6. Dropwise, voeg de transfectie reagens/DMEM/DNA oplossing aan de HEK293T cellen. Tik zachtjes op de plaat te mengen. Incubeer bij 37 ° C gedurende 24 h.
  7. Na 24 h vervangen de media, en houden van de cellen in cultuur voor extra 24 h.
  8. Verwijderen van cellen uit de plaat door krachtig pipetteren en vlekken van de cellen met anti-muis CD3 antilichaam (2,5 µg/mL) om te controleren oppervlakte uitdrukking van de chimeer-TCR stroom cytometry.
  9. Te vergelijken CD3 expressie tussen cellen transfected waren tot een vergelijkbaar niveau, gate de analyse van de cellen, uiting geven aan een vergelijkbaar hoog niveau van fluorescerende verslaggever moleculen (GFP voor CD3 complexe en Ametrine voor TCR expressie vector). Optimaal, moet de analyse worden gated op GFP + Ametrine + cellen binnen 10 4 tot en met 10-5 en TL-intensiteit ( figuur 3A).
    Opmerking: Het niveau van CD3 expressie in cellen transfected met de chimeer constructie moet vergelijkbaar zijn met de controle muis (oorspronkelijke sjabloon) vector ( figuur 3A). De gegenereerde TCR retrovirale vectoren zijn compatibel met in vivo expressiesystemen als eerder beschreven 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

De efficiëntie van de multiplex-genest PCR reactie wordt gecontroleerd in stap 3.2.7 (Figuur 2) door het 5µL van de tweede reactie op een agarose gel opraakt. Gemiddeld de efficiëntie van TCR-beta versterking naar verwachting ongeveer 80%, terwijl de efficiency van de reactie van de TCR-alpha meestal lager, op ongeveer 50 is %4. Alleen gekoppelde TCR-alpha en TCR-bèta ketens kunnen worden gebruikt voor de TCR expressie; alle PCR producten kunnen echter worden sequenced TCR volgorde en repertoire informatie.

Gene zwijgen kan slechts één TCR-bèta keten moet worden uitgedrukt in een bepaalde T-cel. Echter een T-cel is in staat het herschikken van een tweede TCR-alpha-keten, en uiten van een tweede in-frame TCR-alpha ketting 14ongeveer 25% van T cellen zal. Verwacht wordt dat een deel van de geïsoleerde TCR-alpha-ketens de secundaire alpha in plaats van de "juiste" alpha ketting zullen. De secundaire Alfa keten is vaak niet een optimale bindende partner met de TCR-bèta keten; Bijgevolg wordt verwacht dat niet alle gekloonde TCRs een stabiel complexe en uitdrukkelijke op celoppervlak vormen zullen. Daarom de juiste TCR keten in paren rangschikken en cel oppervlakte uitdrukking heeft bevestigd te worden door de transfecting van de HEK293T cellen (figuur 3A).

Figure 1
Figuur 1 . Gestroomlijnde multiplex-genest PCR en retrovirale construct ontwikkeling van enkele T-cellen. Twee rondes van PCR leiden tot versterking van overeenkomstige TCR Alfa en beta-ketens. Beperkingsplaatsen ingebed in de inleidingen toestaan gestroomlijnde sub-kloont en generatie van mens/muis chimeer vector voor expressie in muis cellen. De sjabloon muis vector kan worden gebruikt om gemakkelijk overschakelen op variabele muis regio's voor de mens, het genereren van een chimeer mens/muis TCR retrovirale vector compatibel met expressie in muis cellen. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 . Voorbeeld van eencellige PCR. Geneste PCR versterking van T-cel receptor bèta en alpha ketens van enige menselijke T cellen gesorteerd in een 96-wells-plaat multiplex. Ziet u een overeenkomstige (boven- en onderkant) PCR producten van eencellige versterkte TCR beta en Alfa ketens van de TCR van menselijke PBMCs. NC - geen sjabloon controle, PC - positieve controle. Door een klein deel van de reactie op een agarose gel (5 µL), wordt de efficiëntie van de eencellige Alfa en beta PCR kettingreacties bevestigd vóór PCR product sequencing. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 . Verificatie van cel oppervlakte chimeer TCR expressie en specificiteit. (A) HEK293T cel zijn transfected met muis TCR of een mens/muis chimeer TCR in combinatie met muis CD3εγδζ. Cellen oppervlakte TCR expressie werd gemeten met anti-mCD3ε antistof. Gating strategie: ten eerste de analyse is gated op Ametrine en GFP dubbele positieve cellen (G2). In het geval van enkele vector besturingselementen moet de gating worden gebaseerd op de interne fluorescentie (G1). Ten tweede, de cellen van de G1 en G2 worden geanalyseerd op het niveau van expressie van het CD3ε. (B) TCR specificiteit wordt bevestigd door tetrameer kleuring van 293T cellen met DRB1 * 0401:GAD115-127 tetrameer. Analyse is omheinde op GFP + Ametrine + CD3ε + cellen, zoals in (A). Klik hier voor een grotere versie van dit cijfer.

DOEL-GEN PRIMER ORIËNTATIE VOLGORDE
Omgekeerde transcriptie
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR Alfa PCR reactie 1
TRAV1-1 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC externe Omgekeerde CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR reactie 1 TRBV2 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Voorwaarts CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC externe Omgekeerde GTGGCCAGGCACACCAGTGTG TCR Alfa PCR reactie 2 TRAC interne Omgekeerde CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV adapter Voorwaarts CGGTTCAGCAGGAATGCCtacgtaATG TCR bèta PCR reactie 2 TRBC interne Omgekeerde CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV adapter Voorwaarts CAGAAGACGGCATACGAGATcaattgATG Sequencing inleidingen pMSCV-II Voorwaarts CCTCCTCTTCCTCCATCCGCC TCRbeta Omgekeerde GCCAAGCACACGAGGGTAGCC IRES Omgekeerde AACGCACACCGGCCTTATTCC * Kleine letters binnen de primer sequenties geven dat de opgenomen restrictie-enzym gesneden sites

Tabel 1: Reverse transcriptie, PCR en sequencing inleidingen.

Stap 2.2 bedragen per putje
RT-PCR reactie (6μL) (L)
10 x buffer 0.6
2 x dNTP 0,24
10% Triton X 0,06
3 TCR-specifieke primers (10mM ea.) 0,23 ea. (x 3 = 0,69)
Enzym 0.18
RNase remmer 0.28
NF(Nuclease-Free)-H2O 3,95
Stap 3.1
een PCR reactie 1 (25μL) (L) b PCR reactie 1 (25μL) (L)
5 x buffer 5 5 x buffer 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (3%) 0,75
een zwembad (F primer) (2.3μM) 0.3 b poule (F primer) (2.3μM) 0,5
een externe R primer (10uM) 0.6 b externe R primer (10μM) 1
DNA-polymerase 0.2 Ga polymerase Taq 0.2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14.65 NF-H2O 14.05
Stap 3.8
PCR reactie 2 - hetzelfde voor een en b (25μL) (L)
5 x buffer 5
dNTP (10mM) 1
DMSO 0,75
Adapter F primer (10μM) 1
Interne R primer (10μM) 1
DNA-polymerase 0.2
PCR rxn 1 product 2.5
NF-H2O 13.55

Tabel 2. Omgekeerde transcriptie en PCR reacties.

Stap 4.2 en 4.3
TRBV digest reactie (50μL) (L) mTCR-pMIA vector digest (500μL) (L)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x Buffer 5 10 x Buffer 50
H2O H2O
Stap 4.4
CIP reactie (100μL) (L) DNA(~1.5mg)
> Verteerd & gezuiverd vector DNA 84 10 x Buffer 10 CIP-enzym 6 Stap 4.5 Afbinding reactie (20μL) (L) Verteerd/CIPed vector DNA (insert- en vector totaalbedrag is ~ 150ng) Invoegen van DNA (6 molaire toegang tot vector) 2 x Ligase buffer 10 Ligase enzym 1 H2O Stap 4.9 Test Digest reactie (12μL) (L) DNA (100-300ng) 1 MfeI 0,25 BstbI 0,25 10 x Buffer 1.2 H2O 9.3 Stap 4.11 TRAV digest reactie (60μL) (L) Bèta bevattende - mTCR-pMIA vector digest (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x Buffer 6 10 x Buffer 10 H2O H2O

Tabel 3. Vector klonen reacties.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

In het huidige protocol beschrijven we een efficiënte methode voor eencellige TCR versterking en latere sub-kloont van gepaarde TCR Alfa en bèta ketens in een sjabloon retrovirale expressie vector. Hoewel verscheidene eencellige PCR protocollen hebben ontwikkeld, zijn geen tot nu toe compatibel met onmiddellijke sub-kloont in een expressie-vector. In de meeste gevallen wordt een partiële sequentie omvat de zeer variabel CDR3 regio's versterkt, met genoeg opeenvolging te extrapoleren de variabele regio. Deze kleinere grootte van de PCR-product ondersteunt hogere efficiëntie van de PCR, maar vergt DOVO TCR gene synthese voor functionele studies. Het huidige protocol onderhoudt de efficiëntie van de eerder gepubliceerde CDR3-gerichte eencellige TCR sequencing protocollen, terwijl tegelijkertijd de opbrengst van een langere amplicon met de hele variabele regio geschikt voor klonen. Het beschreven systeem heeft dus een grotere flexibiliteit in het geven van een kwantitatieve reeks, evenals functionele output.

Afhankelijk van de wetenschappelijke vraag, kunnen de bron en de specificiteit van T-cellen geanalyseerd variëren. Als het uiteindelijke doel van het project de analyse van de in vivo TCR functie is, is het echter noodzakelijk om te weten de HLA-beperking van geïsoleerde T-cellen. Het huidige protocol heeft specifiek ontworpen om compatibel met in vivo TCR expressie in HLA-gehumaniseerd muizen. Veel van deze muizen zijn gegenereerd en zijn nu commercieel beschikbaar, met inbegrip van HLA-A2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 en HLA - B * 0702 transgene variëteiten. Dit protocol kan met succes worden gecombineerd met de eerder gepubliceerde protocol voor retrovirale gemedieerde beenmerg stamcel expressie van menselijke TCRs4,15,16. We verwachten dat de gehumaniseerd TCR retrogenic systeem toepasselijke en zeer nuttig voor functionele analyse van menselijke TCRs in diverse zullen auto-immuunziekten, kanker en infectieziekten modellen.

De huidige eencellige PCR protocol beschrijft van de kritische stappen en geeft suggesties nodig voor succesvolle versterking van gepaarde TCR-alpha en TCR-bèta-sequenties. De eerste kritieke stap is een tijdige nakoming van cDNA transcriptie en latere eerste ronde van multiplex PCR. Alle betrokken stappen moeten worden uitgevoerd in een tijdige wijze, en alle reagentia en cellen gehouden op ijs ter voorkoming van aantasting van het RNA en cDNA. Ten tweede, omdat het protocol is ontworpen om zeer gevoelig voor lage niveaus van de sjabloon, het is zeer gevoelig voor besmetting. Daarom is het noodzakelijk om te werken in een sjabloon-vrije zone, weg van vergrote PCR producten of TCR vector klonen. Een logeerkamer of kap moet instellen van cDNA en PCR reacties worden gebruikt. Sjabloon van de eerste PCR reactie moet worden toegevoegd in een ander gebied van waar de PCR is ingesteld. Het is raadzaam dat een aparte set aliquoted reagentia voor de eencellige PCR experimenten worden gebruikt.

Dit protocol heeft specifiek geoptimaliseerd met behulp van de reagentia die zijn vermeld in Tabel van materialen, en vervangingen in reagentia vereist aanvullende optimalisatie. De initiële identificatie van antigeen-specifieke cellen kan worden gewijzigd voor het gebruik van peptide-MHC tetramers. Tetrameer kleuring zorgt voor de gelijktijdige evaluatie van antigeen specificiteit, evenals HLA-beperking. Alternatieve methoden voor de opsporing van antigeen reactiviteit, zoals opregulatie van vroege activering markers of afscheiding van inflammatoire cytokinen kunnen worden beschouwd in de afwezigheid van tetrameer reagentia. Dual specificiteit fusion antilichamen specifiek voor een T-cel-antigeen- en IFNγ kunnen bijvoorbeeld worden gecombineerd met magnetische kraal isolatie te verrijken voor antigeen reactieve IFNγ producerende cellen.

Terwijl de constructie van de chimeer mens/muis beschreven in onze protocol zorgt voor compatibiliteit met de muis cellen, is het niveau van de verenigbaarheid ervan met menselijke CD3 complex onbekend. Hoewel het niet officieel getest door ons, hebben anderen aangetoond dat chimeer TCR-constructs met lymfkliertest constante gebieden op het oppervlak van menselijke lymfocyten17kunnen worden uitgedrukt. Dit geeft aan dat lymfkliertest TCR constante regio's interactie met de menselijke CD3 signalering complexe kunnen ondersteunen. Echter als het doel is het geven van de geïdentificeerde TCRs in menselijke primaire cellen of menselijke cellijnen, zoals Jurkat cellen, een meer optimale aanpak mogelijk te gebruiken van een volledig mens construct. Dit kan worden bereikt door het omwisselen van de lymfkliertest constante regio's binnen de vector met menselijke constante regio's.

Als een geïdentificeerde TCR variabele gebied een van de beperkingsplaatsen gebruikt bevat voor het klonen, de TCR moet worden ingevoegd in een shuttle vector en vervolgens gemuteerd met behulp van een site gericht mutagenese kit voor het opwekken van een stille nucleotide verandering binnen de beperking Snijd de site. Een alternatieve benadering is DOVO synthese van de TCR variabele regio van belang als u wilt uitsluiten van de ongewenste beperkingsplaats bewerkt.

De belangrijkste beperking van deze techniek is het onvermogen om te elimineren versterking van secundaire 'cytoplasmatische' alfa ketens. TCR-alpha genen gaan niet door allèlique uitsluiting als TCR-beta genen, dus dat een aanzienlijk deel van de T-cellen een secundaire 'cytoplasmatische' alfa keten14zal uitspreken. Het beschreven PCR protocol alleen resulteert in versterking van één TCR Alfa ketting, maar als de versterkte Alfa keten de 'cytoplasmatische' alfa keten is, die het niet met de versterkte bèta keten koppelen kan. Daarom is het noodzakelijk voor het testen van TCR cel oppervlakte expressie in HEK293T cellen om succesvolle keten in paren rangschikken.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgments

Deze studie werd gefinancierd door JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 PILOT PJ, en de Robert en Janice McNair Foundation.

Wij danken Sandra Pena en Andrene McDonald patiënt aanwerving, Samuel Blum voor technische bijstand, Dr. George Makedonas voor de gave van antilichamen en controle DNA gebruikt voor PCR Optimalisering.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Gestroomlijnd eencellige TCR isolatie en generatie van retrovirale vectoren voor <em>In Vitro </em>en <em>In Vivo</em> expressie van menselijke TCRs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter