Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Strømlinjeformet enkeltcelle TCR isolasjon og generasjon Retroviral vektorer for In Vitro og i Vivo uttrykk for menneskelige TCRs

doi: 10.3791/55379 Published: September 10, 2017

Summary

Det gjeldende protokoll kombinerer enkeltcelle sammen menneskelige TCR alfa og beta kjede sekvensering med strømlinjeformet generasjon retroviral vektorer kompatibel med i vitro og vivo TCR uttrykk.

Abstract

Selv om flere metoder for sekvensering av parvise T-celle reseptor (TCR) alfa og beta kjettinger fra enkelt T-celler er utviklet, har ingen så langt vært bidrar til nedstrøms i vivo funksjonell analyse av TCR heterodimerer. Vi har utviklet en forbedret protokoll basert på en to-trinns multiplex-nestede PCR, som resulterer i et PCR-produkt som spenner over hele variabel regioner av en menneskelig TCR alfa og beta kjeder. Ved å identifisere unike begrensning nettsteder og innlemme dem i PCR primere, har vi gjort PCR produktet kompatibel med direct sub kloning i malen retroviral vektoren. Den resulterende retroviral konstruere koder en chimeric menneskelige/mus TCR med et mus intracellulær domene, som fungerer i musen celler eller i vivo musen modeller. Samlet kombinerer protokollen beskrevet her menneskelig enkeltcelle sammen TCR alfa og beta kjede identifikasjon med strømlinjeformet generasjon retroviral vektorer lett tilpasses i vitro og vivo TCR uttrykk. Videoen og det medfølgende materialet er utformet for å gi en svært detaljert beskrivelse av enkeltcelle PCR, slik at kritiske trinnene blir fulgt og potensielle fallgruver unngått. I tillegg gir vi en detaljert beskrivelse av kloning trinnene nødvendig å generere uttrykk vektoren. Når mestret, kan hele prosedyren fra enkelt celle sortering TCR uttrykket utføres i en kort to-ukers periode.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

T-celle reseptor (TCR) tilsier T celle skjebne beslutning under utvikling, steady state/homeostase og antigen stimulering i periferien1,2,3. Siste utvidelsen av dype sekvensering teknologi har avdekket en tidligere underappreciated TCR mangfold i antigen-spesifikke T celle svar. TCR mangfold antyder et potensial for funksjonelt bred T celle svar. For å integrere TCR sekvens repertoar analysen med TCR funksjonelle analyser, bør sekvensering tilnærminger være utformet å være kompatibel med eksperimentelle systemer og i vivo modeller benyttet for påfølgende funksjonell analyse av velger TCRs. Vi har utviklet en effektiv fremgangsmåte for menneskelig TCR sekvens isolasjon og strømlinjeformet sub kloning i en chimeric menneskelige/mus TCR mal vektor kompatibel med TCR uttrykk i HLA-humanized mus4. Isolasjon av tilsvarende alfa og beta kjeder av heterodimeric TCRs krever PCR forsterkning av både kjeder fra én enkelt celle. Selv om flere encellede TCR kloning protokoller har vært utviklet og benyttet, har ingen så langt vært lett kompatibel med høy gjennomstrømming strømlinjeformet direkte kloning av ukjent Vα/Vβ TCRs i retroviral vektorer nødvendig for re uttrykket i vivo 4,5,6,7. Tidligere studier har benyttet to store tilnærminger, enten å selektivt forsterke en begrenset del av TCR tilstrekkelig å ekstrapolere sekvensen, eller å forsterke det hele TCR sekvens4,5,6 , 7. nedstrøms funksjonell analyse av TCR sekvenser Hentet via første tilnærmingen krever kostbar i sili montering og de novo byggingen av TCR. Mens den andre tilnærmingen gir komplett TCR sekvensen, er menneskelige konstant regionen ikke kompatibel med i vivo uttrykk for de klonede TCRs musen modeller. Vår tilnærming er spesielt designet for å være kompatibel med i vivo funksjonell analyse av TCRs musen modeller. Vi utviklet en effektiv og strømlinjeformet enkeltcelle PCR-protokoll som tillater direkte sub kloning av PCR i malen uttrykk vektor.

Vår tilnærming benytter en svært følsom multiplex-nestede PCR reaksjon som utføres i to trinn. I den første multiplex reaksjonen trinn en pool av 40 primere gjelder alle V-beta kjedene og en pool av 44 primere bestemt for alle V-alfa kjedene brukes til å forsterke TCR-alpha- eller TCR-beta uten forutgående kunnskap om sekvensen (tabell 1). Fremover Primeren har en adapter-rekkefølge, som er innlemmet i den 5' PCR produktet. Omvendt primer er basert på konstant regionen TCR. Vi har identifisert unik begrensning områder som er borte fra menneskelige variabel eller krysset TCR regioner og innarbeidet dette i nydesignede TCRα og TCRβ primere (figur 1). I den andre nestede reaksjonen brukes en primer spesifikke for adapter sekvensen og en nestet omvendt primer i konstant regionen til å ytterligere forsterke TCR kjeder med økt spesifisitet (tabell 1, figur 1). Etter enkeltcelle isolasjon, to runder med PCR (første reaksjon med en pool av både Vα og Vβ primere, og andre med adapter primere) resultere i et PCR-produkt som kan være direkte sub klonet i malen retroviral vektoren. Den endelige TCR konstruere kan kode, i en enkelt åpent lesing ramme (ORF), menneskelige variabel regioner kombinert med musen konstant regioner forbundet med 'selv cleaving' protein sekvensen, P2A (hVα-mCα-P2A-hVβ-mCβ)8. Den P2A sekvensen er brukt i flere systemer, og er blitt omfattende testet for uttrykket TCRs8,9,10,11. Selv etter oversettelse mesteparten av P2A rekkefølge restene knyttet til C-terminus av alpha kjeden koblet av et fleksibelt linker, mens beta kjeden signal sekvensen har en ekstra proline, denne endringen påvirker ikke skadelig TCR funksjon. Musen konstant regionen brukes i konstruksjonen i stedet for menneskelig for å unngå potensielle endret interaksjon med nedstrøms signalnettverk komponenter når nytt uttrykt i musen celler. Den eneste ORF vil føre stoichiometric separat uttrykk i alfa og beta kjeder9,11. Gjeldende protokollen er basert på reagenser og tilnærminger som er allment tilgjengelig, og er utformet som skal utføres i en strømlinjeformet og effektiv måte. Selv om vi har spesielt brukt denne teknikken til analysen TCRs fra self-reactive T celler innblandet i autoimmune diabetes, forventer vi at denne protokollen kan være allment gjeldende for identifikasjon og funksjonelle vurdering av menneskelig TCRs spesifikke for autoimmune epitopes, kreft epitopes eller svar til patogener og vaksiner.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. identifisere T celle befolkningen rundt.

Merk: Antigen bestemt spredning i kombinasjon med celledeling fargestoff (som Carboxyfluorescein succinimidyl ester, CFSE) kan brukes til å isolere T celler basert på deres spredning i reaksjon på antigen stimulering. Hvis starter fra PBMCs, en 7-dagers i vitro utvidelse bør være tilstrekkelig til å identifisere en antigen bestemte CFSE lavt befolkningstall 12.

  1. Blanding PBMCs 1:1 med MHC samsvar mater celler og etikett med 5 µM CFSE celledeling fargestoff.
  2. Plate 2-2.5 x 10 5 celler per brønn i en 96-brønns runde-bunn kultur plate i 200 µL 10% FCS komplett RPMI media.
    Merk: Komplett RPMI inneholder 2 mM l-glutamin, 1 mM natrium pyruvate, 100 µM MEM unødvendige aminosyrer, 5 mM HEPES, 5.5 × 10 − 5 enheter av 2-mercaptoethanol, 100 U mL − 1 penicillin og 100 µg mL − 1 streptomycin.
  3. Stimulere cellene med 25 µM peptid antigen.
  4. På den fjerde dagen av kultur, nøye fjerne og erstatte 100 µL medier.
    Merk: En mer optimal tilnærming til antigen-spesifikke T celle identifikasjon er bruk av peptid-HLA tetramers 13. Tetramer flekker tillater samtidig vurdering av antigen spesifisitet, samt HLA-begrensning.

2. Definere enkeltcelle sorteringen.

  1. Utføre alle prosedyrer i en hette eller et angitt område uten forsterket mal. Aliquot reagenser å unngå forurensning, Rengjør alle arbeidsflater og, hvis mulig, utstyr med 10% bleke før PCR oppsett. Bruk filter tips, RNAse og DNAse gratis reagenser og plast PCR og vektor kloning trinnene. Nøkkel reagenser kan finnes i Tabell for materiale.
    Merk: Multiplex PCR reaksjonen er svært følsom og lave nivåer av forurensning kan føre til forsterket produktet.
  2. Generer omvendt transkripsjon master mix ved å kombinere 10 x RT reaksjon buffer, 25 X DNTPs, 9 U RT enzym, 0,01% Triton-X, 0,7 U RNAse inhibitor, og 383 nM i hver RT-TCR primer (oppført i tabell 1) i et sterilt pipettering reservoar. For hver 96-brønns plate, kan du gjøre opp nok master blanding for 10 ekstra reaksjoner (totalt 106), å kompensere for tap av væske under pipettering. Se tabell 2 for reaksjon komponenter og beløp per brønn.
  3. Forberede en 96-brønns PCR samling plate for celle sortering etter pipettering 6 µL av omvendt transkripsjon master mix per godt med en flerkanals pipette. Holde platen på is eller en kald blokk.
  4. Merke celler med antistoffer til celle overflate markører (som CD4 og CD3, eller CD8 og CD3, hver på 2 µg/mL, i kombinasjon med celledeling fargestoff eller tetramer flekker).
  5. Sorter T-celler på en celle per brønn, hopper den tolvte raden, som vil tjene som en negativ kontroll.
    Merk: Effektiviteten av sorteringen vil avhenge presis samlingen plate innretting innehaveren av platen, i tillegg til å vedlikeholde celler og plater på en lav temperatur før cDNA reaksjon. Samling plater bør holdes på is til alle tider, unntatt under sortering, når de er fast i kjøleplaten. Ikke alle sorters er utstyrt med en temperatur regulert platen holder; men anbefales bruk av en sterkt. Siden sorteringen tar vanligvis ca 10-15 min per plate, det er en økt potensial for RNA fornedrelse hvis platen ikke brukes på en lav temperatur.
  6. Som en positiv, legge til et større antall celler (100 celler) manuelt med en pipette i en av brønnene på dette stadiet. Alternativt, tidligere isolert RNA fra grupperte cellene kan brukes som en positiv på 10 ng per brønn.
    Merk: Pipetter renset kontroll RNA med presisjon og vare for å unngå kryss-smitte og andre falske positive resultater.
  7. Forsegle platen med lim og spinne ned 1000 x g i 5 min på 4 ° C.
  8. Umiddelbart transkribere RNA til cDNA av rugende platen ved 25 ° C i 10 min, 37 ° C i 45 min, og 85 ° C for 10 min.
    Merk: For å sikre effektiv PCR reaksjon, anbefales det at den første PCR reaksjonen utføres samme dag. Alternativt transkribert platene kan holdes i-80 ° C for opptil 2 måneder.

3. Utføre multiplex-nestede PCR

Merk: forberede alle master blander i en ren mal fritt område å unngå forurensning.

  1. Rekonstituer hver variable regionen primer 100 µM med DNAse og RNAse gratis H 2 O. Deretter kombinere 20 µL av 44 primerne generere V-alfa primer bassenget. For å generere V-beta primer bassenget kombinere 20 µL av hver av de 40 V-beta-primerne pluss 80 µL av DNAse og RNAse gratis H 2 O. Primer sekvenser er oppført i tabell 1. Når samlet, konsentrasjonen av hver primer i miksen er 2,3 µM.
  2. Gjeninnføre de konstante regionen primerne for 100 µM lager løsning med DNAse og RNAse gratis H 2 O. Dilute konstant region primerne 10 µM fungerende løsning og aliquot for bruk.
  3. Forberede to separate master mikser TCR-alfa og TCR-beta forsterkning. Generere master mikser ved å kombinere 5 X buffer, 80 µM dNTPs, 3% DMSO 2 µM primer bassenget (siste konsentrasjon av 46 nM for hver innføring), 200 nM TCR konstant regionen omvendt primer, 1 U DNA utvalg og DNAse og RNAse gratis H 2 O (tabell 2 < / strong >). For hver 96-brønns plate, gjøre opp nok master blanding for 10 ekstra reaksjoner (totalt 106), for å kompensere for tap av væske under pipettering.
    Merk: Beregningene er basert på siste PCR volumet av 25 µL per brønn, hvor 22,5 µL master PCR blanding er kombinert med 2,5 µL cDNA mal.
  4. Holde platen med cDNA på is eller en kald blokk. Bruk en for å Pipetter 22,5 µL av TCR-beta reaksjon i en ny 96-brønns PCR plate. Bruk deretter en overføre 2,5 µL av cDNA inn i PCR plate.
  5. Bruker en til Pipetter 22,5 µL av TCR-alfa reaksjon direkte inn platen med resten av cDNA.
  6. Forsegle platene med lim, forsiktig vortex og spinn ned 1000 x g i 5 min på 4 ° C.
  7. Kjøre multiplex PCR reaksjonen med følgende sykluser: 5 min på 95 ° C etterfulgt av 34 sykluser av 20 s på 95 ° C, 30 s på 54 ° C, og 1 min ved 72 ° C, etterfulgt av 7 min ved 72 ° C.
  8. Bære ut nestede PCR i et siste volum på 25 µL, bruker 2,5 µL av multiplex PCR blandingen som mal.
    1. Rekonstituer interne og adapter primerne til 100 µM med DNAse og RNAse gratis H 2 O. gjøre 10 µM dele leter arbeide.
    2. Forberede to separate master mikser TCR-alfa og TCR-beta amplification. Mix 5 X buffer, 25 X DNTP, 3% DMSO 200 nM frem adapter primer, 200 nM omvendt nestede primer, 1 U DNA polymerase, og DNA polymerase og nuclease-fri H 2 O til en endelig mengde 22,5 µL (tabell 2). For hver 96-brønns plate, gjøre opp nok master blanding for 10 ekstra reaksjoner (totalt 106), å kompensere for tap av væske under pipettering.
      Merk: I andre PCR reaksjon bruk 5 X PCR buffer inneholder lasting fargestoff til rette agarose gel lasting.
    3. Ved å bruke en, Pipetter master mikser til TCR-alfa og TCR-beta reaksjonene på 22,5 µL per brønn i to nye 96-brønns PCR platene.
    4. Legge til malen for multiplex PCR-reaksjon på 2,5 µL per brønn.
      Merk: Den gjenværende første PCR reaksjonen bør være forseglet og lagret på 20 ° C til å tjene som en kilde til ekstra mal, hvis det blir nødvendig (se trinn 4,3 Merk).
    5. Forsegle den plater, forsiktig vortex og spinn ned 1000 x g i 5 min på 4 ° C.
    6. Kjøre nestede PCR reaksjonen med følgende sykluser: 5 min på 95 ° C etterfulgt av 34 sykluser av 20 s på 95 ° C, 30 s på 56 ° C, og 1 min ved 72 ° C, etterfulgt av 7 min ved 72 ° C.
    7. Kjører 5 µL av siste reaksjonen ut på en 1% agarose gel inneholder ethidium bromide (inkludert negative og positive kontroll brønnene).
      Merk: Forventet bandet bør kjøre rundt 500 bp størrelse. En eksempel reaksjon er vist i figur 2.
    8. Renser resten av andre reaksjonen (20 µL) benytter en 96-brønns formatter PCR rensing kit, elute med 15 µL av 70 ° C H 2 O per brønn og utføre Sanger sekvensering. Bruk den aktuelle TCR-alfa eller TCR-beta adapter frem primeren for sekvensering (tabell 1).
      Merk: Sekvenser kan analyseres med online tilgjengelig immunogenetics programvare.

4. Sub kloning alfa og beta PCR kjeder.

Merk: bassenget frem primerne benyttet i den første reaksjonen og omvendt primerne i andre PCR reaksjonen brukes å innlemme begrensning nettsteder. Derfor innhentet alfa og beta kjede PCR produktene er klar til å bli sekvensielt sub klonet i malen retroviral vektor ( figur 1).

  1. Fordøye det renset PCR produkter fra beta nestet reaksjon med BstbI og MfeI (tabell 3).
    Merk: Ikke overstige 5 µg insert.
  2. Parallelt, fordøye mal vektoren med BstbI og MfeI (tabell 3). Bruke 1-2 µg av malen vektoren per TCR. Kjøre fordøyd vektoren på en agarose gel og isolere større bandet (~ 7500 bp). Rense vektor med en gel DNA rensing kit.
    Merk: Under begrensning enzym sammendraget, mal murine TCR-beta variable regionen er fjernet, slik at tillegg av menneskelig TCR-beta variable regionen.
  3. Renser fordøyd PCR produktene bruker et PCR rensing kit.
    Merk: Bekreft DNA rensing kapasitet i kolonnene som vises i kit; Bruk flere kolonner om nødvendig. Minimumsmengden av en renset setter nødvendig for en vellykket ligation reaksjon er 50 ng på en minimum konsentrasjon av 10 ng/µL. Hvis renset sett inn beløpet ikke er tilstrekkelig for en vellykket ligation, andre PCR reaksjonen kan gjentas.
  4. Behandle malen vektoren med 10 U CIP enzym 1t på 37 ° C å hindre selv hemorroider, etterfulgt av varme inaktivering i 10 min på 75 ° C. rense DNA med en PCR rensing kit (tabell 3).
  5. Ligate TCR-beta sett og vektor bruke DNA ligase i et 20 µL totalvolum på 6 molar overkant av sette for 30 min ved romtemperatur.
    Merk: Totalt ligation reaksjonen skal inneholde ca 150 ng DNA (tabell 3).
  6. For transformasjoner, bland 8 µL av hemorroider reaksjon med 80 µL av kjemisk kompetent E.coli DH5α celler (Tabell for materiale) og ruge på is 30 min. heten støt ved 42 ° C i 45 s. legge 500 µL Super Optimal buljong med Catabolite undertrykkelse (S.O.C.) medium og riste for 1,5 t på 37 ° C.
  7. Plate ut 250 µL av bakteriell kultur på en ampicillin inneholder Lysogeny kjøttkraft (LB) agar plate. Inkuber platen over natten (~ 16 h) på 37 ° C.
  8. Neste dag plukke bakteriell koloniene, og vokse dem i 3 mL LB medium som inneholder ampicillin over natten. Isolere plasmider DNA ved hjelp av DNA plasmider rensing kit.
  9. Bekrefte vellykket innsetting av beta kjeden av en småskala test-digest med begrensning enzymer BstbI og MfeI. I et 12 µL totale reaksjon volum, kombinere 200-500 µg plasmider DNA, 0,25 µL av hver enzym og 10 X enzym buffer (tabell 3). Kjøre reaksjonen ut på en 1% agarose gel inneholder ethidium bromide for å bekrefte størrelsen på Sett inn bandet (~ 500 bp).
  10. Etter bekrefter tilstedeværelsen av innsatsen, sekvens delen TCR-beta av vektoren bruker IRES omvendt primer (tabell 1).
  11. Følgende sekvens bekreftelse av TCR-beta sette, utføre en lignende prosess for innsetting av alpha variable regionen. Fordøye det rensede PCR produktene fra Alfa nestede reaksjonen og nygenererte TCR-beta innsatsen som inneholder vektor, med SnaBI og SacII.
    Merk: Under begrensning enzym sammendraget, mal murine TCR-alfa variable regionen er fjernet, slik at tillegg av menneskelig TCR-alfa variable regionen.
  12. Ligate alfa setter inn TCR vektorer koding tilsvarende beta variable regionen bruke DNA ligase i et 20 µL totalvolum på 6 molar overkant av sette for 30 min ved romtemperatur.
    Merk: Totalt ligation reaksjonen skal inneholde ca 150 ng DNA (tabell 3).
  13. For transformasjoner, bland 8 µL av hemorroider reaksjon med 80 µL av kjemisk kompetent E.coli DH5α celler (Tabell for materiale) og ruge på is 30 min. heten støt ved 42 ° C i 45 s. legge 500 µL S.O.C. medium og riste for 1,5 t på 37 ° C.
  14. Plate ut 250 µL av bakteriell kultur på en ampicillin inneholder Lysogeny kjøttkraft (LB) agar plate. Inkuber platen over natten (~ 16 h) på 37 ° C.
  15. Neste dag plukke bakteriell koloniene, og vokse dem i 3 mL LB medium som inneholder ampicillin over natten. Isolere plasmider DNA ved hjelp av DNA plasmider rensing kit.
  16. Bekrefte vellykket innsetting av alpha kjeden av en småskala test-digest med begrensning enzymer SnaBI og SacII. I et 12 µL totale reaksjon volum kombinere 200-500 µg plasmider DNA, 0,25 µL av hver enzym og 10 x enzym buffer (tabell 3). Kjøre reaksjonen ut på en 1% agarose gel inneholder ethidium bromide for å bekrefte størrelsen på Sett inn bandet (~ 500 bp).
  17. Etter bekrefter tilstedeværelsen av innsatsen, sekvens delen TCR-alfa vektoren bruker MSCV2 fram primer (tabell 1).
  18. Når alfa kjede sekvensen er validert, bekrefte komplett TCR innsatsen ved sekvensering med TCR-beta-revers og IRES invertering primer (tabell 1).

5. Kontroller TCR cellen overflaten uttrykk og spesifisitet.

Merk: HEK293T celler brukes til å teste vellykket TCR kjeden paring og celle overflaten uttrykk ( figur 3A) 8. Peptid-MHC tetramer flekker kan også utføres på transfekterte HEK293T cellene å teste for oppbevaring av antigen spesifisitet innlegget TCR genet isolasjon ( figur 3B).

  1. Plate ut HEK293T celler i 12-vel vev kultur plater på 1 x 10 5 celler per brønn i 1 mL komplett DMEM media som inneholder 5% FCS og kultur overnatting på 37 ° C. Plate ut nok celler til angitte separat brønner for hver nye TCR , kontroll mal TCR vektor, CD3 vektor, kontrollere TCR vektor bare, og en ikke-transfekterte vel.
    Merk: Hva med en fullt musen mal TCR vektor (mTCR-pMIA) i kombinasjon med mCD3εγδζ-pMIG vektor, mTCR-pMIA vektor alene, og mCD3εγδζ-pMIG vektor alene brukes som positive og negative kontroller.
    Merk: Komplett DMEM inneholder 2 mM L-glutamin, 1 mM natrium Pyruvate, 100 µM ikke-essensielle aminosyrer, 5 mM HEPES buffer, 5.5 x 10 -5 enheter av 2-mercaptoethanol, 100 U/ml Penicillin/Streptomycin.
  2. Dagen transfect cellene med 1 µg chimeric h/mTCR-pMIA vektor, 1 µg musen CD3εγδζ-pMSCVII-GFP (pMIG) vektor og en liposome-baserte transfection reagens følge instruksjonene fra produsenten.
  3. For hver TCR, legge 6 µL transfection reagens til 100 µL romtemperatur, serum-free DMEM. Kort virvelen, og Inkuber ved romtemperatur i 15 min.
  4. i separate 1,5 mL rør kombinere 1 µg av TCR-pMIA vektor med 1 µg musen CD3εγδζ-pMSCVII-GFP (pMIG) vektor eller 1 µg av hver vektor separat for kontroller.
  5. Dropwise, legge til hva reagens/DMEM løsningen rørene som inneholder vector DNA. Inkuber ved romtemperatur i 15 min.
  6. Dropwise, legge til hva reagens/DMEM/DNA løsningen HEK293T cellene. Forsiktig Tapp plate å blande. Inkuber ved 37 ° C i 24 h.
  7. Etter 24t erstatter media, og holde celler i kultur for ekstra 24 h.
  8. Fjerne celler fra platen av energisk pipettering og flekken cellene med anti-musen CD3 antistoff (2,5 µg/mL) til å kontrollere overflaten uttrykk for chimeric-TCR av flowcytometri.
  9. For å sammenligne CD3 uttrykk mellom celler som var transfekterte til nivå, gate analysen på celler som uttrykker lignende høy fluorescerende reporter molekyler (GFP for CD3 komplekse og Ametrine for TCR uttrykk vektor). Optimalt, analysen bør være gated på GFP + Ametrine + celler innenfor 10 4 til 10 5 fluorescerende intensitet ( figur 3A).
    Merk: Nivået av CD3 uttrykk i celler transfekterte med den chimeric konstruere skal sammenlignes for kontroll mus (opprinnelige malen) vektoren ( figur 3A). Genererte TCR retroviral vektorer er kompatibel med i vivo uttrykk systemer som tidligere beskrevet 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Effektiviteten av multiplex-nestede PCR reaksjonen kontrolleres i trinn 3.2.7 (figur 2) ved å kjøre ut 5µL av andre reaksjon på en agarose gel. Gjennomsnittlig effektiviteten av TCR-beta forsterkning forventes å være rundt 80%, mens effektiviteten av TCR-alfa reaksjonen er vanligvis lavere, rundt 50%4. Bare paret TCR-alfa og TCR-beta kjeder kan brukes for TCR uttrykk. men kan alle PCR produkter være rekkefølge for å få TCR sekvens og repertoar informasjon.

Gene stanse tillater bare en enkelt TCR-beta kjeden å bli uttrykt i en gitt T-celle. Men en T-celler er i stand til å omorganisere en andre TCR-alfa kjede, og ca 25% av T-celler uttrykke en andre i-ramme TCR-alfa kjede 14. Det forventes at noen andelen isolert TCR-alfa kjedene vil være sekundær alfa i stedet for den "riktig" alfa kjeden. Den sekundære alfa kjeden er ofte ikke en optimal bindende partner med TCR-beta kjeden; Derfor er det forventet at ikke alle klonet TCRs vil danne en stabil komplekse og uttrykke på cellens overflate. Derfor har riktig TCR kjeden sammenkoblingen og celle overflaten uttrykket bekreftes av transfecting HEK293T celler (figur 3A).

Figure 1
Figur 1 . Strømlinjeformet multiplex-nestede PCR og retroviral konstruere utvikling enkelt T-celler. To rundene PCR føre forsterkning av tilsvarende TCR alfa og beta kjeder. Begrensning nettsteder innebygd i primerne tillate strømlinjeformet sub kloning og generering av menneskelige/mus chimeric vektor for uttrykk i mus celler. Malen musen vektoren kan brukes til å enkelt bytte ut variabel musen regioner som menneske, generere en chimeric menneskelige/mus TCR retroviral vektor kompatibel med uttrykk i mus celler. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 . Eksempel på enkeltcelle PCR. Multiplex nestede PCR forsterkning av T celle reseptor beta og alpha kjeder fra enkelt menneskelige T celler sortert i en 96-brønns plate. Vist er tilsvarende (topp og bunn) PCR produkter fra enkelt celle forsterket TCR beta og TCR alpha kjeder fra menneskelige PBMCs. NC - malen kontroll PC - positiv kontroll. Kjører en liten del av reaksjonen på en agarose gel (5 µL), bekreftes effektiviteten av enkeltcelle alfa og beta kjede PCR reaksjonene før PCR produktet sekvensering. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 . Verifisering av cellen overflaten chimeric TCR uttrykk og spesifisitet. (A) HEK293T cellen var transfekterte med mus TCR eller human/mus chimeric TCR i kombinasjon med musen CD3εγδζ. Celler overflaten TCR uttrykket ble målt med anti-mCD3ε antistoff. Gating strategi: først analysen Portes på Ametrine og GFP dobbel positiv celler (G2). I enkelt vektor kontroller har av gating basert på den eneste fluorescensen (G1). Andre analyseres cellene fra G1 og G2 for det CD3ε uttrykket. (B) TCR spesifisitet er bekreftet av tetramer farging av 293T celler med DRB1 * 0401:GAD115-127 tetramer. Analyse er gated på GFP + Ametrine + CD3ε + celler, som vist i (A). Klikk her for å se en større versjon av dette tallet.

MÅLET GENET PRIMER ORIENTERING SEKVENS
Omvendt transkripsjon
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR alpha PCR reaksjon 1
TRAV1-1 Fremover CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Fremover CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Fremover CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Fremover CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Fremover CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Fremover CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Fremover CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Fremover CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Fremover CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Fremover CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC ekstern Omvendt CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR reaksjon 1 TRBV2 Fremover CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Fremover CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Fremover CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Fremover CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Fremover CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Fremover CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Fremover CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Fremover CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Fremover CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Fremover CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Fremover CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Fremover CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Fremover CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Fremover CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Fremover CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Fremover CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Fremover CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Fremover CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Fremover CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Fremover CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Fremover CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Fremover CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Fremover CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Fremover CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Fremover CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Fremover CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC ekstern Omvendt GTGGCCAGGCACACCAGTGTG TCR alpha PCR reaksjon 2 TRAC interne Omvendt CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV adapter Fremover CGGTTCAGCAGGAATGCCtacgtaATG TCR beta PCR reaksjon 2 TRBC interne Omvendt CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV adapter Fremover CAGAAGACGGCATACGAGATcaattgATG Sekvensering primere pMSCV-II Fremover CCTCCTCTTCCTCCATCCGCC TCRbeta Omvendt GCCAAGCACACGAGGGTAGCC IRES Omvendt AACGCACACCGGCCTTATTCC * Små bokstaver i primer sekvensene angi innarbeidet begrensning enzymet kutte områder

Tabell 1: Omvendt transkripsjon, PCR og sekvensering primere.

Trinn 2.2 Beløpene per brønn
RT PCR reaksjon (6μL) (ΜL)
10 x-buffer 0,6
2 x dNTP 0.24
10% Triton X 0,06
3 TCR-spesifikke primere (10mM ea.) 0,23 ea. (x 3 = 0.69)
Enzym 0,18
Rnase hemmer 0.28
NF(nuclease-Free)-H2O 3.95
Trinn 3.1
en PCR reaksjon 1 (25μL) (ΜL) b PCR reaksjon 1 (25μL) (ΜL)
5 x-buffer 5 5 x-buffer 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (3%) 0,75
et basseng (F primer) (2.3μM) 0,3 b bassenget (F primer) (2.3μM) 0,5
en ekstern R primer (10uM) 0,6 b ekstern R primer (10μM) 1
DNA polymerase 0,2 Gå Taq utvalg 0,2
RT PCR cDNA 2.5 RT PCR cDNA 2.5
NF-H2O 14.65 NF-H2O 14.05
Trinn 3.8
PCR reaksjon 2 - samme for en og b (25μL) (ΜL)
5 x-buffer 5
dNTP (10mM) 1
DMSO 0,75
Adapter F primer (10μM) 1
Intern R primer (10μM) 1
DNA polymerase 0,2
PCR rxn 1 produkt 2.5
NF-H2O 13.55

Tabell 2. Tilbakefør transkripsjon og PCR reaksjoner.

Trinn 4.2 og 4.3
TRBV ufullstendig reaksjon (50μL) (ΜL) mTCR-pMIA vector Sammendrag (500μL) (ΜL)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x Buffer 5 10 x Buffer 50
H2O H2O
Trinn 4.4
CIP reaksjon (100μL) (ΜL) DNA(~1.5mg)
> Fordøyd & renset vektor DNA 84 10 x Buffer 10 CIP enzym 6 Trinn 4.5 Hemorroider reaksjon (20μL) (ΜL) Fordøyd/CIPed vektor DNA (Sett inn og vektor totalbeløpet er ~ 150ng) Sett inn DNA (6 molar tilgang til vektor) 2 x Ligase buffer 10 Ligase enzym 1 H2O Steg 4,9 Teste Digest reaksjon (12μL) (ΜL) DNA (100-300ng) 1 MfeI 0,25 BstbI 0,25 10 x Buffer 1.2 H2O 9.3 Trinn 4.11 TRAV ufullstendig reaksjon (60μL) (ΜL) Beta inneholder - mTCR-pMIA vector Sammendrag (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x Buffer 6 10 x Buffer 10 H2O H2O

Tabell 3. Vector kloning reaksjoner.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

I den gjeldende protokollen beskriver vi en effektiv metode for enkelt celle TCR forsterkning og påfølgende sub kloning av sammenkoblede TCR alfa og beta kjeder i en mal retroviral uttrykk vektor. Selv om flere enkeltcelle PCR protokoller er utviklet, har ingen så langt vært kompatibel med umiddelbar sub kloning i et uttrykk vektor. I de fleste tilfeller, er en delvis sekvens omfatter den svært variabel CDR3 områder forsterket, med nok orden å ekstrapolere variable regionen. Denne mindre PCR produktet størrelse støtter høyere PCR effektivitet, men nødvendiggjør de novo TCR gen syntese for funksjonell studier. Gjeldende protokollen opprettholder effektiviteten av tidligere publiserte CDR3-fokusert enkeltcelle TCR sekvensering protokoller, mens på samme tid gir en lengre amplicon som inneholder hele variable regionen egnet for kloning. Derfor har systemet beskrevet en økt fleksibilitet i å gi en kvantitativ sekvens, samt funksjonelle utgang.

Avhengig av vitenskapelige spørsmålet adressert, kan kilde- og spesifisitet av T-celler analysert variere. Men hvis målet med prosjektet er analysen av funksjonen i vivo TCR, er det nødvendig å kjenne begrensning HLA isolert T-celler. Gjeldende protokollen har blitt spesielt designet for å være kompatibel med i vivo TCR uttrykk i HLA-humanized mus. Mange av disse musene er generert, og er nå kommersielt tilgjengelig, inkludert HLA-A2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 og HLA - B * 0702 transgene stammer. Denne protokollen kan med hell kombineres med tidligere publiserte protokollen for retroviral mediert benmarg stamcelleforskningen uttrykk for menneskelige TCRs4,15,16. Vi forventer at humanized TCR retrogenic systemet blir gjeldende og svært nyttig for funksjonell analyse av menneskelig TCRs i ulike autoimmune, kreft og smittsomme modeller.

Gjeldende enkelt celle PCR-protokollen beskriver viktige trinnene og gir forslag nødvendig for vellykket forsterkning sammenkoblede TCR-alfa og TCR-beta sekvenser. Det første kritiske trinnet er en betimelig ytelse cDNA transkripsjon og påfølgende første runde av multiplex PCR. Alle trinnene involveredd skal utføres i tide, og alle de reagenser og holdt på is å hindre RNA og cDNA fornedrelse. Dernest fordi protokollen er utformet for å være svært følsomme for lave nivåer av malen, er det svært utsatt for forurensning. Derfor er det viktig å arbeide i en mal fritt område, fra forsterket PCR produkter eller TCR vektor kloning. Et eget rom eller hette bør brukes til å definere cDNA og PCR reaksjoner. Mal fra første PCR reaksjonen bør legges i et annet område fra der PCR er definert. Det anbefales at et separat sett med aliquoted reagenser brukes for enkeltcelle PCR eksperimenter.

Denne protokollen er spesielt optimalisert bruke reagensene oppført i Tabell av materialer, og noen erstatninger i reagenser vil kreve ytterligere optimalisering. Den innledende identifiseringen av antigen-spesifikke celler kan endres for å bruke peptid-MHC tetramers. Tetramer flekker kan samtidig vurdering av antigen spesifisitet, samt HLA-begrensning. Alternative metoder for påvisning av antigen reaktivitet, som oppregulering av tidlig aktivisering markører eller sekresjon av inflammatoriske cytokiner kan betraktes i fravær av tetramer reagenser. Dobbel spesifisitet fusion antistoffer spesifikke for T celle antigen og IFNγ kan for eksempel kombineres med magnetiske perle isolasjon å berike for antigen reaktive IFNγ produsere celler.

Mens chimeric menneskelige/mus Konstruer beskrevet i våre protokollen sikrer kompatibilitet med musen celler, er kompatibilitet med menneskelige CD3 komplekse ukjent. Selv om ikke formelt testet av oss, har andre vist at chimeric TCR konstruksjoner med murine konstant regioner kan uttrykkes på overflaten av menneskelig lymfocytter17. Dette indikerer at murine TCR konstant regioner kan støtte samhandling med menneskelige CD3 signalering komplekse. Hvis målet er å uttrykke de identifiserte TCRs i menneskeceller primære eller humane cellelinjer, som Jurkat celler, kan en mer optimal tilnærming imidlertid bruke en fullstendig menneske konstruksjon. Dette kan oppnås ved å bytte murine konstant områdene i vektoren med menneskelige konstant regioner.

Hvis en identifisert TCR variable regionen inneholder ett av webområdene begrensning brukes for kloning, TCR skal settes inn i en shuttle vektor og senere mutert bruker et nettsted rettet mutagenese kit for å indusere en stille nukleotid endring i begrensning kuttet nettstedet. En alternativ tilnærming er de novo syntese av TCR variable regionen rundt endres for å utelukke uønskede begrensning området.

Den viktigste begrensningen av denne teknikken er manglende evne til å eliminere forsterkning av sekundær 'cytoplasmatiske' alfa kjeder. TCR-alfa gener går ikke gjennom allel utelukkelse som TCR-beta gener, dermed en betydelig andel av T-celler vil uttrykke en sekundær 'cytoplasmatiske' alfa kjede14. Beskrevet PCR protokollen bare resultater i forsterkning av en TCR alfa kjede, men hvis den forsterket alfa kjeden er 'cytoplasmatiske' alfa kjeden det ikke kan paret med forsterket beta kjeden. Derfor er det viktig å teste TCR cellen overflaten uttrykk i HEK293T celler å sikre vellykket kjeden sammenkobling.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Denne studien ble finansiert av JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 PILOT PJ, og The Robert og Janice McNair Foundation.

Vi takker Sandra Pena og Andrene McDonald for pasient rekruttering, Samuel Blum for teknisk assistanse, Dr. George Makedonas for gave antistoffer og kontroll DNA brukes for PCR optimalisering.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Strømlinjeformet enkeltcelle TCR isolasjon og generasjon Retroviral vektorer for <em>In Vitro </em>og <em>i Vivo</em> uttrykk for menneskelige TCRs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter