Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Strømlinet enkelt celle TCR Isolation og Generation af Retroviral vektorer for In Vitro og In Vivo udtryk for menneskelige TCRs

doi: 10.3791/55379 Published: September 10, 2017

Summary

De nuværende protokol kombinerer enkelt celle parret menneskelige TCR alfa og beta kæde sekventering med strømlinet generation af retroviral vektorer kompatibel med in vitro- og i vivo TCR udtryk.

Abstract

Selv om flere metoder til sekvensering af parret T-celle receptoren (TCR) alpha og beta kæder fra enkelt T celler er blevet udviklet, har ingen hidtil været befordrende for downstream i vivo funktionel analyse af TCR heterodimers. Vi har udviklet en forbedret protokol baseret på en to-trins multiplex-indlejret PCR, hvilket resulterer i et PCR-produkt, der strækker sig over hele variable regioner af en menneskelig TCR alfa og beta kæder. Ved at identificere entydig begrænsning websteder og indarbejde dem i PCR-primere, har vi gjort PCR produkt kompatibelt med direkte sub kloning til skabelon retroviral vektor. Den resulterende retroviral konstruere koder en kimære menneskelige/mus TCR med en mus intracellulære domæne, som er funktionelle i mus celler eller i vivo musemodeller. Samlet set kombinerer protokollen beskrevet her menneskelige enkelt celle parret TCR alfa og beta kæde identifikation med strømlinede generation af retroviral vektorer let kan tilpasses til in vitro- og i vivo TCR udtryk. Videoen og den ledsagende materiale er designet til at give en meget detaljeret beskrivelse af den enkelte celle PCR, således at de kritiske trin kan være fulgt og potentielle faldgruber undgås. Derudover giver vi en detaljeret beskrivelse af de nødvendige til at generere udtryk vektor kloning skridt. Når styr, kunne hele proceduren fra enkelt celle sortering til TCR udtryk udføres i en kort periode på to uger.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

T-celle receptoren (TCR) dikterer T-celle skæbne beslutning under udvikling, steady state/homøostase og antigene stimulation i periferien1,2,3. Seneste udvidelse af dyb sekventering teknologier har afdækket en tidligere underappreciated TCR mangfoldighed inden for antigen specifikke T-celle svar. TCR mangfoldighed antyder et potentiale for funktionelt bred T-celle svar. For at integrere TCR Sekvensanalyse repertoire med TCR funktionelle assays, bør sekventering strategier være udformet til at være kompatibel med eksperimentelle systemer og i vivo modeller udnyttede efterfølgende funktionel analyse af Vælg TCRs. Vi har udviklet en effektiv tilgang til menneskelige TCR sekvens isolation og strømlinet sub kloning til en kimære menneskelige/mus TCR skabelon vektor kompatibel med TCR udtryk i HLA-humaniseret mus4. Isolering af tilsvarende alpha og beta kæder af heterodimerisk TCRs kræver PCR-amplifikation af begge kæder fra en enkelt celle. Selv om flere encellede TCR kloning protokoller er blevet udviklet og udnyttet, har ingen hidtil været let forenelig med høj overførselshastighed strømlinet direkte kloning af ukendt Vα/Vβ TCRs i retroviral vektorer nødvendige for fornyet udtryk in vivo 4,5,6,7. Tidligere undersøgelser har udnyttet to vigtigste tilgange, enten til selektivt forstærke en begrænset del af TCR tilstrækkeligt at ekstrapolere sekvensen, eller til at forstærke den hele TCR sekvens4,5,6 , 7. downstream funktionel analyse af TCR sekvenser opnået via den første tilgang kræver dyre i siliciummangan forsamling og de novo konstruktion af TCR. Mens den anden tilgang giver den komplette TCR sekvens, er den menneskelige konstant region ikke kompatibel med i vivo udtryk af de klonede TCRs i musemodeller. Vores tilgang er specielt designet til at være kompatibel med i vivo funktionel analyse af TCRs i musemodeller. Vi udviklet en effektiv og strømlinet enkelt celle PCR-protokol, der giver mulighed for direkte sub kloning af PCR fragmenter i skabelonen udtryk vektor.

Vores tilgang udnytter en meget følsomme multiplex-indlejret PCR reaktion, der er udført i to trin. I den første multiplex reaktion trin en pulje af 40 primere specifikke for alle V-beta kæder og en pulje af 44 primere specifikke for alle V-alpha kæder er brugt til at forstærke TCR-alpha eller TCR-beta uden forudgående kendskab til sekvensen (tabel 1). Den forreste primer har en adapter sekvens, som er indarbejdet i 5' af PCR-produktet. Den omvendte primer er baseret på konstant regionen af TCR. Vi har identificeret entydig begrænsning websteder, der er fraværende fra menneskelige variabel eller krydset TCR regioner, og indarbejdet disse i nydesignede TCRα og TCRβ primere (figur 1). I den anden indlejrede reaktion bruges en specifik for adapter sekvens primer og en indlejret omvendt primer inden for regionen konstant til at yderligere forstærke TCR kæder med øget specificitet (tabel 1, figur 1). Efter enkelt celle isolation, to runder af PCR (første reaktion med en pulje af både Vα og Vβ primere, og for det andet med adapter primere) resultere i et PCR-produkt, der kan være direkte sub klonet i skabelonen retroviral vektor. Den endelige TCR konstruktion vil indkode, i en enkelt åben behandling ramme (ORF), menneskelige variable regioner kombineret med mouse konstant regioner forbundet med den 'selvstændig cleaving' protein sekvens, P2A (hVα-mCα-P2A-hVβ-mCβ)8. P2A sekvens er blevet brugt i flere systemer, og er blevet grundigt testet specielt til udtryk i TCRs8,9,10,11. Selv efter oversættelse de fleste af P2A sekvens forbliver knyttet til C-terminus af alfa kæden forbundet med en fleksibel linker, mens beta kæde signal sekvensen har en ekstra prolin, denne ændring har nogen skadelig indvirkning på TCR funktion. Regionen mus konstant bruges i konstruktionen i stedet for menneskelige for at undgå potentielle ændrede interaktioner med downstream signaling komponenter når re udtrykt i mus celler. Den eneste ORF vil resultere i støkiometriske separat udtryk for alpha og beta kæder9,11. Den nuværende protokol er baseret på reagenser og tilgange, der er bredt tilgængelige, og er designet til at være udført på en strømlinet og effektiv måde. Selv om vi har specielt brugt denne teknik til analysen TCRs fra self-reactive T celler impliceret i autoimmune diabetes, forventer vi, at denne protokol kan være almindeligt gældende for identifikation og funktionel vurdering af menneskelige TCRs bestemt for autoimmun epitoper, kræft epitoper eller svar til patogener og vacciner.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identificere T-celle population af interesse.

Bemærk: Antigen specifikke spredning i kombination med celledeling farvestof (ligesom Carboxyfluorescein succinimidyl ester, CFSE) kan bruges til at isolere T celler baseret på deres spredning i svar til antigene stimulation. Hvis start fra PBMC, en 7-dages in vitro- udvidelse bør være tilstrækkelige til at identificere en antigen specifikke CFSE lav befolkningen 12.

  1. Mix PBMC 1:1 med MHC-matchede feeder celler, og etiketten med 5 µM CFSE celledeling farvestof.
  2. Plade 2-2,5 x 10 5 celler pr. brønd i en 96-brønd runde-bunden kultur plade i 200 µL 10% FCS komplet RPMI media.
    Bemærk: Komplet RPMI indeholder 2 mM l-glutamin, 1 mM natrium pyruvat, 100 µM MEM uvæsentlige aminosyrer, 5 mM HEPES, 5.5 × 10 − 5 enheder af 2-mercaptoethanol, 100 U mL − 1 penicillin og 100 µg mL − 1 streptomycin.
  3. Stimulere cellerne med 25 µM peptid antigen.
  4. På den fjerde dag i kultur, forsigtigt fjerne og udskifte 100 µL af media.
    Bemærk: En mere optimal tilgang til antigen-specifikke T-celle identifikation er brugen af peptid-HLA tetramers 13. Tetramer farvning muliggør samtidige vurdering af antigen specificitet, samt HLA-restriktion.

2. Oprette enkelt celle form.

  1. Udføre alle procedurer i en hætte eller et udpeget område gratis forstærket skabelon. Alikvot reagenser til at undgå forurening, rense alle arbejdsflader og, hvis muligt, udstyr med 10% blegemiddel før PCR setup. Brug filter tips, RNAse og DNAse gratis reagenser og plast i alle PCR og vektor kloning trin. Centrale reagenser kan findes i Tabel of Materials.
    Bemærk: Multiplex PCR reaktionen er meget følsomme, og lave niveauer for forurening kan resultere i forstærket produkt.
  2. Generer reverse transkription master mix ved at kombinere 10 x RT reaktion buffer, 25 X dNTP'er, 9 U RT enzym, 0,01% Triton-X, 0,7 U RNAse hæmmer, og 383 nM af hver RT-TCR primer (angivet i tabel 1) i en steril pipettering reservoir. For hver 96-brønd plade, gøre op nok master mix for 10 yderligere reaktioner (samlede 106), at kompensere for tab af væske under pipettering. Se tabel 2 for reaktion komponenter og beløb pr. brønd.
  3. Forbered en 96-brønd PCR indsamling plade for celle sortering af pipettering 6 µL af reverse transkription master mix pr. brønd med en multikanalpipette. Holde pladen på is eller en kold blok.
  4. Mærke celler med antistoffer til cellens overflade markører (som CD4 og CD3, eller CD8 og CD3, hver på 2 µg/mL, i kombination med celledeling farvestof eller tetramer farvning).
  5. Slags T-celler på en celle pr. brønd, overspringelse den tolvte række, der skal tjene som en negativ kontrol.
    Bemærk: Effektivitet af slags vil afhænge af nøjagtig indsamling plade justering inden for indehaveren af pladen, samt vedligeholdelse af celler og plader på en lav temperatur før cDNA reaktion. Samling plader skal holdes på is på alle tidspunkter, undtagen under sortering, når de er faste inden for køling pladen. Ikke alle sorteringsanlæg er udstyret med en temperatur reguleret plade holder; dog anbefales et kraftigt. Da slags tager generelt omkring 10-15 min pr. plade, der er en øget potentiale for RNA nedbrydning, hvis pladen ikke er opretholdes ved lav temperatur.
  6. Som positiv kontrol, manuel tilføjelse af et større antal celler (100 celler) med en pipette til en af brøndene på dette stadium. Alternativt, tidligere isoleret RNA fra poolede celler kan bruges som en positiv kontrol på 10 ng pr. brønd.
    Bemærk: Afpipetteres renset kontrol RNA med præcision og omhu for at undgå krydskontaminering af andre brønde og falske positive resultater.
  7. Forsegle pladen med selvklæbende film og spin ned ved 1000 x g i 5 min. ved 4 ° C.
  8. Straks transskribere RNA til cDNA ved at inkubere plade ved 25 ° C i 10 min, 37 ° C i 45 min, og 85 ° C i 10 min.
    Bemærk: For at sikre effektiv PCR reaktion, er det anbefales, at den første PCR reaktionen udføres samme dag. Alternativt, transskriberede pladerne kan opbevares i-80 ° C i op til 2 måneder.

3. Udføre multiplex-indlejret PCR

Bemærk: forberede alle master mix i en ren skabelon-fri område at undgå kontaminering.

  1. Rekonstruere hver variable region primer til 100 µM med DNAse- og RNAse gratis H 2 O. Næste, kombinere 20 µL af hver af de 44 primere til at generere V-alpha primer pool. For at generere V-beta kombinere primer pool 20 µL af hver af de 40 V-beta primere plus 80 µL af DNAse- og RNAse gratis H 2 O. Primer sekvenser er angivet i tabel 1. Når samles, koncentrationen af hver primer i blandingen er 2,3 µM.
  2. Rekonstruere konstant region primere til 100 µM stamopløsning DNAse og RNAse gratis H 2 O. Dilute konstant region primere til 10 µM brugsopløsning og delprøve til brug.
  3. Forberede TCR-alpha og TCR-beta forstærkning to separate master mix. Generere de master mix ved at kombinere 5 X buffer, 80 µM dNTP'er, 3% DMSO, 2 µM primer pool (endelig koncentration af 46 nM for hver primer), 200 nM TCR-konstant region omvendt primer, 1 U DNA polymerase og DNAse- og RNAse gratis H 2 O (tabel 2 < / strong >). For hver 96-brønd plade, fyldes op nok master mix for 10 yderligere reaktioner (samlede 106), for at kompensere for tab af væske under pipettering.
    NOTE: Beregningerne er baseret på den endelige PCR volumen af 25 µL pr. brønd, hvor 22,5 µL master PCR blanding er kombineret med 2,5 µL cDNA skabelon.
  4. Holde pladen med cDNA på is eller en kold blok. Bruge en multikanal til afpipetteres 22,5 µL af TCR-beta reaktion i en ny 96-brønd PCR plade. Brug derefter en multikanal til at overføre 2,5 µL cDNA ind i PCR-plade.
  5. Bruger en multikanal til afpipetteres 22,5 µL af TCR-alpha reaktion direkte ind på den plade, der indeholder den resterende del af cDNA.
  6. Forsegle plader med lim, forsigtigt vortex og spin ned ved 1000 x g i 5 min. ved 4 ° C.
  7. Køre multiplex PCR reaktionen med følgende cykler: 5 min. ved 95 ° C efterfulgt af 34 cyklusser af 20 s ved 95 ° C, 30 s ved 54 ° C og 1 min. ved 72 ° C, efterfulgt af 7 min på 72 ° C.
  8. Bære ud den indlejrede PCR reaktion i en endelige mængden af 25 µL, ved hjælp af 2,5 µL af multiplex PCR-blandingen som skabelon.
    1. Rekonstruere de indre og adapter primere til 100 µM med DNAse- og RNAse gratis H 2 O. gøre 10 µM delprøver for den arbejdende bestand.
    2. Forberede TCR-alpha og TCR-beta ampl to separate master mixverifikationsprogrammet. Mix 5 X buffer, 25 X DNTP, 3% DMSO, 200 nM fremad adapter primer, 200 nM omvendt indlejrede primer, 1 U DNA polymerase, og DNA polymerase og nukleasen-fri H 2 O for en endelige mængden af 22,5 µL (tabel 2). For hver 96-brønd plade, udgør nok master mix for 10 yderligere reaktioner (samlede 106), at kompensere for tab af væske under pipettering.
      Bemærk: I den anden PCR reaktion brug 5 X PCR buffer indeholdende lastning farvestof til at lette agarosegel lastning.
    3. Med en multikanal, afpipetteres master blander til TCR-alpha og TCR-beta reaktioner på 22,5 µL pr. brønd i to nye 96-brønd PCR plader.
    4. Tilføje skabelonen multiplex PCR reaktion på 2,5 µL pr. brønd.
      Bemærk: Den resterende første PCR reaktion skal være forseglet, og opbevares ved-20 ° C til at tjene som en kilde til yderligere skabelon, hvis det bliver nødvendigt (Se trin 4,3 Bemærk).
    5. Sæl plader, starter forsigtigt vortex og spin ned ved 1000 x g i 5 min. ved 4 ° C.
    6. Køre indlejrede PCR reaktionen med følgende cykler: 5 min. ved 95 ° C efterfulgt af 34 cyklusser af 20 s ved 95 ° C, 30 s på 56 ° C, og 1 min. ved 72 ° C, efterfulgt af 7 min på 72 ° C.
    7. Køre 5 µL af den endelige reaktion ud på en 1% Agarosen gel indeholder ethidiumbromid (herunder negative og positive kontrolhullerne).
      NOTE: Den forventede band skal køre på omkring 500 bp størrelse. Et eksempel reaktion er vist i figur 2.
    8. Rense den resterende del af den anden reaktion (20 µL) ved hjælp af en 96-brønds format PCR rensning kit, elueres med 15 µL af 70 ° C H 2 O pr. brønd og udføre Sanger sekvensering. Brug den relevante TCR-alpha eller TCR-beta adapter fremad primer for sekventering (tabel 1).
      Bemærk: Sekvenser kan analyseres med online tilgængelige immunogenetics software.

4. Sub kloning alpha og beta PCR kæder.

Bemærk: puljen af de fremad primere udnyttes i den første reaktion, og de omvendte primere i anden PCR reaktionen bruges til at indarbejde begrænsning websteder. Derfor, de opnåede alfa og beta kæde PCR produkter er klar til at blive sekventielt sub klonede til skabelon retroviral vektor ( figur 1).

  1. Digest renset PCR produkter fra beta indlejret reaktion med BstbI og MfeI (tabel 3).
    Bemærk: Ikke overstiger 5 µg Indsæt.
  2. Parallelt, fordøje skabelon vektoren med BstbI og MfeI (tabel 3). Brug 1-2 µg skabelon vektorens pr. TCR. Køre den fordøjede vektor på et agarosegel, og isolere de større band (~ 7500 bp). Rense vektor med en gel DNA rensning kit.
    Bemærk: Under begrænsning enzym digest, skabelon murine TCR-beta variable region er fjernet, giver mulighed for tilsætning af den menneskelige TCR-beta variable region.
  3. Rense de fordøjede PCR produkter ved hjælp af en PCR rensning kit.
    Bemærk: Kontroller DNA rensning kapacitet af de kolonner, der er inkluderet i sættet; Brug flere kolonner, hvis nødvendigt. Minimumsbeløbet for en renset indsætte nødvendige for en vellykket ligatur reaktion er 50 ng på et minimum koncentration af 10 ng/µL. Hvis renset Indsæt beløb ikke er tilstrækkelig for en vellykket ligatur, den anden PCR reaktion kan gentages.
  4. Behandler skabelon vektor med 10 U CIP enzym i 1 time ved 37 ° C at forhindre selvstændige ligatur, efterfulgt af varme inaktivering i 10 min ved 75 ° C. rense DNA med en PCR rensning kit (tabel 3).
  5. Ligate TCR-beta sæt og vektorgrafik ved hjælp af DNA ligase i en 20 µL samlede volumen på 6 molær overskud af insertet i 30 min. ved stuetemperatur.
    NOTE: I alt ligatur reaktion bør indeholde ca 150 ng af DNA (tabel 3).
  6. For transformationer, mix 8 µL af ligatur reaktion med 80 µL af kemisk kompetente E.coli DH5α celler (Tabel af materialer) og der inkuberes i isbad i 30 min. varme chok på 42 ° C til 45 s. tilføje 500 µL Super Optimal bouillon med Catabolite undertrykkelse (S.O.C.) medium og ryste i 1,5 timer ved 37 ° C.
  7. Plade ud 250 µL af bakteriel kultur på en ampicillin, der indeholder Lysogeny bouillon (LB) agar plade. Pladen natten over (~ 16 h) der inkuberes ved 37 ° C.
  8. Den næste dag vælge bakteriel kolonier, og dyrke dem i 3 mL LB medium indeholdende ampicillin natten over. Isolere plasmid DNA ved hjælp af DNA plasmid rensning kit.
  9. Bekræft vellykket indsættelse af beta kæde af en mindre test-digest med restriktionsenzymer BstbI og MfeI. I en 12 µL samlede reaktion volumen, kombinere 200-500 µg plasmid DNA, 0,25 µL af hvert enzym og 10 X enzym buffer (tabel 3). Køre reaktion ud på en 1% agarosegel indeholdende ethidiumbromid for at bekræfte størrelsen af Indsæt band (~ 500 bp).
  10. Efter bekræfter tilstedeværelsen af indsatsen, sekvens afsnittet TCR-beta af den vektor, ved hjælp af IRES omvendt primer (tabel 1).
  11. Følgende sekvens bekræftelse af TCR-beta Indsæt, udføre en lignende proces til indsættelse af alpha variable regionen. Fordøje de renset PCR produkter fra alpha indlejrede reaktion, og den nyligt genererede TCR-beta sæt indeholdende vektor, med SnaBI og SacII.
    Bemærk: Under begrænsning enzym digest, skabelon murine TCR-alpha variable region er fjernet, giver mulighed for tilsætning af den menneskelige TCR-alpha variable region.
  12. Ligate alpha indsætter i TCR vektorer kodning den tilsvarende beta variable region ved hjælp af DNA ligase i en 20 µL samlede volumen på 6 molær overskud af insertet i 30 min. ved stuetemperatur.
    NOTE: I alt ligatur reaktion bør indeholde ca 150 ng af DNA (tabel 3).
  13. For transformationer, mix 8 µL af ligatur reaktion med 80 µL af kemisk kompetente E.coli DH5α celler (Tabel af materialer) og der inkuberes i isbad i 30 min. varme chok på 42 ° C til 45 s. tilføje 500 µL S.O.C. medium og ryste i 1,5 timer ved 37 ° C.
  14. Plade ud 250 µL af bakteriel kultur på en ampicillin, der indeholder Lysogeny bouillon (LB) agar plade. Pladen natten over (~ 16 h) der inkuberes ved 37 ° C.
  15. Den næste dag vælge bakteriel kolonier, og dyrke dem i 3 mL LB medium indeholdende ampicillin natten over. Isolere plasmid DNA ved hjælp af DNA plasmid rensning kit.
  16. Bekræft vellykket indsættelse af alfa kæden ved en mindre test-digest med restriktionsenzymer SnaBI og SacII. I en 12 µL samlede reaktion volumen kombinere 200-500 µg plasmid DNA, 0,25 µL af hvert enzym og 10 x enzym buffer (tabel 3). Køre reaktion ud på en 1% agarosegel indeholdende ethidiumbromid for at bekræfte størrelsen af Indsæt band (~ 500 bp).
  17. Efter bekræfter tilstedeværelsen af indsatsen, sekvens afsnittet TCR-alpha af vektoren, der bruger MSCV2-forward primer (tabel 1).
  18. Alpha kæde sekvens er blevet godkendt, bekræfte den komplette TCR Indsæt ved sekventering med TCR-beta-reverse og IRES-reverse primer (tabel 1).

5. Kontrollere TCR celle overflade udtryk og specificitet.

Bemærk: HEK293T celler anvendes til at teste vellykket TCR kæde pariNG og celle overflade udtryk ( figur 3A) 8. Peptid-MHC tetramer farvning kan også udføres på de transfected HEK293T celler til at teste for fastholdelse af antigene specificitet post TCR gen isolation ( figur 3B).

  1. Plade ud HEK293T celler i 12-godt vævskultur plader på 1 x 10 5 celler pr. brønd i 1 mL komplet DMEM medier indeholdende 5% FCS og kultur natten over ved 37 ° C. plade ud nok celler til har udpeget separate brønde for hver ny TCR , kontrol skabelon TCR vektor, CD3 vektor kun, kontrollere TCR vektor kun, og en ikke-transfekteret godt.
    Bemærk: Transfektion med en fuldt mus skabelon TCR vektor (missilteknologikontrolregimet-pMIA) i kombination med mCD3εγδζ-pMIG vektor, missilteknologikontrolregimet-pMIA vektor alene, og mCD3εγδζ-pMIG vektor alene anvendes som positive og negative kontroller.
    Bemærk: Komplet DMEM indeholder 2 mM L-glutamin, 1 mM natrium pyruvat, 100 µM Non-essentielle aminosyrer, 5 mM HEPES buffer, 5,5 x 10 -5 enheder af 2-mercaptoethanol, 100 U/ml Penicillin/Streptomycin.
  2. Den følgende dag, transfect celler med 1 µg kimære h/missilteknologikontrolregimet-pMIA vektor, 1 µg mus CD3εγδζ-pMSCVII-NGL (pMIG) vektor og et Liposom-baserede Transfektion reagens efter producentens anvisninger.
  3. For hver TCR, tilføje 6 µL Transfektion reagens til 100 µL stuetemperatur, serum-gratis DMEM. Kort vortexes og inkuberes ved stuetemperatur i 15 min.
  4. i separate 1,5 mL rør kombinere 1 µg af TCR-pMIA vektor med 1 µg mus CD3εγδζ-pMSCVII-NGL (pMIG) vektor eller 1 µg for hver vektor separat for kontrolelementer.
  5. Dropwise, tilføje Transfektion reagens/DMEM løsning til rør indeholdende vektor DNA. Inkuber ved stuetemperatur i 15 min.
  6. Dropwise, tilføje Transfektion reagens/DMEM/DNA løsning til HEK293T celler. Tryk forsigtigt på plade til at blande. Der inkuberes ved 37 ° C i 24 h.
  7. Efter 24 h erstatte medierne, og holde celler i kultur for yderligere 24 h.
  8. Fjerne celler fra pladen ved kraftig pipettering, og plette celler med anti-mus CD3 antistof (2,5 µg/mL) til at kontrollere overflade udtryk for kimære-TCR ved flowcytometri.
  9. For at sammenligne CD3 udtryk mellem celler, der var transfekteret til et lignende niveau, gate analyse på celler, der udtrykker et tilsvarende højt niveau af fluorescerende reporter molekyler (normal god landbrugspraksis for CD3 kompliceret, og Ametrine for TCR udtryk vektor). Optimalt, analysen bør være låge på normal god landbrugspraksis + Ametrine + celler inden for 10 4 til 10 5 fluorescerende intensitet ( figur 3A).
    Bemærk: Niveau af CD3 udtryk i celler transfekteret med den kimære konstruktion skal være sammenlignelige med kontrol mus (oprindelige skabelon) vektor ( figur 3A). De genererede TCR retroviral vektorerne er kompatibel med i vivo udtryk systemer som tidligere beskrevet 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Effektiviteten af multiplex-indlejret PCR reaktionen er markeret i trin 3.2.7 (figur 2) ved at køre ud 5 µl af den anden reaktion på en agarosegel. I gennemsnit effektiviteten af TCR-beta forstærkning forventes at blive på omkring 80%, mens effektiviteten af TCR-alpha reaktion er normalt lavere, ca 50%4. Kun parrede TCR-alpha og TCR-beta kæder kan bruges til TCR udtryk; men alle PCR produkter kunne blive sekventeret for at opnå TCR sekvens og repertoire oplysninger.

Genhæmning tillader kun en enkelt TCR-beta kæde skal udtrykkes i en given T-celle. Dog en T-celle er i stand til at organisere en anden TCR alfa kæden, og omkring 25% af T-celler vil give udtryk for en anden i frame TCR-alpha kæde 14. Det forventes, at nogle andel af de isolerede TCR-alpha kæder bliver den sekundære alpha i stedet for den "korrekte" alpha kæde. Den sekundære alpha kæde er ofte ikke en optimal bindende partner med TCR-beta kæde; Det forventes derfor, at ikke alle klonede TCRs vil danne en stabil komplekse og udtrykkelig på cellens overflade. Den korrekte TCR kæde parring og celle overflade udtryk har derfor skal bekræftes ved transfecting HEK293T celler (figur 3A).

Figure 1
Figur 1 . Strømlinet multiplex-indlejret PCR og retroviral konstruere udvikling fra enkelt T-celler. To runder af PCR resultere i forstærkning af tilsvarende TCR alfa og beta kæder. Begrænsning websteder indlejret i primere giver mulighed for strømlinet sub kloning og generation af menneskelige/mus kimære vektor til udtryk i mus celler. Skabelon mus vektor kan bruges til hurtigt at skifte ud variable mus regioner for menneskelige, skaber en kimære menneskelige/mus TCR retroviral vektor kompatibel med udtryk i mus celler. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 . Eksempel på enkelt celle PCR. Multiplex indlejrede PCR-amplifikation af T-celle receptoren beta og alpha kæder fra enkelt humane T celler sorteret i en 96-brønd plade. Vist er tilsvarende (top og bund) PCR produkter fra enkelt celle forstærket TCR beta og TCR alfa kæder fra menneskelige PBMC. NC - ingen skabelon control, PC - positiv kontrol. Ved at køre en lille del af reaktionen på en agarosegel (5 µL), bekræftes effektiviteten af enkelt celle alfa og beta kæde PCR reaktioner før PCR produkt sekventering. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 . Verifikation af celle overflade kimære TCR udtryk og specificitet. (A) HEK293T celle var transfekteret med musen TCR eller menneskelige/mus kimære TCR i kombination med mus CD3εγδζ. Celler overflade TCR udtryk blev målt med anti-mCD3ε antistoffer. Gating strategi: for det første analysen er gated på Ametrine og normal god landbrugspraksis dobbelt positive celler (G2). I tilfælde af enkelt vektor kontrol har af gating skal baseres på den enkelt fluorescens (G1). For det andet er celler fra G1 og G2 analyseret for niveauet af CD3ε udtryk. (B) TCR specificitet er bekræftet af tetramer farvning af 293T celler med DRB1 * 0401:GAD115-127 tetramer. Analyse er gated på normal god landbrugspraksis + Ametrine + CD3ε + celler, som vist i (A). Venligst klik her for at se en større version af dette tal.

TARGET GEN PRIMER ORIENTERING SEKVENS
Reverse transkription
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR alfa PCR reaktion 1
TRAV1-1 Fremad CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Fremad CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Fremad CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Fremad CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Fremad CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Fremad CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Fremad CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Fremad CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Fremad CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Fremad CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC ekstern Omvendt CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR reaktion 1 TRBV2 Fremad CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Fremad CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Fremad CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Fremad CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Fremad CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Fremad CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Fremad CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Fremad CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Fremad CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Fremad CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Fremad CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Fremad CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Fremad CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Fremad CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Fremad CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Fremad CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Fremad CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Fremad CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Fremad CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Fremad CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Fremad CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Fremad CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Fremad CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Fremad CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Fremad CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Fremad CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC eksterne Omvendt GTGGCCAGGCACACCAGTGTG TCR alfa PCR reaktion 2 TRAC interne Omvendt CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV adapter Fremad CGGTTCAGCAGGAATGCCtacgtaATG TCR beta PCR reaktion 2 TRBC interne Omvendt CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV adapter Fremad CAGAAGACGGCATACGAGATcaattgATG Sekventering primere pMSCV-II Fremad CCTCCTCTTCCTCCATCCGCC TCRbeta Omvendt GCCAAGCACACGAGGGTAGCC IRES Omvendt AACGCACACCGGCCTTATTCC * Små bogstaver inden for primer sekvenser indikerer indarbejdet begrænsning enzymet skære websteder

Tabel 1: Omvendt transkription, PCR og sekventering primere.

Trin 2.2 beløb pr. brønd
RT-PCR reaktion (6μL) (ΜL)
10 x buffer 0,6
2 x dNTP 0,24
10% Triton X 0,06
3 TCR-specifikke primere (10mM ea.) 0,23 ea. (x 3 = 0,69)
Enzym 0,18
RNase hæmmer 0,28
NF(nuclease-Free)-H2O 3,95
Trin 3.1
en PCR reaktion 1 (25μL) (ΜL) b PCR reaktion 1 (25μL) (ΜL)
5 x buffer 5 5 x buffer 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (3%) 0,75
en swimmingpool (F primer) (2.3μM) 0,3 b pool (F primer) (2.3μM) 0,5
en ekstern R primer (10uM) 0,6 b ekstern R primer (10μM) 1
DNA polymerase 0,2 Gå Taq-polymerase 0,2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14.65 NF-H2O 14,05
Trin 3.8
PCR reaktion 2 - samme for en og b (25μL) (ΜL)
5 x buffer 5
dNTP (10mM) 1
DMSO 0,75
Adapter F primer (10μM) 1
Interne R primer (10μM) 1
DNA polymerase 0,2
PCR rxn 1 produkt 2.5
NF-H2O 13.55

Tabel 2. Reverse transkription og PCR reaktioner.

Trin 4.2 og 4.3
TRBV digest reaktion (50μL) (ΜL) missilteknologikontrolregimet-pMIA vektor digest (500μL) (ΜL)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x Buffer 5 10 x Buffer 50
H2O H2O
Trin 4.4
CIP reaktion (100μL) (ΜL) DNA(~1.5mg)
> Fordøjet & renset vektor DNA 84 10 x Buffer 10 CIP enzym 6 Trin 4.5 Ligatur reaktion (20μL) (ΜL) Fordøjet/CIPed vektor DNA (Indsæt og vektor totalbeløbet er ~ 150ng) Indsæt DNA (6 molær adgang til vektor) 2 x Ligase buffer 10 Ligase enzym 1 H2O Trin 4.9 Test Digest reaktion (12μL) (ΜL) DNA (100-300ng) 1 MfeI 0,25 BstbI 0,25 10 x Buffer 1.2 H2O 9.3 Trin 4.11 TRAV digest reaktion (60μL) (ΜL) Beta indeholdende - missilteknologikontrolregimet-pMIA vektor digest (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x Buffer 6 10 x Buffer 10 H2O H2O

Tabel 3. Vektor kloning reaktioner.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I den nuværende protokol beskriver vi en effektiv metode til enkelt celle TCR forstærkning og efterfølgende sub kloning af parret TCR alfa og beta kæder i en skabelon retroviral udtryk vektor. Selv om flere enkelt celle PCR-protokoller er blevet udviklet, har ingen hidtil været forenelig med øjeblikkelig sub kloning til et udtryk vektor. I de fleste tilfælde forstærkes delsekvens omfatter de meget varierende CDR3 regioner med nok sekvens til at ekstrapolere den variable region. Denne mindre PCR produktstørrelse understøtter højere PCR effektivitet, men nødvendiggør de novo TCR gen syntese for funktionelle studier. Den nuværende protokol bevarer effektiviteten af tidligere udgivne CDR3-fokuserede enkelt celle TCR sekventering protokoller, samtidig med at den giver en længere amplikon indeholdende den hele variable region egnet til kloning. Systemet beskrevet har derfor en øget fleksibilitet i at give en kvantitativ sekvens, såvel som funktionelle output.

Afhængigt af de videnskabelige spørgsmål, kan kilde og specificitet af T-celler analyseret variere. Hvis det endelige mål med projektet er en analyse af in vivo TCR funktion, er det imidlertid nødvendigt at kende HLA begrænsning af isolerede T-celler. Den nuværende protokol har været specielt beregnet på være kompatibel med i vivo TCR udtryk i HLA-humaniseret mus. Mange af disse mus er blevet genereret og er nu kommercielt tilgængelige, herunder HLA-A2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24, og HLA - B * 0702 transgene stammer. Denne protokol kan kombineres med succes med den tidligere udgivne protokol for retroviral medieret knoglemarv stamceller udtryk for menneskelige TCRs4,15,16. Vi forventer at humaniseret TCR retrogenic systemet vil være gældende og meget nyttig for funktionel analyse af menneskelige TCRs i forskellige autoimmune, kræft og smitsomme modeller.

Den aktuelle enkelte celle PCR-protokol beskriver de kritiske trin og giver forslag nødvendigt for vellykkede forstærkning af parret TCR-alpha og TCR-beta sekvenser. Det første vigtige skridt er en rettidig ydelse af cDNA transskription og efterfølgende første runde af multiplex PCR. Alle de involverede skridt bør udføres i tide, og alle reagenser og celler opbevares på is at forhindre RNA og cDNA nedbrydning. For det andet, fordi protokollen er designet til at være meget følsom over for lave niveauer af skabelonen, det er meget modtagelige for forurening. Derfor er det bydende nødvendigt at arbejde i en skabelon-fri område, væk fra amplificerede PCR produkter eller TCR vektor kloning. Et separat rum eller hætte bør anvendes til at angive cDNA og PCR reaktioner. Skabelon fra den første PCR reaktion skal tilføjes i et andet område fra hvor PCR er sat op. Det er tilrådeligt at et separat sæt aliquoted reagenser anvendes til enkelt celle PCR eksperimenter.

Denne protokol er specifikt optimeret ved hjælp af de reagenser, der er anført i Tabel af materialer, og eventuelle erstatninger i reagenser vil kræve yderligere optimering. Den oprindelige identifikation af antigen-specifikke celler kan redigeres til at bruge peptid-MHC tetramers. Tetramer farvning giver mulighed for samtidige vurdering af antigen specificitet, samt HLA-begrænsning. Alternative metoder til påvisning af antigen reaktivitet, som opregulering af tidlig aktivering markører eller sekretion af inflammatoriske cytokiner kan betragtes i mangel af tetramer reagenser. For eksempel, kan dobbelt specificitet fusion antistoffer specifikke for en T-celle antigen og IFNγ kombineres med magnetisk bead isolation til at berige for antigen reaktive IFNγ producerer celler.

Mens den kimære menneskelige/mus konstruktion beskrevet i vores protokol sikrer kompatibilitet med musen celler, er dens forenelighed med menneskelige CD3 kompliceret ukendt. Selv om ikke formelt testet af os, har andre vist, at kimære TCR konstruktioner med murine konstant regioner kan udtrykkes på overfladen af humane lymfocytter17. Dette indikerer, at murine TCR konstant regioner kan støtte interaktion med den menneskelige CD3 signalering komplekse. Men hvis målet er at udtrykke de identificerede TCRs i primære celler eller menneskelige cellelinjer, såsom Jurkat celler, en mere optimal tilgang kan være at bruge en fuldt ud menneskelig konstruktion. Dette kan opnås ved at bytte de murine konstant regioner inden for vektoren med menneskelige konstant regioner.

Hvis en identificeret TCR variable region indeholder for begrænsning steder anvendes til kloning, TCR bør indsættes i en shuttle vektor og efterfølgende muterede ved hjælp af et site rettet mutagenese kit til at fremkalde en tavs nukleotid ændring inden for begrænsning skær site. En alternativ fremgangsmåde er de novo syntesen af TCR variable region af interesse ændres for at udelukke uønsket begrænsning site.

Den største begrænsning af denne teknik er den manglende evne til at eliminere forstærkning af sekundære 'cytoplasmatisk' alpha kæder. TCR-alpha gener gå ikke gennem allel udelukkelse som TCR-beta gener, således en betydelig andel af T-celler vil udtrykke en sekundær 'cytoplasmatisk' alpha kæde14. Den beskrevne PCR-protokol kun resulterer i forstærkning af én TCR alfa kæden, men hvis den forstærkede alfa kæden er den 'cytoplasmatisk' alpha kæde det ikke kan parre med forstærkede beta kæde. Derfor er det bydende nødvendigt at teste TCR celle overflade udtryk i HEK293T celler til at sikre succesfuld kæde parring.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Undersøgelsen blev finansieret af JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 PILOT PJ, og The Robert og Janice McNair Foundation.

Vi takker Sandra Pena og Andrene McDonald for patient rekruttering, Samuel Blum for teknisk bistand, Dr. George Makedonas til gave af antistoffer og kontrol DNA anvendes til PCR optimering.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Strømlinet enkelt celle TCR Isolation og Generation af Retroviral vektorer for <em>In Vitro </em>og <em>In Vivo</em> udtryk for menneskelige TCRs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter