Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Rationalisé unicellulaire TCR isolement et génération des vecteurs rétroviraux pour In Vitro et In Vivo Expression de TCRs humaines

doi: 10.3791/55379 Published: September 10, 2017

Summary

Le cours combine protocole unicellulaire jumelé humain séquençage de TCR alpha et bêta de chaîne avec simplifié génération des vecteurs rétroviraux compatibles avec l’expression de TCR in vitro et in vivo .

Abstract

Bien que plusieurs méthodes de séquençage d’appariés T cell receptor (TCR) alpha et bêta chaînes de cellules T ont été développés, aucun jusqu'à présent ont été propices à l’aval en vivo analyse fonctionnelle des hétérodimères TCR. Nous avons développé un protocole amélioré basé sur une PCR en deux étapes de multiplex imbriquées, qui se traduit par un produit PCR qui s’étend sur les régions variables entières d’une chaînes humaines TCR alpha et bêta. Par identification des sites de restriction uniques et leur intégration dans les amorces PCR, nous avons fait le produit PCR compatible avec direct sous clonage dans le vecteur rétroviral de modèle. La construction rétrovirale qui en résulte encode une chimérique humain/souris TCR avec un domaine intracellulaire de la souris, qui est fonctionnel dans les cellules de souris ou de modèles de souris in vivo . Dans l’ensemble, le protocole décrit ici combine humaine seule cellule jumelé TCR alpha et bêta chaîne identification avec génération simplifiée des vecteurs rétroviraux aisément adaptables pour l’expression de TCR in vitro et in vivo . La vidéo et le matériel qui l’accompagne sont conçus pour donner une description très détaillée de la cellule unique PCR, afin que les étapes critiques puissent être suivies et potentiels pièges évités. En outre, nous fournir une description détaillée des étapes nécessaires pour générer le vecteur d’expression clonage. Une fois maîtrisé, tout le processus depuis la seule cellule de tri à l’expression de TCR peut être effectué dans un délai de deux semaines.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Le récepteur des cellules T (TCR) dicte décision sort des lymphocytes T au cours de développement, l’état stationnaire/homéostasie et une stimulation antigénique en périphérie1,2,3. Expansion récente des technologies de séquençage de profondeur a permis de découvrir une diversité TCR précédemment sous-estimé au sein de l’antigène des lymphocytes T spécifiques aux réponses. Diversité des TCR suggère un potentiel pour les lymphocytes T large point de vue fonctionnel. Afin d’intégrer l’analyse TCR répertoire des séquences avec des essais fonctionnels de TCR, les approches de séquençage devraient être conçus pour être compatible avec les systèmes expérimentaux et in vivo des modèles utilisés pour l’analyse fonctionnelle de select TCRs. Nous avons développé une approche efficace pour l’isolation de séquence humaine TCR et rationalisé sous clonage dans un vecteur de modèle des TCR de chimérique humain/souris compatible avec l’expression de TCR à souris humanisée HLA4. L’isolement des correspondants des chaînes alpha et bêta des hétérodimères TCRs nécessite l’amplification PCR des deux chaînes d’une seule cellule. Bien que plusieurs protocoles de clonage TCR unicellulaires ont été développés et utilisés, aucun jusqu'à présent ont été facilement compatible avec haut débit simplifiée clonage direct de TCRs Vα/Vβ inconnu dans des vecteurs rétrovirus nécessaires pour réexpression in vivo 4,5,6,7. Des études antérieures ont utilisé deux approches majeures, soit pour amplifier sélectivement une partie limitée du TCR suffit d’extrapoler la séquence, ou d’amplifier les TCR toute séquence4,5,6 , 7. analyse fonctionnelle en aval de TCR séquences obtenues par l’intermédiaire de la première approche exige la construction du TCR Assemblée et de novo coûteux en silico . Tandis que la seconde approche présente également la séquence complète de TCR, la région constante humaine n’est pas compatible avec in vivo l’expression des TCRs clonés dans des modèles murins. Notre approche est spécifiquement conçu pour être compatible avec in vivo analyse fonctionnelle des TCRs dans des modèles murins. Nous avons développé une cellule unique protocole PCR permettant directement sous clonage de fragments PCR dans le vecteur d’expression de modèle efficace et simplifiée.

Notre approche utilise une réaction de PCR de multiplex imbriqué très sensible qui s’effectue en deux étapes. Dans la première réaction de multiplexe étape une piscine de 40 amorces spécifiques pour toutes les chaînes de V-bêta et une piscine de 44 amorces spécifiques pour toutes les chaînes alpha-V sont utilisées pour amplifier la TCR-alpha ou bêta-TCR sans la connaissance préalable de la séquence (tableau 1). L’apprêt avant a une séquence de l’adaptateur, qui est incorporée dans la 5' du produit PCR. L’apprêt inverse est issu de la région constante du TCR. Nous avons identifié des sites de restriction uniques qui sont absents de la variable humaine ou jonction TCR régions et incorporés dans des amorces nouvellement redessinés de TCRα et TCRβ (Figure 1). Dans la deuxième réaction imbriquée, une amorce spécifique pour la séquence de l’adaptateur et une amorce inverse imbriquée au sein de la région constante sont utilisés pour amplifier encore les chaînes TCR avec une spécificité accrue (tableau 1, Figure 1). Après l’isolement de cellules du même, deux rondes de PCR (première réaction avec un pool d’amorces Vα tant Vβ et deuxièmement avec des amorces adaptateur) aboutir à un produit PCR qui peut être directement sous cloné dans le template vecteur rétroviral. La construction TCR finale doit pouvoir coder, dans un cadre de lecture seule (ORF), les régions variables humaines combinées avec les régions constantes souris reliées par la séquence protéique « Self clivage », P2A (hVα-mCα-P2A-hVβ-mCβ)8. La séquence de P2A a été utilisée dans plusieurs systèmes et a été longuement testée spécifiquement pour l’expression de TCRs8,9,10,11. Bien que, après traduction la plupart de la P2A séquence reste attachée à l’extrémité C-terminale de la chaîne alpha, reliée par un flexible linker, tandis que la séquence de signaux de chaîne bêta a une proline supplémentaire, cette modification n’a aucun effet néfaste sur la fonction TCR. La région constante de la souris est utilisée dans la construction au lieu de l’homme pour éviter des interactions altérées avec des composants de signalisation en aval lors de ré-exprimé dans les cellules de souris. L’ORF unique entraînera stoechiométrique expression distincte d’alpha et bêta chaînes9,11. Le protocole actuel est issu des réactifs et des approches qui sont largement disponibles et est conçu pour être réalisées de manière simple et efficace. Bien que nous avons spécifiquement utilisé cette technique pour dosage de TCRs des cellules T autoréactives impliqués dans le diabète auto-immun, nous prévoyons que ce protocole peut être largement applicable pour l’identification et l’évaluation fonctionnelle des TCRs humaines spécifiques pour épitopes auto-immunes, cancer épitopes ou réponses aux pathogènes et aux vaccins.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identifier la population des lymphocytes T.

Remarque : antigène spécifique prolifération en combinaison avec de la teinture de la division cellulaire (comme la carboxyfluorescéine succinimidyl ester, CFSE) peut être utilisée pour isoler les cellules T basé sur leur prolifération en réponse à une stimulation antigénique. Si à partir de PBMC, une expansion 7 jours in vitro devrait suffire identifier un antigène spécifique CFSE faible population 12.

  1. Mix PBMC 1:1 avec des cellules nourricières MHC assortie et étiquette avec de la teinture de la division cellulaire 5 µM CFSE.
  2. Plaque de 2 à 2,5 x 10 5 cellules / puits dans un fond rond 96 puits culture plaque dans 200 µL 10 % FCS complet RPMI médias.
    NOTE : Le RPMI complet contient 2 mM de l-glutamine, pyruvate de sodium 1 mM, 100 µM MEM acides aminés non essentiels, 5 mM HEPES, 5,5 × 10 − 5 unités de 2-mercaptoéthanol, 100 mL de U − 1 pénicilline et 100 µg mL − 1 streptomycine.
  3. Stimuler les cellules avec des antigènes de peptide 25 µM.
  4. Sur la quatrième journée de la culture, soigneusement retirer et remplacer 100 µL de médias.
    Remarque : Une approche plus optimale pour l’identification spécifique de l’antigène des lymphocytes T est l’utilisation de peptide-HLA tétramères 13. Tétramère de coloration permettant l’évaluation simultanée de la spécificité de l’antigène, mais aussi de HLA-restriction.

2. Mettre en place le type de cellule unique.

  1. Effectuer toutes les procédures dans une hotte ou d’un secteur désigné gratuitement modèle amplifié. Aliquote les réactifs pour éviter toute contamination, nettoyer toutes les surfaces de travail et, si c’est possible, équipement avec 10 % d’eau de Javel avant l’installation de la PCR. Utilisez les bouts filtrants, RNAse et DNAse réactifs gratuits et plastiques dans tous les PCR et vecteur de clonage des étapes. Réactifs clés se trouvent dans la Table des matières.
    Remarque : La réaction de PCR multiplexe est très sensible, et de faibles niveaux de contamination sont notamment imputables au produit amplifié.
  2. Tampon de
  3. Generate master mix transcription inverse en combinant 10 x réaction de droite, 25 X DNTPs, 9 enzyme RT U, 0,01 % Triton-X, inhibiteur de RNAse U 0,7 et 383 nM de chaque amorce RT-TCR (énumérée dans le tableau 1) dans un réservoir de pipetage stérile. Pour chaque plaque à 96 puits, composent assez mélange maître pour 10 réactions supplémentaires (total 106), pour compenser la perte de liquide pendant le pipetage. Voir le tableau 2 pour les composants de la réaction et montants / puits.
  4. Préparer une collection de PCR 96 puits plaque pour cellule Tri par pipetage 6 µL du mélange maître transcription inverse / puits avec une pipette multicanaux. Maintenir la plaque sur la glace ou dans un bloc froid.
  5. Étiquette de cellules avec des anticorps dans la cellule des marqueurs de surface (par exemple les CD4 et CD3, ou CD8, CD3, chacun à 2 µg/mL, en combinaison avec la division cellulaire colorant ou coloration tétramère).
  6. Cellules de T de sorte à une cellule par puits, sauter la douzième ligne, qui servira de témoin négatif.
    Remarque : L’efficacité du tri dépendra alignement plaque collection précis dans le support de plaque, ainsi que maintenir les cellules et les plaques à une température basse avant la réaction de l’ADNc. Assiettes de collection doivent être conservés sur la glace en permanence, sauf pendant le tri, lorsqu’ils sont fixés au sein de la plaque de refroidissement. Pas tous les trieurs sont équipés d’un support de plaque réglementé de température ; Toutefois, l’utilisation de l’un est fortement recommandée. Puisque le tri prend généralement environ 10-15 min par plaque, il y a un risque accru pour la dégradation de l’ARN si la plaque n’est pas maintenue à basse température.
  7. Comme témoin positif, ajouter un plus grand nombre de cellules (100) manuellement avec une pipette à l’un des puits à ce stade. Sinon, déjà isolé l’ARN des cellules regroupées peut être utilisé comme témoin positif à 10 ng / puits.
    NOTE : Pipetter purifiée control RNA avec précision et soin afin d’éviter la contamination croisée d’autres puits et des résultats faussement positifs.
  8. Sceller la plaque avec film adhésif et tournez en bas à 1000 x g pendant 5 min à 4 ° C.
  9. Transcrire immédiatement RNA d’ADNc en incubant la plaque à 25 ° C pendant 10 min, 37 ° C pendant 45 min et 85 ° C pendant 10 min.
    Remarque : Pour garantir la réaction PCR efficace, il est recommandé que la première réaction de PCR être effectué le même jour. Alternativement, les plaques transcrits peuvent être conservées à-80 ° C pendant 2 mois.

3. Effectuer imbriqué multiplex PCR

Remarque : préparer tous les mélanges maîtres dans une zone propre modèle pour éviter toute contamination.

Apprêt
  1. reconstituer chaque région variable à 100 µM avec DNAse et RNAse libre H 2 O. Ensuite, mélanger 20 µL de chacune des 44 amorces pour générer la piscine d’apprêt V-alpha. Pour générer la bêta V piscine apprêt combiner 20 µL de chacune des 40 amorces V-bêta plus 80 µL de DNAse et RNAse libre H 2 O. Primer séquences sont répertoriées dans le tableau 1. Une fois mis en commun, la concentration de chaque amorce dans le mélange est 2.3 µM.
  2. Reconstituer les amorces de la région constante de la solution mère de 100 µM à la DNAse et RNAse libre H 2 O. diluer les amorces région constante 10 solution de travail µM et partie aliquote destiné.
  3. Préparer deux mélanges maîtres distinctes pour l’amplification TCR-alpha et bêta-TCR. Générer les mélanges maîtres en combinant 5 X buffer, 80 µM dNTPs, 3 % DMSO, 2 µM amorce pool (concentration finale de 46 nM pour chaque amorce), 200 nM TCR-constant région inverse l’apprêt, 1 U ADN polymérase et DNAse et RNAse libre H 2 O (tableau 2 < / strong >). Pour chaque plaque à 96 puits, composent assez mélange maître pour 10 réactions supplémentaires (total 106), afin de compenser la perte de liquide pendant le pipetage.
    Remarque : Les calculs sont basés sur le volume final de PCR de 25 µL / puits, où le mélange de 22,5 µL maître PCR se conjugue avec matrice d’ADNc 2,5 µL.
  4. Garder la plaque avec l’ADNc sur la glace ou dans un bloc froid. Utilisez un multicanal pour distribuer 22,5 µL de réaction TCR-bêta dans une nouvelle plaque PCR 96 puits. Puis utilisez un multicanal pour transférer 2,5 µL d’ADNc dans la plaque PCR.
  5. Utiliser un multicanal pour distribuer 22,5 µL de réaction TCR alpha directement dans le plat contenant le reste du cDNA.
  6. Sceller les plaques avec une colle doucement vortex et spin down à 1000 x g pendant 5 min à 4 ° C.
  7. Exécuter la réaction de PCR multiplexe avec les cycles suivants : 5 min à 95 ° C suivie de 34 cycles de 20 s à 95 ° C, 30 s à 54 ° C et 1 min à 72 ° C, suivie de 7 min à 72 ° C.
  8. Carry out la réaction PCR imbriquée dans un volume final de 25 µL, à l’aide de 2,5 µL du mélange PCR multiplex en tant que modèle.
    1. Reconstituer les amorces internes et adaptateur à 100 µM avec DNAse et RNAse libre H 2 O. faire 10 µM parties aliquotes pour le stock travail.
    2. Préparer deux mélanges maîtres distinctes pour ampl TCR-alpha et bêta-TCRfication. Mix 5 X tampon, 25 X DNTP, 3 % DMSO, 200 nM adaptateur avant apprêt, amorce imbriquée inverse de 200 nM, 1 U ADN polymérase et l’ADN polymérase et exempte de nucléase H 2 O pour un volume final de 22,5 µL (tableau 2). Pour chaque plaque à 96 puits, composent assez mélange maître pour 10 réactions supplémentaires (total 106), pour compenser la perte de liquide pendant le pipetage.
      Remarque : Dans la deuxième utilisation de réaction PCR le 5 X PCR buffer contenant colorant de chargement pour faciliter le chargement de gel d’agarose.
    3. à l’aide d’un multicanal, pipette les mélanges maîtres pour les réactions TCR-alpha et bêta-TCR à 22,5 µL / puits dans deux nouvelles plaques de 96 puits PCR.
    4. Ajouter le modèle de réaction PCR multiplex à 2,5 µL / puits.
      Remarque : La première réaction de PCR restante devrait être scellée et conservée à-20 ° C et servir de source de modèles supplémentaires, si cela devient nécessaire (voir étape Note 4,3).
    5. Sceller les plaques doucement vortex et spin down à 1000 x g pendant 5 min à 4 ° C.
    6. Exécuter la réaction PCR imbriquée avec les cycles suivants : 5 min à 95 ° C suivie de 34 cycles de 20 s à 95 ° C, 30 s à 56 ° C et 1 min à 72 ° C, suivie de 7 min à 72 ° C.
    7. Exécuter 5 µL de la réaction finale sur un gel d’agarose de 1 % de gel contenant du bromure d’éthidium (y compris les puits des témoins négatifs et positifs).
      Remarque : La bande attendue doit tourner autour de 500 taille de bp. Une réaction de l’exemple est illustrée à la Figure 2.
    8. Purifier le reste de la seconde réaction (20 µL) en utilisant un format 96 puits kit de purification de PCR, éluer avec 15 µL de 70 ° C H 2 O / puits et effectuer Sanger séquençage. Utiliser l’approprié TCR-alpha ou bêta-TCR adaptateur avant primaire de séquençage (tableau 1).
      Remarque : Les séquences peuvent être analysées avec logiciel immunogénétique disponibles en ligne.

4. Clonage des chaînes PCR alpha et bêta.

Remarque : la piscine de l’avant amorces utilisées dans la première réaction et les amorces inverses dans la deuxième réaction de PCR sont utilisés pour intégrer les sites de restriction. Par conséquent, les produits PCR chaîne alpha et beta obtenus sont prêts à être successivement Sub cloné dans le vecteur rétroviral modèle ( Figure 1).

Produits
  1. Digest le PCR purifié de la beta imbriqués réaction avec BstbI et MfeI (tableau 3).
    Remarque : Ne pas dépasser 5 µg insert.
  2. En parallèle, digérer le template vecteur avec BstbI et MfeI (tableau 3). Utiliser 1 à 2 µg de la template vecteur par TCR. Exécutez le vecteur digéré sur gel d’agarose et isoler la bande plus large (~ 7500 bp). Purifier le vecteur d’un gel kit de purification de l’ADN.
    Remarque : Pendant le digest de l’enzyme de restriction, la région variable de la murine TCR-bêta de modèle est supprimée, permettant l’ajout de la région variable de TCR-bêta humaine.
  3. Purifier les produits de PCR digérés à l’aide d’un kit de purification PCR.
    Remarque : Vérifier la capacité de purification de l’ADN des colonnes incluses dans le kit ; Utilisez plusieurs colonnes si nécessaire. Le montant minimum d’un insert purifié nécessaire à une réaction de ligature réussie est de 50 ng à une concentration minimale de 10 ng/µL. Si le montant d’insert purifiée n’est pas suffisant pour une ligature avec succès, la seconde réaction de PCR peut être répétée.
  4. Traiter le template vecteur avec 10 enzyme U CIP pendant 1 h à 37 ° C pour empêcher l’individu-ligature, suivie de l’inactivation par la chaleur pendant 10 min à 75 ° C. purifier l’ADN avec un kit de purification de l’ACP (tableau 3).
  5. Bêta-TCR Ligate insérer et vector à l’aide de DNA ligase, pendant 30 min à température ambiante dans un volume total de 20 µL à 6 excès molaire de l’insert.
    Remarque : Au total, la réaction de ligature doit contenir environ 150 ng d’ADN (tableau 3).
  6. Pour les transformations, mélanger 8 µL de la réaction de ligature 80 µl de cellules chimiquement compétentes de e. coli DH5α (Table des matières) et incuber sur glace pendant 30 min à 42 ° C pendant 45 s. ajouter 500 µL un choc thermique Super Bouillon optimal avec moyen de répression (O.S.C.) catabolique et agiter pendant 1,5 h à 37 ° C.
  7. Plaque à 250 µL de culture bactérienne sur une ampicilline contenant de gélose lysogénie bouillon (LB). Incuber la plaque pendant la nuit (~ 16 h) à 37 ° C.
  8. Le lendemain prélever des colonies bactériennes et eux grandisse dans un milieu 3 mL LB contenant l’ampicilline durant la nuit. Isoler l’ADN de plasmide à l’aide du kit de purification ADN plasmidique.
  9. Confirmer l’insertion réussie de la chaîne bêta par un essai à petite échelle-digest avec les enzymes de restriction, BstbI et MfeI. Dans un volume de réaction totale 12 µL, mélanger 200 à 500 µg ADN plasmidique, 0,25 µL de chacune des enzymes et 10 X enzyme tampon (tableau 3). Exécutez la réaction dehors sur un gel d’agarose à 1 % contenant du bromure d’éthidium pour confirmer la taille de la bande d’insertion (~ 500 bp).
  10. Après la confirmation de la présence de l’insert, séquencer la section RCT-bêta du vecteur à l’aide de l’apprêt inverse IRES (tableau 1).
  11. Suite à la confirmation de la séquence de l’insert de TCR-bêta, effectuer un processus similaire pour l’insertion de la région variable alpha. Digérer les produits PCR purifiés de la réaction alpha imbriquée et l’insert de TCR-bêta nouvellement générée contenant le vecteur, avec SnaBI et SacII.
    Remarque : Pendant le digest de l’enzyme de restriction, la région variable de la murine TCR alpha de modèle est supprimée, permettant l’ajout de la région variable de TCR-alpha humaine.
  12. Alpha
  13. Ligate insère dans les vecteurs TCR codant la région variable correspondante de bêta à l’aide de DNA ligase, pendant 30 min à température ambiante dans un volume total de 20 µL à 6 excès molaire de l’insert.
    Remarque : Au total, la réaction de ligature doit contenir environ 150 ng d’ADN (tableau 3).
  14. Pour les transformations, mélanger 8 µL de la réaction de ligature 80 µl de cellules chimiquement compétentes de e. coli DH5α (Table des matières) et incuber sur glace pendant 30 minutes un choc thermique à 42 ° C pendant 45 s. ajouter 500 µL O.S.C. moyen et agiter pendant 1,5 h à 37 ° C.
  15. Plaque à 250 µL de culture bactérienne sur une ampicilline contenant de gélose lysogénie bouillon (LB). Incuber la plaque pendant la nuit (~ 16 h) à 37 ° C.
  16. Le lendemain prélever des colonies bactériennes et eux grandisse dans un milieu 3 mL LB contenant l’ampicilline durant la nuit. Isoler l’ADN de plasmide à l’aide du kit de purification ADN plasmidique.
  17. Confirmer l’insertion réussie de la chaîne alpha par un essai à petite échelle-digest avec les enzymes de restriction SnaBI et SacII. Dans un volume de réaction totale 12 µL mélanger 200 à 500 µg ADN plasmidique, 0,25 µL de chacune des enzymes et 10 x enzyme tampon (tableau 3). Exécutez la réaction dehors sur un gel d’agarose à 1 % contenant du bromure d’éthidium pour confirmer la taille de la bande d’insertion (~ 500 bp).
  18. Après la confirmation de la présence de l’insert, séquencer la section TCR alpha du vecteur à l’aide de l’apprêt MSCV2-forward (tableau 1).
  19. Une fois que la séquence de la chaîne alpha est validée, vérifier l’insertion complète de TCR par séquençage d’amorce de TCR-bêta-inversion et IRES-inverse (tableau 1).

5. Vérifier l’expression superficielle de cellules TCR et spécificité.

Remarque : cellules HEK293T sont utilisés pour tester le succès TCR chaîne paring et cell surface expression ( Figure 3 a) 8. Peptide-MHC tétramère coloration peut également être effectuée sur les cellules transfectées de HEK293T à tester pour le maintien de la spécificité antigénique poste TCR gène isolement ( Figure 3 b).

  1. Plaque de cellules HEK293T en plaques de culture de tissu de 12 puits à 1 x 10 5 cellules / puits dans 1 mL complet DMEM médias contenant 5 % FCS et de la culture pendant une nuit à 37 ° C. plaque sur suffisamment de cellules ont désignées au puits séparés pour chaque nouveau TCR , contrôle template TCR vecteur, vecteur de CD3 seulement, contrôler vecteur TCR seulement et un non transfectées bien.
    NOTE : Transfection avec un modèle entièrement souris TCR vector (RCTM-pMIA) en combinaison avec mCD3εγδζ-pMIG vecteur, vecteur du RCTM-pMIA seul, et mCD3εγδζ-pMIG vecteur seul sont utilisés comme témoins positifs et négatifs.
    NOTE : DMEM complet contient 2 mM de L-glutamine, 1 mM de Pyruvate de Sodium, 100 µM Non essentiels, acides aminés, 5 mM HEPES buffer, 5,5 x 10 -5 unités de 2-mercaptoéthanol, 100 U/ml de pénicilline/streptomycine.
  2. Le lendemain, transfecter les cellules avec 1 µg chimérique h/RCTM-pMIA vecteur, vecteur de CD3εγδζ-pMSCVII-GFP (pMIG) 1 µg souris et un réactif de transfection axée sur les liposomes, suivant les instructions du fabricant.
  3. Pour chaque TCR, ajouter 6 µL de réactif de transfection à 100 µL la température ambiante, sans sérum DMEM. Brièvement, vortex et incuber à température ambiante pendant 15 min.
  4. Dans séparé 1,5 mL tubes mélanger 1 µg de vecteur de TCR-pMIA µg 1 souris CD3εγδζ-pMSCVII-GFP (pMIG) vecteur ou 1 µg de chaque vecteur distinct pour les contrôles.
  5. Dropwise, ajouter la solution de réactif/DMEM de transfection pour les tubes contenant le vecteur ADN. Incuber à température ambiante pendant 15 min.
  6. Dropwise, ajouter la solution de réactif/DMEM/ADN de transfection de cellules HEK293T. Tapoter légèrement la plaque pour mélanger. Incuber à 37 ° C pendant 24 h.
  7. Après 24 h remplacer les médias et de garder les cellules en culture pour supplémentaires 24h.
  8. Enlever les cellules de la plaque par pipetage vigoureux et tacher les cellules avec un anticorps anti-souris CD3 (2,5 µg/mL) afin de vérifier l’expression superficielle de la chimère-TCR par cytométrie.
  9. Pour comparer l’expression CD3 entre les cellules qui ont été transfectées à un niveau similaire, porte l’analyse sur les cellules exprimant un haut niveau similaire de molécules journaliste fluorescente (GFP pour complexe CD3 et amétrine pour vecteur d’expression de TCR). Idéalement, l’analyse devrait être fermée sur GFP + amétrine + cellules dans 10 4 10 5 intensité de fluorescence ( Figure 3 a).
    Remarque : Le niveau d’expression de CD3 dans les cellules transfectées par la construction chimérique devrait être comparable au vecteur contrôle souris (modèle d’origine) ( Figure 3 a). Les vecteurs rétroviraux générés de TCR sont compatibles avec les systèmes d’expression in vivo comme décrit précédemment 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L’efficacité de la réaction de PCR multiplex imbriqué est activée à l’étape 3.2.7 (Figure 2) en exécutant sur 5 µl de la seconde réaction sur gel d’agarose. L’efficacité de l’amplification de la TCR-bêta en moyenne devrait se situer autour de 80 %, tandis que l’efficacité de la réaction de TCR-alpha est généralement plus bas, aux alentours de 50 %4. Seulement paires chaînes TCR-alpha et bêta-TCR peuvent être utilisés pour l’expression de TCR ; Cependant, tous les produits PCR pourraient être séquencés pour obtenir des informations de répertoire et de séquence TCR.

Silençage génique permettra seulement une seule chaîne de TCR-bêta de s’exprimer dans une cellule de T donnée. Cependant, une cellule T est capable de réorganiser une deuxième chaîne TCR alpha, et environ 25 % des cellules T s’exprimant une seconde dans le cadre TCR alpha chaîne 14. Il est prévu qu’une partie des chaînes TCR alpha isolés sera l’alpha secondaire au lieu de la chaîne alpha « correcte ». La chaîne alpha secondaire n’est souvent pas un partenaire de liaison optimale avec la chaîne bêta-TCR ; par conséquent, il est probable que pas tous TCRs clonés formera une écurie expresse sur la surface des cellules et complexe. Par conséquent, le RCT chaîne appariement et cell surface l’expression appropriée doit être confirmée par transfectants cellules HEK293T (Figure 3 a).

Figure 1
Figure 1 . Simplifiée de PCR multiplex imbriqués et construct retroviral développement de cellules T. Entraînent deux séries de PCR amplification des chaînes correspondantes de TCR alpha et bêta. Sites de restriction incorporés dans les amorces permettent sous clonage simplifiée et la génération de vector chimérique humain/souris pour l’expression dans les cellules de souris. Le vecteur de souris modèle peut être utilisé pour passer facilement les régions variables souris pour homme, générant un vecteur rétroviral TCR chimérique humain/souris compatible avec l’expression dans les cellules de souris. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 . Exemple d’une seule cellule PCR. Amplification par PCR multiplexe imbriquée des chaînes bêta et alpha récepteurs de lymphocytes T de simples cellules T humaines triées dans une plaque de 96 puits. Est indiqué correspondant (haut et bas) des produits PCR partir seule cellule amplifié bêta TCR et les chaînes alpha TCR de humaine NC PBMC. - aucun contrôle de modèle, PC - contrôle positif. En exécutant une petite partie de la réaction sur un gel d’agarose (5 µL), l’efficacité des cellule alpha et bêta PCR réactions en chaîne est confirmée avant le produit PCR, séquençage. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 . Vérification de la cellule de surface chimérique expression TCR et spécificité. (A) HEK293T cellules ont été transfectées avec la souris TCR ou un homme ou une souris chimérique TCR en combinaison avec la souris CD3εγδζ. TCR modelé de cellules a été mesurée avec un anticorps anti-mCD3ε. Stratégie de déclenchement : tout d’abord, l’analyse est fermée sur l’Ametrine et GFP doubles cellules positives (G2). Dans le cas de contrôles unique vecteur le déclenchement doit être basée sur la fluorescence unique (G1). En second lieu, les cellules de G1 et G2 sont analysées pour le niveau d’expression de CD3ε. (B), TCR spécificité est confirmée par tétramère coloration des cellules 293 t avec DRB1 * 0401:GAD115-127 tétramère. Analyse est fermée sur GFP + amétrine + CD3ε + des cellules, comme indiqué en (A). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

GÈNE CIBLE ORIENTATION DE L’APPRÊT SÉQUENCE
Transcription inverse
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 ADNc GAAATCCTTTCTCTTGACCATG
TRBC2 ADNc GCCTCTGGAATCCTTTCTCT
Réaction de PCR alpha TCR 1
TRAV1-1 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC externe Marche arrière CAGACAGACTTGTCACTGGATTTAGAGTCTC Réaction de PCR TCRbeta 1 TRBV2 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d :>Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Vers l’avant CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC externe Marche arrière GTGGCCAGGCACACCAGTGTG Réaction de PCR alpha RCT 2 TRAC interne Marche arrière CAGCTGGTACAccgcggGGTCAGGGTTCTG VTRT adaptateur Vers l’avant CGGTTCAGCAGGAATGCCtacgtaATG Bêta TCR réaction PCR 2 TRBC interne Marche arrière CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG Adaptateur TRBV Vers l’avant CAGAAGACGGCATACGAGATcaattgATG Amorces de séquençage pMSCV-II Vers l’avant CCTCCTCTTCCTCCATCCGCC TCRbeta Marche arrière GCCAAGCACACGAGGGTAGCC IRES Marche arrière AACGCACACCGGCCTTATTCC * Les lettres minuscules dans les séquences d’amorces indiquent que l’enzyme de restriction incorporé couper sites

Tableau 1 : Reverse transcription PCR et des amorces de séquençage.

Étape 2.2 montants par puits
Réaction de RT-PCR (6μL) (ΜL)
tampon de x 10 0,6
2 x dNTP 0,24
Triton 10 % X 0,06
3 amorces spécifiques de TCR (ch. 10mM) 0.23 ea. (x 3 = 0,69)
Enzyme 0,18
Inhibiteur de RNase 0,28
NF(nuclease-Free)-H2O 3.95
Étape 3.1
une réaction de PCR 1 (25µL) (ΜL) b réaction PCR 1 (25µL) (ΜL)
zone tampon de 5 x 5 zone tampon de 5 x 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (3 %) 0,75
une piscine (amorce de F) (2.3μM) 0,3 piscine b (amorce de F) (2.3μM) 0,5
une amorce de R externe (10uM) 0,6 apprêt de R externe b (10 μM) 1
ADN polymérase 0,2 Aller la Taq polymérase 0,2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14.65 NF-H2O 14.05
Étape 3,8
Réaction de PCR 2 - même pour a et b (25µL) (ΜL)
zone tampon de 5 x 5
dNTP (10mM) 1
DMSO 0,75
Apprêt adaptateur F (10 μM) 1
Apprêt intérieur de R (10 μM) 1
ADN polymérase 0,2
Produit de PCR rxn 1 2.5
NF-H2O 13,55

Le tableau 2. Transcriptase inverse et les réactions de PCR.

Étapes, 4.2 et 4.3
Réaction de TRBV digest (50μL) (ΜL) mTCR-pMIA digest de vecteur (500μL) (ΜL)
ADN (~ 20μg) ADN (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x tampon 5 10 x tampon 50
H2O H2O
Étape 4.4
Réaction de CIP (100 μl) (ΜL) DNA(~1.5mg)
> Digéré & purifiée à l’ADN vecteur 84 10 x tampon 10 Enzyme CIP 6 Étape 4.5 Réaction de ligature (20μL) (ΜL) Digestion/CIPed vecteur ADN (insert et vecteur totalise ~ 150ng) Insérer l’ADN (6 accès molaire à vector) 2 x tampon Ligase 10 Enzyme de ligase 1 H2O Étape 4,9 Réaction au Digest test (12μL) (ΜL) ADN (100-300ng) 1 MfeI 0.25 BstbI 0.25 10 x tampon 1.2 H2O 9.3 Étape 4.11 Réaction de digest VTRT (60μL) (ΜL) Contenant du bêta - RCTM-pMIA digest de vecteur (120μL) DNA(~1.5μg) ADN (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x tampon 6 10 x tampon 10 H2O H2O

Tableau 3. Vecteur de clonage des réactions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Dans le protocole actuel, nous décrivons une méthode efficace pour l’amplification de TCR unicellulaire et ultérieures sous clonage des chaînes appariées de TCR alpha et bêta dans un vecteur rétroviral expression de modèle. Bien que plusieurs protocoles PCR de cellule unique ont été développés, aucun jusqu'à présent ont été compatible avec immédiate sous clonage dans un vecteur d’expression. Dans la plupart des cas, une séquence partielle qui englobe les régions CDR3 très variables est amplifiée, avec assez de séquence d’extrapoler la région variable. Cette petite taille de produit PCR prend en charge une plus grande efficacité PCR, mais nécessite la synthèse de gènes TCR en reprenant des études fonctionnelles. Le protocole actuel maintient l’efficacité des protocoles de séquençage de TCR publiées antérieurement axés sur les CDR3 unicellulaire, tout en même temps ce qui donne un amplicon plus longs contenant la région ensemble variable appropriée pour le clonage. Par conséquent, le système décrit a une flexibilité accrue en donnant une séquence quantitatif, ainsi que sortie fonctionnelle.

Selon la question scientifique, la source et la spécificité des lymphocytes T analysé peuvent varier. Toutefois, si l’objectif final du projet est l’analyse de la fonction TCR in vivo , il est nécessaire de connaître la restriction HLA de cellules T isolées. Le protocole actuel a été spécialement conçu pour être compatible avec expression de TCR in vivo chez la souris HLA-humanisé. Beaucoup de ces souris ont été générées et sont maintenant disponibles dans le commerce, y compris les HLA-A2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 et HLA - B * 0702 souches transgéniques. Ce protocole est cumulable avec succès avec le protocole déjà publié pour l’expression de cellules souches retroviral médiée par la moelle osseuse humaine TCRs4,15,16. Nous attendons que le système de retrogenic TCR humanisé seront applicables et très utiles pour l’analyse fonctionnelle des TCRs humains dans divers auto-immunes, cancer et les modèles infectieuses.

La cellule active unique protocole PCR décrit les étapes essentielles et donne des suggestions nécessaires à l’amplification réussie des paire TCR-alpha et séquences de TCR-bêta. La première étape critique est une performance en temps opportun de la transcription de l’ARNC et ultérieure premier cycle de PCR multiplex. Toutes les étapes doivent être effectués en temps opportun, et tous les réactifs et les cellules gardé sur glace à prévenir la dégradation de l’ARN et de cDNA. Deuxièmement, parce que le protocole est conçu pour être très sensibles aux faibles niveaux du modèle, il est très sensible à la contamination. Par conséquent, il est impératif de travailler à un modèle l’abri, loin des produits PCR amplifiés ou TCR vecteur de clonage. Une salle séparée ou le clapet doit servir à mettre en place l’ADNc et les réactions de PCR. Modèle à partir de la première réaction de PCR doit être ajouté dans un domaine différent d’où la PCR est mis en place. Il est recommandé qu’un ensemble distinct de réactifs aliquotés être utilisé pour les expériences PCR de cellule unique.

Ce protocole a été spécifiquement optimisé en utilisant les réactifs énumérés dans la Table des matières, et des substitutions dans les réactifs, il faudra une optimisation supplémentaire. L’identification initiale de cellules antigène-spécifiques peut être modifiée pour utiliser des tétramères peptide-MHC. Tétramère coloration permet une évaluation simultanée de la spécificité de l’antigène, mais aussi de HLA-restriction. Méthodes alternatives pour la détection de la réactivité de l’antigène, tels que l’upregulation des premiers marqueurs d’activation ou de la sécrétion de cytokines inflammatoires peuvent être considérés en l’absence de réactifs tétramère. Par exemple, anticorps de fusion double spécificité spécifiques d’un antigène des cellules T et IFNγ est cumulable avec l’isolement de billes magnétiques pour enrichir pour cellules IFNγ production réactives l’antigène.

Tandis que la construction chimérique humain/souris décrite dans notre protocole assure la compatibilité avec les cellules de souris, le niveau de sa compatibilité avec CD3 humain complexe est inconnu. Bien que non officiellement testé par nos soins, d’autres ont montré que des constructions TCR chimériques murin régions constante peuvent être exprimées à la surface des lymphocytes humains17. Ceci indique que murines régions constantes de TCR peuvent prendre en charge une interaction avec les humains CD3 signalisation complexes. Toutefois, si l’objectif est d’exprimer les TCRs identifiés dans les cellules humaines primaires ou des lignées cellulaires humaines, telles que les cellules Jurkat, une approche plus optimale serait d’utiliser une construction totalement humaine. Cela est possible en permutant les régions murines constantes dans le vecteur avec les régions constantes humaines.

Si une région variable identifiée de TCR contienne un des sites de restriction utilisées pour le clonage, le RCT doit être inséré dans un vecteur navette et par la suite muté à l’aide d’un kit de mutagénèse site réalisé pour induire un changement de silencieux nucléotides au sein de la restriction couper le site. Une autre approche est la synthèse de novo de la région variable de TCR d’intérêt modifié pour exclure du site de restriction non désirés.

La principale limite de cette technique est l’incapacité à éliminer l’amplification des chaînes alpha « cytoplasmiques » secondaires. Gènes de TCR alpha ne passent pas par exclusion allélique comme gènes de TCR-bêta, donc qu'une proportion importante des lymphocytes T exprimera un secondaire de la chaîne alpha « cytoplasmique »14. Le protocole PCR décrit uniquement les résultats pour l’amplification d’une chaîne alpha de TCR, mais si la chaîne alpha amplifiée est la chaîne alpha « cytoplasmique » il ne peut pas de paire avec la chaîne bêta amplifié. Par conséquent, il est impératif de tester expression TCR à la surface cellulaire dans les cellules HEK293T pour assurer le succès chaîne appariement.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

Cette étude a été financée par la FRDJ 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 PILOT PJ et The Robert et Janice McNair Foundation.

Nous remercions Sandra Pena et Andrene McDonald pour le recrutement de patients, Samuel Blum pour l’assistance technique, le Dr George Makedonas pour le don d’anticorps et contrôle ADN utilisé pour l’optimisation de la PCR.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Rationalisé unicellulaire TCR isolement et génération des vecteurs rétroviraux pour <em>In Vitro </em>et <em>In Vivo</em> Expression de TCRs humaines
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter