Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Razionalizzato isolamento di singole cellule TCR e generazione di vettori retrovirali per In Vitro e In Vivo l'espressione del TCR umano

doi: 10.3791/55379 Published: September 10, 2017

Summary

I combines di protocollo corrente singola cella coppia umana TCR alfa e beta catena sequenziamento con snella generazione di vettori retrovirali compatibile con espressione TCR in vitro e in vivo .

Abstract

Anche se, sono stati sviluppati diversi metodi per il sequenziamento di catene alfa e beta di accoppiati delle cellule T a ricevitore (TCR) da singole cellule di T, nessuno finora sono stati favorevoli a valle in vivo analisi funzionale di TCR eterodimeri. Abbiamo sviluppato un protocollo migliorato basato su una PCR multiplex-annidato in due fasi, che si traduce in un prodotto PCR che si estende su intere regioni variabili di un catene alfa e beta TCR di umane. Identificando i siti di restrizione unici e incorporare gli iniettori PCR, abbiamo fatto il prodotto PCR compatibile con Sub-clonazione diretta nel vettore retrovirale modello. Il costrutto retrovirale risultante consente di codificare un chimerico umano/mouse TCR con un dominio intracellulare del mouse, che è funzionale in cellule di topo o in modelli di topo in vivo . Nel complesso, il protocollo descritto qui combina umana singola cella accoppiato TCR alfa e beta catena identificazione con generazione ottimizzata di vettori retrovirali facilmente adattabile per espressione TCR in vitro e in vivo . Il video e il materiale di accompagnamento sono progettati per fornire una descrizione altamente dettagliata della singola cella PCR, cosicché i passaggi critici possono essere seguite e potenziali insidie evitati. Inoltre, forniamo una descrizione dettagliata dei passaggi clonazione necessari per generare il vettore di espressione. Una volta imparato, l'intera procedura da singola cella ordinamento all'espressione TCR potrebbe essere eseguita in un breve periodo di due settimane.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

T cell receptor (TCR) detta decisione di destino delle cellule T durante lo sviluppo, stato stazionario/omeostasi e stimolazione antigenica in periferia1,2,3. Recente espansione delle tecnologie di sequenziamento profondo ha scoperto una diversità TCR precedentemente poco apprezzata all'interno di risposte specifiche delle cellule di T di antigene. Diversità TCR suggerisce un potenziale per le risposte delle cellule T funzionalmente ampio. Al fine di integrare l'analisi di repertorio TCR sequenza con saggi funzionali TCR, gli approcci di sequenziamento dovrebbero essere progettati per essere compatibile con sistemi sperimentali e in vivo modelli utilizzati per la successiva analisi funzionale di select TCR. Abbiamo sviluppato un approccio efficace per l'isolamento di sequenza umana del TCR e razionalizzato Sub-clonazione in un vettore di modello TCR chimerico umano/mouse compatibile con espressione TCR in topi umanizzati HLA4. Isolamento delle relative catene alfa e beta del TCR heterodimeric richiede l'amplificazione di PCR di entrambe le catene da una singola cellula. Anche se, diversi protocolli clonazione di singole cellule TCR sono stati sviluppati e utilizzati, nessuno finora sono stati facilmente compatibile con alto-rendimento aerodinamico clonazione diretta di sconosciuto Vα/Vβ TCR in vettori retrovirali necessari per ri-espressione in vivo 4,5,6,7. Precedenti studi hanno utilizzato due approcci principali, sia per amplificare selettivamente una porzione limitata del TCR sufficiente per estrapolare la sequenza, o per amplificare l'intero TCR sequenza4,5,6 , 7. analisi funzionale a valle di TCR sequenze ottenute tramite il primo approccio richiede costose in silico un costruzione assemblaggio e de novo del TCR. Mentre il secondo approccio prevede la sequenza completa di TCR, regione costante umana non è compatibile con l'espressione in vivo del TCR clonato in modelli murini. Il nostro approccio è specificamente progettato per essere compatibile con in vivo analisi funzionale di TCR in modelli murini. Abbiamo sviluppato un'efficiente e snella singola cella protocollo PCR che consente per sub-clonazione diretta di frammenti PCR nel vettore di espressione di modello.

Il nostro approccio utilizza un'altamente sensibile reazione di PCR multiplex-nidificati che viene eseguita in due fasi. Nella prima reazione multiplex passo una piscina di 40 primer specifici per tutte le catene di V-beta e una piscina di 44 primer specifici per tutte le catene di V-alfa sono utilizzate per amplificare il TCR-alfa o TCR-beta senza la preventiva conoscenza della sequenza (tabella 1). Il primer forward ha una sequenza di adattatore, che è incorporata in 5' del prodotto della PCR. Il primer reverse si basa sulla regione costante del TCR. Abbiamo identificato siti di restrizione unici che sono assente dal variabile umana o regioni della giunzione TCR e ha incluso tali in nuova e ridisegnata, TCRα e TCRβ primer (Figura 1). Nella seconda reazione nidificata, un primer specifico per la sequenza di adattatore e un primer reverse nidificato all'interno della regione costante sono utilizzati per amplificare ulteriormente le catene TCR con specificità aumentata (tabella 1, Figura 1). Dopo isolamento di singole cellule, due tondi di PCR (reazione prima con un pool di primer sia Vα e Vβ e in secondo luogo con gli iniettori adattatore) portano a un prodotto PCR che può direttamente essere sub-clonato nel vettore retrovirale modello. Il costrutto TCR finale codificherà, in una cornice unica lettura aperta (ORF), umane regioni variabili combinate con regioni costante del mouse collegate di sequenza della proteina 'self-che fende', P2A (hVα-mCα-P2A-hVβ-mCβ)8. La sequenza P2A è stata utilizzata nei sistemi multipli ed è stato ampiamente testata in modo specifico per l'espressione del TCR8,9,10,11. Anche se, dopo traduzione la maggior parte del P2A sequenza rimane attaccata al C-terminale della catena alfa collegato da un linker flessibile, mentre la sequenza di segnale catena beta ha un'ulteriore prolina, questa modifica non ha alcun effetto negativo sulla funzione TCR. La regione costante del mouse viene utilizzata nel costrutto anziché umani per evitare potenziali interazioni alterate con componenti di segnalazione a valle quando ri-espressa in cellule di topo. Il singolo ORF si tradurrà in espressione separata stechiometrico di alfa e beta catene9,11. Il protocollo attuale è basato su reagenti e approcci che sono ampiamente disponibili ed è stato progettato per essere eseguita in modo snello ed efficiente. Anche se abbiamo usato questa tecnica in particolare test TCR da cellule T autoreattive implicate nel diabete autoimmune, prevediamo che questo protocollo può essere ampiamente applicabile per l'identificazione e la valutazione funzionale di umano TCR specifico per epitopi autoimmuni, cancro epitopi o risposte a patogeni e vaccini.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identificare la popolazione delle cellule di T di interesse.

Nota: antigene specifica proliferazione in combinazione con la tintura di divisione cellulare (come Carboxyfluorescein succinimidyl ester, CFSE) può essere utilizzata per isolare le cellule T basato sulla loro proliferazione in risposta alla stimolazione antigenica. Se a partire da PBMCs, un'espansione di 7 giorni in vitro dovrebbe essere sufficiente per identificare un antigene specifico CFSE popolazione bassa 12.

  1. PBMCs Mix 1:1 con le cellule di alimentatore MHC-abbinato ed etichetta con colorante divisione cellulare di 5 µM CFSE.
  2. Piastra 2-2,5 x 10 5 cellule per pozzetto in un turno di 96 pozzetti-fondo cultura piastra in 200 µ l 10% FCS completo RPMI media.
    Nota: RPMI completo contiene 2 mM l-glutammina, piruvato di sodio di 1 mM, 100 µM MEM aminoacidi non essenziali, 5 mM HEPES, 5.5 × 10 − 5 unità di 2-mercaptoetanolo, 100ml U − 1 penicillina e 100 µ g mL − 1 streptomicina.
  3. Stimolare le cellule con l'antigene di peptide 25 µM.
  4. Il quarto giorno della cultura, con attenzione rimuovere e sostituire 100 µ l di media.
    Nota: Un approccio più ottimale per l'identificazione di cellule T antigene-specifiche è l'uso di peptide-HLA tetrameri 13. Tetramero colorazione consente una valutazione simultanea di specificità antigenica, così come HLA-restrizione.

2. Impostare il tipo unicellulare.

  1. Eseguire tutte le procedure in un cappuccio o una area destinata gratuitamente modello amplificato. Aliquotare i reagenti per evitare la contaminazione, pulire tutte le superfici di lavoro e, se fattibile, attrezzature con 10% di candeggina prima dell'installazione PCR. Utilizzare puntali con filtro, RNasi e dnasi gratis reagenti e materiali plastici in tutti la PCR e il vettore di clonazione passi. Chiavi reagenti possono essere trovati nella Tabella materiali.
    Nota: La reazione di PCR multiplex è altamente sensibile, e bassi livelli di contaminazione possono provocare prodotto amplificato.
  2. Genera il mix master trascrizione inversa mediante la combinazione di reazione di RT: 10x buffer, 25 X DNTPs, enzima RT U 9, 0,01% Triton-X, inibitore di 0,7 U RNasi e 383 nM di ogni primer RT-TCR (elencati nella tabella 1) in un serbatoio di pipettaggio sterile. Per ogni piastra a 96 pozzetti, make up abbastanza mix master per 10 ulteriori reazioni (Totale 106), per compensare la perdita di liquido durante il pipettaggio. Vedere la tabella 2 per i componenti di reazione e importi per pozzetto.
  3. Piastra
  4. preparare una collezione di PCR 96 pozzetti per cella ordinamento di pipettaggio 6 µ l del mix master trascrizione inversa per pozzetto con una pipetta multicanale. Tenere la piastra su ghiaccio o in un blocco freddo.
  5. Marcare le cellule con anticorpi alla cella marcatori di superficie (ad esempio CD4 e CD3, o CD8 e CD3, ciascuna a 2 µ g/mL, in combinazione con la divisione cellulare tintura o colorazione tetramero).
  6. Cellule di T di sorta in uno delle cellule per pozzetto, saltando la dodicesima fila, che servirà come controllo negativo.
    Nota: L'efficienza dell'ordinamento dipenderà precisa raccolta piatto allineamento all'interno il portatarga, nonché a mantenere le cellule e piastre a bassa temperatura prima reazione di cDNA. Piastre di raccolta dovrebbero essere tenuti su ghiaccio in ogni momento, tranne durante l'ordinamento, quando sono fissati all'interno della placca di raffreddamento. Non tutti i selezionatori sono dotate di un portatarga regolamentato di temperatura; Tuttavia, si raccomanda vivamente l'uso di uno. Poiché l'ordinamento richiede generalmente circa 10-15 min per piastra, c'è un potenziale aumento di degradazione del RNA se la piastra non viene mantenuta a bassa temperatura.
  7. Come controllo positivo, aggiungere un numero maggiore di cellule (100) manualmente con una pipetta a uno dei pozzi in questa fase. In alternativa, precedentemente isolato RNA da cellule in pool può essere utilizzato come controllo positivo alle 10 ng per pozzetto.
    Nota: Pipettare controllo purificato RNA con precisione e cura al fine di evitare la contaminazione incrociata di altri pozzi e risultati falsi positivi.
  8. Sigillare la piastra con la pellicola adesiva e spin giù a 1000 x g per 5 min a 4 ° C.
  9. Immediatamente trascrivere RNA in cDNA incubando la piastra a 25 ° C per 10 min, 37 ° C per 45 min e 85 ° C per 10 min.
    Nota: Per garantire la reazione di PCR efficiente, è consigliabile che la prima reazione di PCR viene eseguita il giorno stesso. In alternativa, le piastre trascritte possono essere conservate a-80 ° C per fino a 2 mesi.

3. Eseguire nidificati multiplex PCR

Nota: preparare tutti i master mix in un ambiente pulito privo di modello per evitare la contaminazione.

Primer
  1. ricostituire ogni regione variabile 100 µM con DNasi e RNasi free H 2 O. Poi, combinate 20 µ l di ciascuno dei 44 primer per generare la piscina di primer V-alfa. Per generare il V-beta piscina primer combinare 20 µ l di ciascuno dei 40 V-beta primer plus 80 µ l di DNasi e RNasi free H 2 O. Primer sequenze sono elencate nella tabella 1. Una volta riuniti, la concentrazione di ogni primer nel mix è 2,3 µM.
  2. Ricostituire i primer regione costante alla soluzione stock di 100 µM con DNasi e RNAsi libera H 2 O. Diluire i primer regione costante a 10 µM lavoro soluzione e aliquota per l'uso.
  3. Preparare due mix master separati per l'amplificazione di TCR-alfa e beta-TCR. Generare i master mix combinando 5 X 80 µM dNTPs, 3% DMSO, 2 µM primer pool di buffer, (concentrazione finale di 46 nM per ciascun primer), 200 nM TCR-costante regione reverse primer, 1 U DNA polimerasi e DNasi e RNasi free H 2 O (tabella 2 < / strong >). Per ogni piastra a 96 pozzetti, make up abbastanza mix master per 10 ulteriori reazioni (Totale 106), al fine di compensare la perdita di liquido durante il pipettaggio.
    Nota: I calcoli si basano sul volume di PCR finale di 25 µ l per pozzetto, dove il mix PCR master di 22,5 µ l è combinato con modello di cDNA 2,5 µ l.
  4. Tenere la piastra con cDNA su ghiaccio o in un blocco di freddo. Utilizzare un multicanale per 22,5 µ l di reazione di TCR-beta in una nuova piastra per PCR a 96 pozzetti. Quindi utilizzare un multicanale per trasferire 2,5 µ l di cDNA nella piastra PCR.
  5. Utilizzare un multicanale per 22,5 µ l di reazione di TCR-alfa direttamente nella piastra contenente il resto del cDNA.
  6. Sigillare le piastre con adesivo, delicatamente vortice e spin giù a 1000 x g per 5 min a 4 ° C.
  7. Eseguire la reazione di PCR multiplex con i seguenti cicli: 5 min a 95 ° C seguita da 34 cicli di 20 s a 95 ° C, 30 s a 54 ° C e 1 min a 72 ° C, seguita da 7 min a 72 ° C.
  8. Portare fuori la reazione di PCR annidata in un volume finale di 25 µ l, utilizzando 2,5 µ l della miscela PCR multiplex come modello.
    1. Ricostituire i primers interni ed adattatore a 100 µM con DNasi e RNasi free H 2 O. fare 10 µM aliquote per lo stock di lavoro.
    2. Preparare due mix master separati per TCR-alfa e beta-TCR amplflussi, la verifica. Mix 5 X 200 nM inversa nidificati primer, primer di adattatore avanti 200 nM X DNTP, 3% DMSO, 25, buffer, 1 U DNA polimerasi e DNA polimerasi e privo di nucleasi H 2 O per un volume finale di 22,5 µ l (tabella 2). Per ogni piastra a 96 pozzetti, make up abbastanza mix master per 10 ulteriori reazioni (Totale 106), per compensare la perdita di liquido durante il pipettaggio.
      Nota: L'uso di reazione di PCR secondo il 5 X PCR tampone contenente caricamento colorante per facilitare il caricamento del gel dell'agarosi.
    3. Tramite un multicanale, dispensare i master mix per le reazioni di TCR-alfa e beta-TCR a 22,5 µ l per pozzetto in due nuove piastre PCR a 96 pozzetti.
    4. Aggiungere il modello di reazione di PCR multiplex a 2,5 µ l per pozzetto.
      Nota: La prima reazione di PCR rimanente dovrebbe essere sigillata e conservata a-20 ° C per servire come fonte di modelli aggiuntivi, se si rende necessario (Vedi passo Nota 4.3).
    5. Sigillare le piastre, delicatamente vortice e spin giù a 1000 x g per 5 min a 4 ° C.
    6. Eseguire la reazione di PCR annidata con i seguenti cicli: 5 min a 95 ° C seguita da 34 cicli di 20 s a 95 ° C, 30 s a 56 ° C e 1 min a 72 ° C, seguita da 7 min a 72 ° C.
    7. Eseguire 5 µ l di reazione finale fuori su un 1% di agarosio gel contenente bromuro di etidio (compresi i pozzetti di controllo positivi e negativi).
      Nota: La band prevista deve essere eseguito con dimensioni di circa 500 bp. Una reazione di esempio è illustrata nella Figura 2.
    8. Purificare il resto della seconda reazione (20 µ l) utilizzando un formato a 96 pozzetti kit di purificazione di PCR, eluire con 15 µ l di 70 ° C H 2 O per pozzetto ed eseguire Sanger sequenziamento. Utilizzare apposito TCR-alfa o TCR-beta adattatore forward primer di sequenziamento (tabella 1).
      Nota: Sequenze possono essere analizzate con il software di Immunogenetica disponibile online.

4. Sub-clonazione catene PCR di alfa e beta.

Nota: lo stagno di forward primer utilizzati nella prima reazione e gli iniettori d'inversione nella seconda reazione di PCR è usato per incorporare siti di restrizione. Di conseguenza, i prodotti PCR catena alfa e beta ottenuti sono pronti per essere in sequenza Sub-clonato nel vettore retrovirale modello ( Figura 1).

Prodotti
  1. Digest la PCR purificato dalla beta annidati di reazione con BstbI e MfeI (tabella 3).
    Nota: Non superare 5 µ g inserto.
  2. In parallelo, digerire il template vettoriale con BstbI e MfeI (tabella 3). Utilizzare 1-2 µ g di template vettoriale per TCR. Eseguire il vettore digerito su un gel di agarosio e isolare la band più grande (~ 7500 bp). Purificare il vettore con un gel kit di purificazione di DNA.
    Nota: Durante il digest di enzima di restrizione, area variabile del modello murino TCR-beta viene rimosso, consentendo l'aggiunta della regione variabile umana TCR-beta.
  3. Purificare i prodotti PCR digeriti con un kit di purificazione di PCR.
    Nota: Verificare la capacità di purificazione del DNA delle colonne incluse nel kit; Se necessario, utilizzare più colonne. L'importo minimo di un inserto purificato necessario per una reazione di legatura successo è 50 ng ad una concentrazione minima di 10 ng / µ l. Se la quantità di inserto purificata non è sufficiente per una legatura di successo, la seconda reazione di PCR può essere ripetuta.
  4. Trattare il template vettoriale con 10 enzima U CIP per 1h a 37 ° C per evitare auto-legatura, seguita da inattivazione termica per 10 min a 75 ° C. purificare il DNA con un kit di purificazione di PCR (tabella 3).
  5. Legano TCR-beta inserire e vettoriale utilizzando ligasi del DNA in un volume totale di 20 µ l in eccesso molare 6 dell'inserto per 30 min a temperatura ambiente.
    Nota: In totale, la reazione di legatura dovrebbe contenere circa 150 ng di DNA (tabella 3).
  6. Per le trasformazioni, 8 µ l della reazione di legatura con 80 µ l di cellule di e. coli DH5α chimicamente competenti (Tabella materiali) e incubare in ghiaccio per 30 min. shock termico a 42 ° C per 45 s. aggiungere 500 µ l Super Brodo di ottimo con medie di soppressione (S.O.C) dei cataboliti e agitare per 1,5 h a 37 ° C.
  7. Piastra fuori 250 µ l di coltura batterica su un ampicillina contenente piastra di agar Lisogenesi brodo (LB). Incubare la piastra durante la notte (~ 16 h) a 37 ° C.
  8. Il giorno successivo scegli colonie batteriche e loro crescono in mezzo mL 3 LB contenente ampicillina durante la notte. Isolare il DNA del plasmide utilizzando kit di purificazione di DNA plasmidico.
  9. Confermare l'esito positivo inserimento della catena beta da un test su piccola scala-digest con gli enzimi di restrizione BstbI e MfeI. In un volume di reazione totale 12 µ l, unire 200-500 µ g plasmide DNA, 0,25 µ l di ogni enzima e buffer di 10 X enzima (tabella 3). Eseguire la reazione fuori su un gel di agarosio all'1% contenente etidio bromuro per confermare la dimensione della band inserto (~ 500 bp).
  10. Dopo aver confermato la presenza dell'inserto, sequenza sezione TCR-beta del vettore utilizzando il primer reverse IRES (tabella 1).
  11. In seguito alla conferma di sequenza dell'inserto TCR-beta, eseguire un processo simile per l'inserimento della regione variabile alfa. Digerire i prodotti di PCR purificati dalla reazione alfa nidificata e l'inserimento di TCR-beta appena generato contenente vettoriale, con SnaBI e Silvio.
    Nota: Durante il digest di enzima di restrizione, area variabile del modello murino TCR-alfa viene rimosso, consentendo l'aggiunta della regione variabile TCR-alfa umana.
  12. Legano alfa inserisce in vettori TCR codifica regione variabile corrispondente beta utilizzando ligasi del DNA in un volume totale di 20 µ l in eccesso molare 6 dell'inserto per 30 min a temperatura ambiente.
    Nota: In totale, la reazione di legatura dovrebbe contenere circa 150 ng di DNA (tabella 3).
  13. Per le trasformazioni, 8 µ l della reazione di legatura con 80 µ l di cellule di e. coli DH5α chimicamente competenti (Tabella materiali) e incubare in ghiaccio per 30 min. shock termico a 42 ° C per 45 s. aggiungere 500 µ l S.O.C medio e agitare per 1,5 h a 37 ° C.
  14. Piastra fuori 250 µ l di coltura batterica su un ampicillina contenente piastra di agar Lisogenesi brodo (LB). Incubare la piastra durante la notte (~ 16 h) a 37 ° C.
  15. Il giorno successivo scegli colonie batteriche e loro crescono in mezzo mL 3 LB contenente ampicillina durante la notte. Isolare il DNA del plasmide utilizzando kit di purificazione di DNA plasmidico.
  16. Confermare l'esito positivo inserimento della catena alfa da un test su piccola scala-digest con gli enzimi di restrizione SnaBI e Silvio. In un volume di reazione totale 12 µ l unire 200-500 µ g plasmide DNA, 0,25 µ l di ogni enzima e buffer di 10 x enzima (tabella 3). Eseguire la reazione fuori su un gel di agarosio all'1% contenente etidio bromuro per confermare la dimensione della band inserto (~ 500 bp).
  17. Dopo aver confermato la presenza dell'inserto, sequenza la sezione di TCR-alfa del vettore utilizzando il MSCV2-forward primer (tabella 1).
  18. Una volta che la sequenza di alfa catena viene convalidata, verificare il completo inserimento TCR di sequenziamento con TCR-beta-reverse e IRES-reverse primer (tabella 1).

5. Verificare l'espressione di superficie delle cellule TCR e la specificità.

Nota: HEK293T cellule sono utilizzate per testare successo TCR catena paring e cellule superficiali espressione ( Figura 3A) 8. Peptide-MHC tetramero macchiatura può essere eseguita anche su cellule transfected HEK293T per testare per la ritenzione dell'isolamento di specificità antigenica post TCR gene ( Figura 3B).

  1. Piastra HEK293T cellule in piastre di coltura del tessuto 12-pozzetti a 1 x 10 5 cellule per pozzetto in 1 mL completo DMEM media contenente 5% FCS e cultura durante la notte a 37 ° C. piastra fuori abbastanza cellule per hanno designato pozzetti separati per ogni nuovo TCR , vettore di controllo modello TCR, CD3 vettoriale solo, controllo vettoriale TCR unico e un non-transfettate bene.
    Nota: Transfezione con un modello del mouse completamente TCR vector (mTCR-pMIA) in combinazione con mCD3εγδζ-pMIG vettore, vettore mTCR-pMIA da solo, e mCD3εγδζ-pMIG vettoriale da solo sono utilizzati come controlli positivi e negativi.
    Nota: DMEM completo contiene 2 mM L-Glutammina, 1 mM sodio piruvato, 100 µM Non essenziali aminoacidi, 5 mM HEPES buffer, 5.5 x 10 -5 unità di 2-mercaptoetanolo, 100 U/ml di penicillina/streptomicina.
  2. Il giorno seguente, le cellule con 1 µ g chimerico h/mTCR-pMIA vettoriale, 1 µ g del mouse CD3εγδζ-pMSCVII-GFP (pMIG) vettore e un reagente di transfezione liposoma-base seguendo le istruzioni del produttore del transfect.
  3. Per ogni TCR, aggiungere 6 µ l di reagente di transfezione di 100 µ l temperatura, DMEM privo di siero. Brevemente vortice e incubare a temperatura ambiente per 15 min.
  4. In separata 1,5 mL tubi combinano 1 µ g di TCR-pMIA vettoriale con 1 µ g del mouse CD3εγδζ-pMSCVII-GFP (pMIG) vettore o 1 µ g di ogni vettore separato per i controlli.
  5. Dropwise, aggiungere la soluzione di reagente/DMEM trasfezione le provette contenenti il vettore di DNA. Incubare a temperatura ambiente per 15 min.
  6. Dropwise, aggiungere la soluzione di reagente/DMEM/DNA di transfezione delle cellule HEK293T. Picchiettare delicatamente la piastra per mescolare. Incubare a 37 ° C per 24 h.
  7. Dopo 24 h sostituire i media e mantenere le cellule in coltura per altre 24 h.
  8. Rimuovere cellule dalla piastra pipettando vigoroso e macchiare le cellule con anti-anticorpo CD3 topo (2,5 µ g/mL) per verificare l'espressione di superficie del chimerico-TCR tramite flusso cytometry.
  9. Al fine di confrontare l'espressione CD3 tra celle transfected a un livello analogo, cancello l'analisi sulle cellule che esprimono un simile livello elevato di molecole fluorescenti reporter (GFP per complesso CD3 e ametrino per vettore di espressione TCR). In modo ottimale, l'analisi dovrebbe essere recintato su GFP + ametrino + cellule entro 10 4 10 5 intensità fluorescente ( Figura 3A).
    Nota: Il livello di espressione di CD3 in cellule trasfettate con il costrutto chimerico dovrebbe essere paragonabile al vettore di controllo del mouse (modello originale) ( Figura 3A). I vettori retrovirali TCR generati sono compatibili con sistemi di espressione in vivo come descritto in precedenza 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'efficienza della reazione di PCR multiplex-annidata è selezionata nel passaggio 3.2.7 (Figura 2) eseguendo fuori 5 µ l di seconda reazione su un gel di agarosio. In media dovrebbe essere circa 80%, mentre l'efficienza della reazione TCR-alfa è di norma inferiore al 50% l'efficienza di amplificazione di TCR-beta4. Solo catene accoppiate TCR-alfa e beta-TCR possono essere utilizzate per l'espressione TCR; Tuttavia, tutti i prodotti di PCR potrebbero essere ordinati per ottenere la sequenza TCR e informazioni sui repertori.

Silenziamento genico consente solo una singola catena di TCR-beta essere espressa in una determinata cella di T. Tuttavia, una cellula T è in grado di riorganizzare una seconda catena di TCR-alfa, e circa il 25% delle cellule di T che esprimono un seconda nel telaio TCR-alfa a catena 14. Si prevede che alcuni proporzione delle catene TCR-alfa isolate sarà l'alfa secondaria invece la catena alfa "corretta". La catena alfa secondaria spesso non è un partner di associazione ottimale con la catena di TCR-beta; di conseguenza, si prevede che TCR clonato non tutti si forma una scuderia complessa ed espressa sulla superficie delle cellule. Pertanto, il corretto TCR catena pairing e cella espressione di superficie deve essere confermata dalla trasfezione HEK293T cellule (Figura 3A).

Figure 1
Figura 1 . Snella nidificate multiplex PCR e sviluppo retrovirali costrutto da singole cellule di T. Due cicli di PCR provocare l'amplificazione delle relative catene alfa e beta TCR. Siti di restrizione incorporati nei primer permettono snella Sub-clonazione e generazione di vettore chimerico umano/mouse per espressione in cellule di topo. Il modello del mouse vettore può essere utilizzato per passare facilmente fuori regioni variabili del mouse per umani, generando vettore retrovirale un TCR chimerico umano/mouse compatibile con l'espressione in cellule di topo. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 . Esempio di cella singola PCR. Amplificazione di PCR annidata multiplex delle catene di alfa e beta di recettore delle cellule T da singole cellule T umane ordinate in una piastra a 96 pozzetti. Vengono mostrati amplificato corrispondente (superiore e inferiore) i prodotti di PCR da singola cellula beta TCR e TCR alfa catene da umano PBMCs. NC - no controllo del modello, PC - controllo positivo. Eseguendo una piccola porzione della reazione su un gel di agarosio (5 µ l), l'efficienza delle reazioni PCR singola cella alfa e beta catena è confermato prima del prodotto di PCR, sequenziamento. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 . Verifica della cella in superficie chimerico espressione TCR e la specificità. (A) HEK293T cellule transfected con il mouse TCR o un umano/mouse chimerici TCR in combinazione con mouse CD3εγδζ. Espressione di TCR superficie cellule è stata misurata con l'anticorpo anti-mCD3ε. Strategia di gating: in primo luogo, l'analisi è recintato su cellule positive doppie ametrino e GFP (G2). Nel caso di controlli singolo vettore il gating deve essere basata sulla fluorescenza singola (G1). In secondo luogo, le cellule da G1 e G2 sono analizzate per il livello di espressione di CD3ε. (B) TCR specificità è confermata dalla tetramero macchiatura delle cellule 293T con DRB1 * 0401:GAD115-127 tetramero. Analisi sono recintato su GFP + ametrino + CD3ε + cellule, come mostrato in (A). Clicca qui per visualizzare una versione più grande di questa figura.

GENE TARGET ORIENTAMENTO DI PRIMER SEQUENZA
Trascrizione inversa
CDNA TRAC AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
Reazione di PCR per TCR alfa 1
TRAV1-1 Avanti CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Avanti CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Avanti CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Avanti CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Avanti CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Avanti CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Avanti CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Avanti CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Avanti CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Avanti CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG Esterno TRAC Invertire CAGACAGACTTGTCACTGGATTTAGAGTCTC Reazione di PCR TCRbeta 1 TRBV2 Avanti CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Avanti CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Avanti CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Avanti CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Avanti CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Avanti CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Avanti CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Avanti CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Avanti CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Avanti CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Avanti CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Avanti CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Avanti CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Avanti CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Avanti CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Avanti CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Avanti CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Avanti CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Avanti CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Avanti CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Avanti CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Avanti CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Avanti CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Avanti CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Avanti CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Avanti CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC esterno Invertire GTGGCCAGGCACACCAGTGTG Reazione di PCR per TCR alfa 2 TRAC interna Invertire CAGCTGGTACAccgcggGGTCAGGGTTCTG Adattatore TRAV Avanti CGGTTCAGCAGGAATGCCtacgtaATG Beta TCR reazione di PCR 2 TRBC interno Invertire CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV adattatore Avanti CAGAAGACGGCATACGAGATcaattgATG Primer di sequenziamento pMSCV-II Avanti CCTCCTCTTCCTCCATCCGCC TCRbeta Invertire GCCAAGCACACGAGGGTAGCC IRES Invertire AACGCACACCGGCCTTATTCC * Minuscole all'interno delle sequenze primer indicano che l'enzima di restrizione incorporato taglio siti

Tabella 1: Reverse primer di sequenziamento, PCR e trascrizione.

Passaggio 2.2 importi per pozzetto
Reazione di RT-PCR (6μL) (ΜL)
buffer di 10 x 0.6
2 x dNTP 0,24
10% Triton X 0,06
3 iniettori TCR-specific (ea 10mM.) 0,23 ea. (x 3 = 0.69)
Enzima 0.18
Inibitore di RNAsi 0.28
NF(Nuclease-Free)-H2O 3,95
Fase 3.1
una reazione di PCR 1 (25μL) (ΜL) b reazione di PCR 1 (25μL) (ΜL)
buffer di 5 x 5 buffer di 5 x 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (3%) 0,75
una piscina (primer F) (2.3μM) 0.3 pool b (primer F) (2.3μM) 0,5
un primer R esterno (10uM) 0.6 primer di b esterno R (10μM) 1
DNA polimerasi 0.2 Vai Taq polimerasi 0.2
CDNA di RT-PCR 2.5 CDNA di RT-PCR 2.5
NF-H2O 14,65 NF-H2O 14,05
Passo 3.8
Reazione di PCR 2 - lo stesso vale per a e b (25μL) (ΜL)
buffer di 5 x 5
dNTP (10mM) 1
DMSO 0,75
Primer adattatore F (10μM) 1
Interno primer R (10μM) 1
DNA polimerasi 0.2
Prodotto di PCR rxn 1 2.5
NF-H2O 13,55

Tabella 2. Trascrizione d'inversione e reazioni di PCR.

Punti 4.2 e 4.3
Reazione di TRBV digest (50μL) (ΜL) digest di vettore mTCR-pMIA (500μL) (ΜL)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x Buffer 5 10 x Buffer 50
H2O H2O
Passo 4.4
Reazione di CIP (100 µ l) (ΜL) DNA(~1.5mg)
> Digerito & purificato il DNA del vettore 84 10 x Buffer 10 Enzima CIP 6 Passo 4.5 Reazione di legatura (20μL) (ΜL) DNA di vettore digerito/CIPed (importo totale di insert e vettore è ~ 150ng) Inserire il DNA (6 molare accesso al vettore) 2 x buffer di ligasi 10 Enzima ligasi 1 H2O Passo 4.9 Testare la reazione del Digest (12μL) (ΜL) DNA (100-300ng) 1 MfeI 0.25 BstbI 0.25 10 x Buffer 1.2 H2O 9.3 Passo 4.11 Reazione di TRAV digest (60μL) (ΜL) Beta contenente - mTCR-pMIA digest vettoriale (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 Silvio 2 BstbI 4 10 x Buffer 6 10 x Buffer 10 H2O H2O

Tabella 3. Vettore di clonazione reazioni.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Nel protocollo attuale, descriviamo un metodo efficiente per singola cella TCR amplificazione e successiva Sub-clonazione di accoppiati catene alfa e beta TCR in un vettore retrovirale espressione di modello. Anche se, sono stati sviluppati diversi protocolli di PCR di singola cellula, nessuno finora sono stati compatibili con immediata Sub-clonazione in un vettore di espressione. Nella maggior parte dei casi, una sequenza parziale che comprende le regioni CDR3 altamente variabile è amplificata, con abbastanza sequenza di estrapolare la regione variabile. Questo più piccolo formato del prodotto PCR supporta una maggiore efficienza PCR, ma necessita di sintesi de novo del gene TCR per studi funzionali. Il protocollo attuale mantiene l'efficienza dei protocolli di sequenziamento di TCR precedentemente pubblicati CDR3-messa a fuoco singola cella, mentre allo stesso tempo producendo un amplicone più lungo contenente la regione intera variabile adatta per clonazione. Di conseguenza, il sistema descritto ha una maggiore flessibilità nel dare una sequenza quantitativa, così come output funzionali.

A seconda la domanda scientifica indirizzata, l'origine e la specificità delle cellule di T analizzato può variare. Tuttavia, se l'obiettivo finale del progetto è l'analisi della funzione TCR in vivo , è necessario conoscere la restrizione HLA delle cellule di T isolate. Il protocollo attuale è stato specificamente progettato per essere compatibile con espressione di TCR in vivo in topi umanizzati HLA. Molti di questi topi sono stati generati e sono ora disponibili in commercio, tra cui HLA-a 2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 e ceppi transgenici HLA - B * 0702. Questo protocollo può essere combinato con successo con il protocollo precedentemente pubblicato per l'espressione di cellule staminali midollo osseo mediato retroviral di umano TCR4,15,16. Ci aspettiamo che il sistema di retrogenic TCR umanizzato sarà applicabile e molto utile per l'analisi funzionale del TCR umano in vari autoimmuni, il cancro e modelli infettive.

La cella singola corrente protocollo PCR vengono descritti i passaggi critici e dà i suggerimenti necessari per l'amplificazione di successo di accoppiato TCR-alfa e sequenze di TCR-beta. Il primo passaggio fondamentale è una prestazione tempestiva della trascrizione di cDNA e successivo primo turno di PCR multiplex. Tutti i passaggi coinvolti dovrebbero essere eseguiti in modo tempestivo, e tutti i reagenti e le cellule tenuta su ghiaccio per evitare la degradazione del RNA e cDNA. In secondo luogo, poiché il protocollo è progettato per essere altamente sensibili ai bassi livelli del modello, è altamente sensibile alla contaminazione. Pertanto, è imperativo per lavorare in una zona priva di modello, lontano da prodotti amplificati di PCR o TCR vettoriale clonazione. Un locale separato o cappa deve essere utilizzato per impostare cDNA e reazioni di PCR. Modello dalla prima reazione di PCR deve essere aggiunto in una zona diversa da dove la PCR è impostata. È consigliabile che un set separato di reagenti aliquotati essere usato per gli esperimenti PCR di singola cellula.

Questo protocollo è stato specificamente ottimizzato utilizzando i reagenti elencati nella Tabella materiali, ed eventuali sostituzioni di reagenti richiederà ulteriore ottimizzazione. L'identificazione iniziale delle cellule antigene-specifiche può essere modificato per utilizzare tetrameri MHC-peptide. Tetramero colorazione consente una valutazione simultanea di specificità antigenica, così come HLA-restrizione. Metodi alternativi per la rilevazione della reattività dell'antigene, come il upregulation dei marcatori di attivazione precoce o la secrezione di citochine infiammatorie possono essere considerati in assenza di reagenti tetramero. Ad esempio, gli anticorpi di fusione doppia specificità specifici per un antigene delle cellule T e IFNγ combinabile con isolamento di biglie magnetiche per arricchire per cellule reattive di IFNγ producendo l'antigene.

Mentre il costrutto chimerico umano/mouse descritto nel nostro protocollo garantisce la compatibilità con cellule di topo, il livello della sua compatibilità con il complesso CD3 umano è sconosciuto. Anche se non formalmente testato da noi, altri hanno indicato che costrutti chimerici TCR con murine regioni costante possono essere espresso sulla superficie dei linfociti umani17. Questo indica che murine regioni costante di TCR possono supportare l'interazione con l'umano complesso CD3 segnalazione. Tuttavia, se l'obiettivo è di esprimere il TCR identificati in cellule primarie umane o linee cellulari umane, quali le cellule Jurkat, un approccio più ottimale potrebbe essere utilizzare un costrutto pienamente umano. Questo può essere realizzato scambiando la murine costante all'interno del vettore umani costante regioni regioni.

Se una regione variabile di TCR identificata contiene uno dei siti di restrizione utilizzati per la clonazione, il TCR deve essere inserito in un vettore navetta e successivamente mutato utilizzando un kit di mutagenesi sito diretta per indurre un cambiamento del nucleotide silenzioso all'interno la restrizione tagliare il sito. Un approccio alternativo è la sintesi de novo della regione variabile TCR di interesse modificato per escludere il sito di restrizione indesiderati.

La limitazione principale di questa tecnica è l'incapacità di eliminare l'amplificazione delle catene alfa 'citoplasmiche' secondarie. TCR-alfa geni non andare attraverso l'esclusione allelica come geni di TCR-beta, così che una percentuale significativa di cellule T esprimerà una secondaria catena alfa 'citoplasmico'14. Il protocollo PCR descritto si traduce solo in amplificazione di una catena alfa di TCR, ma se la catena alfa amplificata è la catena alfa 'citoplasmico', che esso non può accoppiare con la catena beta amplificato. Pertanto, è imperativo per testare espressione superficiale di TCR delle cellule in cellule HEK293T affinché la catena di successo di accoppiamento.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Questo studio è stato finanziato dal JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 pilota PJ e The Robert e Janice McNair Foundation.

Ringraziamo Sandra Pena e Andrene McDonald per il reclutamento dei pazienti, Samuel Blum per l'assistenza tecnica, Dr. George Makedonas per il dono di anticorpi e di controllo utilizzato per l'ottimizzazione di PCR del DNA.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Razionalizzato isolamento di singole cellule TCR e generazione di vettori retrovirali per <em>In Vitro </em>e <em>In Vivo</em> l'espressione del TCR umano
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter