Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Упорядочение одноклеточного TCR изоляции и поколения ретровиральных векторов для In Vitro и In Vivo выражение человека TCRs

doi: 10.3791/55379 Published: September 10, 2017

Summary

Текущий протокол сочетает в себе одну ячейку в паре человека TCR альфа и бета-цепи последовательности с рационализированы поколения ретровиральных векторов совместим с in vitro и in vivo выражения TCR.

Abstract

Хотя, было разработано несколько методов для секвенирования парных Т-клеток рецепторов (TCR) альфа и бета-цепи от одного Т-клеток, никто до настоящего времени были способствуют вниз по течению в vivo функционального анализа гетеродимерами TCR. Мы разработали более протокол, основанный на двухэтапный мультиплекс вложенные PCR, что приводит к продукт PCR, который охватывает весь переменной регионах человека TCR альфа и бета-цепи. Выявляя места уникальные ограничения и включения их в праймеры PCR, мы сделали продукт PCR совместимы с прямым югу клонирования в шаблон антиретровирусные вектор. Результате антиретровирусного лечения конструкции кодирует химерных человека/мышь TCR с мыши Внутриклеточный домен, который функциональных клеток мыши или в в естественных условиях моделей мышей. В целом протокол, описанные здесь сочетает клеток человека одной паре TCR альфа и бета-цепи идентификации с обтекаемый поколения ретровиральных векторов, легко могут быть приспособлены для выражения TCR in vitro и in vivo . Видео и сопроводительные материалы призваны дать весьма подробное описание Одноячеистый PCR, таким образом, чтобы критические шаги можно избежать последовали и потенциальные ловушки. Кроме того мы предоставляем подробное описание клонирования шаги, необходимые для создания вектора выражения. Как только освоил, вся процедура от одной ячейки к TCR выражение сортировки может быть выполнена в течение короткого периода продолжительностью две недели.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Т-клеточных рецепторов (TCR) диктует решение судьбы Т-клеток во время разработки, установившемся/гомеостаза и антигенной стимуляции в периферии1,2,3. Недавнее расширение глубоких технологий виртуализации обнаружила ранее underappreciated TCR разнообразия в антиген Т-клеток конкретных ответов. TCR разнообразия предполагает потенциал для функционально широкий Т-клеток ответов. Для того, чтобы интегрировать анализ репертуар последовательности TCR с TCR функциональных анализов, последовательности подходов должны быть призваны быть совместимы с экспериментальных систем и в естественных условиях модели используются для последующего функционального анализа выберите TCRs. Мы разработали эффективный подход для человека TCR последовательности изоляцию и рационализированы югу клонирования в совместимы с TCR выражение HLA-очеловеченное мышей4вектор TCR шаблон химерных человека и мыши. Изоляции соответствующего альфа и бета-цепи гетеродимерная TCRs требует амплификации PCR обеих цепей из одной клетки. Хотя, несколько одноклеточных TCR клонирования протоколы были разработаны и использованы, никто до настоящего времени были легко совместим с высокой пропускной способностью обтекаемый прямого клонирования неизвестных Vα/Vβ TCRs в ретровиральных векторов необходимых для повторного выражения в естественных условиях 4,5,6,7. Предыдущие исследования использовали два основных подхода, либо выборочно дополнить ограниченную часть TCR, достаточных для экстраполяции последовательность, или усилить весь TCR последовательности4,5,6 , 7. ниже по течению функционального анализа последовательностей TCR, полученные через первый подход требует дорогостоящих в silico Ассамблеи и de novo строительство TCR. В то время как второй подход обеспечивает полную последовательность TCR, регионе человека постоянно не совместим с в vivo выражение клонированного TCRs в моделях мыши. Наш подход разработан специально для совместимости с в vivo функционального анализа TCRs в моделях мыши. Мы разработали эффективный и рациональный Одноячеистый PCR протокол, который позволяет для прямого югу клонирования PCR фрагментов в векторные выражения шаблона.

Наш подход использует весьма чувствительной реакции PCR мультиплекс вложенных, которая выполняется в два этапа. В первый мультиплекс реакции шаг бассейн 40 праймеров для всех V-бета-цепи и бассейн 44 праймеров для все, что V-альфа-цепи используются для усиления TCR альфа или бета-TCR без предварительного знания о последовательности (Таблица 1). Форвард грунт имеет адаптер последовательность, которая включена в 5' продукта PCR. Обратный грунт на основе постоянной региона TCR. Мы определили места уникальные ограничения, которые отсутствуют от человека переменной или перекрестка TCR регионов и включили их в обновленным TCRα и TCRβ грунты (рис. 1). В втором вложенных реакции грунт, определенных для адаптера последовательности и вложенного обратного грунт в регионе постоянно используются для дальнейшего усиления TCR цепи с повышенной точностью (Таблица 1, рис. 1). После изоляции одной ячейки, два раунда ПЦР (первая реакция с бассейном праймеров Vα и Vβ и второй с праймерами адаптер) результат ПЦР продукта, который может быть непосредственно югу клонирован в шаблон антиретровирусные вектор. Окончательный TCR конструкция будет кодировать в одном открытом чтения рамке (ORF), человека переменной регионах, в сочетании с постоянной регионов мыши соединены «самостоятельно расщепления» последовательности белка, P2A (hVα-mCα-P2A-hVβ-mCβ)8. P2A последовательность была использована в нескольких системах и были тщательно протестированы специально для выражения TCRs8,9,10,11. Хотя, после перевода, придает большую часть останков P2A последовательности C-конечная альфа-цепи соединены гибкими компоновщик, в то время как последовательность сигнала цепи бета-версия имеет дополнительные пролина, эта модификация не пагубно влияет на функции TCR. Регионе постоянный мыши используется в конструкции вместо человека во избежание потенциальных изменены взаимодействий с сигнальных компонентов нисходящего потока при вновь выразил в клетки мыши. Один ORF приведет к стехиометрическим отдельные выражения альфа и бета-цепи9,11. Текущий протокол основан на реагенты и подходы, которые широко доступны и призвана осуществляться на рациональной и эффективной основе. Хотя специально для анализа TCRs от самореактивных Т-клеток, причастны аутоиммунный диабет мы использовали этот метод, мы ожидаем, что этот протокол может быть широко применяется для идентификации и функциональной оценки человеческого TCRs для аутоиммунная epitopes, рака эпитопов или ответы на патогенные микроорганизмы и вакцин.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. определять популяции клеток T интерес.

Примечание: антигена конкретных распространения в сочетании с красителем деление клеток (например, Карбоксифлуоресцеина succinimidyl эфира, CFSE) могут использоваться для изоляции Т-клеток, основанный на их распространение в ответ на антигенной стимуляции. Если начиная с получения, 7-дневный в vitro расширение должно быть достаточно для выявления конкретных малочисленностью населения CFSE антигена 12.

  1. Получения смеси с MHC-согласованной фидер клетки и этикетка с 5 мкм CFSE деление клеток красителя 1:1.
  2. Плита 2-2,5 x 10 5 клеток на хорошо в 96-луночных раунд дно культура пластины в 200 мкл 10% FCS полный RPMI СМИ.
    Примечание: Полный RPMI содержит 2 мм l глютамином, пируват натрия 1 мм, 100 мкм MEM заменимые аминокислоты, 5 мм HEPES, 5,5 × 10 − 5 единиц 2-меркаптоэтанол, 100 мл U − 1 пенициллин и 100 мкг мл − 1 стрептомицин.
  3. Стимулировать клетки с 25 мкм пептид антигена.
  4. На четвертый день культуры, тщательно удалить и заменить 100 мкл СМИ.
    Примечание: Более оптимальный подход для идентификации антиген специфические клетки T является использование пептида HLA тетрамера 13. Тетрамер окрашивание позволяет одновременной оценки антигена специфику, а также HLA-ограничение.

2. Настроить одну ячейку Сортировка.

  1. Выполнять все процедуры в капот или указанного района бесплатно усиливается шаблона. Аликвота реагентов, чтобы избежать загрязнения, очистить все рабочие поверхности и, если это возможно, оборудование с 10% отбеливателем до установки ПЦР. Использовать фильтр советы, RNAse и DNAse бесплатно реагентов и пластмасс во всех ПЦР и вектор клонирования шаги. Основные реагенты можно найти в Таблице материалов.
    Примечание: Мультиплексной ПЦР реакция очень чувствительна, и низкий уровень загрязнения может привести к усиливается продукт.
  2. Формирования обратной транскрипции Мастер микс, объединяя 10 x реакции RT буфера, 25 X дНТФ, 9 U RT фермента, 0,01% Тритон-X, 0.7 АБС битор РНКазы U и 383 Нм каждого RT-TCR праймера (перечислены в таблице 1), в стерильной дозирования водохранилище. Для каждой пластины 96-луночных составляют достаточно мастер смесь для 10 дополнительных реакций (всего 106), чтобы компенсировать потерю жидкости во время закупорить. Приведены в таблице 2 для реакции компонентов и суммы по хорошо.
  3. Подготовка семейство PCR 96-луночных пластина для ячеек, сортировка по дозирования 6 мкл обратной транскрипции мастер смеси в скважины с многоканальные пипетки. Держите пластины на льду или в блоке холодной.
  4. Ярлык клетки с антителами к ячейке поверхностных маркеров (например, CD4 и CD3, или CD8 и CD3, каждая на 2 мкг/мл, в сочетании с деление клеток красителя или Тетрамер окрашивание).
  5. Сортировка Т-клеток в одной ячейки в колодец, пропуская двенадцатой строке, которая будет служить в качестве отрицательного контроля.
    Примечание: Эффективность такого рода будет зависеть от точной коллекции пластины выравнивание пластина держателя, а также сохранение клеток и пластин при низкой температуре до cDNA реакции. Коллекции пластины должны храниться на льду во все времена, за исключением во время сортировки, когда они устанавливаются в пределах охлаждения пластины. Не все сортировщики оснащены Температура регулируемой пластины держателя; Однако настоятельно рекомендуется использовать один. После сортировки, как правило, занимает около 10-15 мин на пластину, есть увеличение потенциала для РНК деградации, если плита не поддерживается при низкой температуре.
  6. Как позитивный элемент, добавить большее количество клеток (100 клеток) вручную с пипеткой в одной из скважин на данном этапе. Кроме того, ранее изолированные РНК из пула клеток может использоваться как положительный контроль 10 нг на колодец.
    Примечание: Пипетка очищенный управления РНК с точностью и ухода во избежание перекрестного заражения других скважин и ложных положительных результатов.
  7. Уплотнение пластины с липкой пленкой и спина вниз на 1000 x g 5 мин на 4 ° C.
  8. Немедленно транскрибировать РНК в cDNA, инкубации пластину на 25 ° C в течение 10 мин, 37 ° C за 45 мин и 85 ° C в течение 10 мин
    Примечание: Для обеспечения эффективной реакции PCR, рекомендуется, что первая реакция PCR выполняться в тот же день. Кроме того, транскрибируется пластины может храниться в-80 ° C до 2 месяцев.

3. Выполняют мультиплекс вложенные ПЦР

Примечание: Подготовьте все мастер смеси в чистый шаблон свободно OBLASTь, чтобы избежать загрязнения.

  1. Воссоздать каждой переменной региона грунт до 100 мкм с DNAse и РНКазы бесплатно H 2 O. Затем объединить 20 мкл каждого из 44 Праймеры для создания пула грунтовка V-альфа. Для создания V-бета-грунтовка бассейн объединить 20 мкл каждого из 40 V-бета праймеры плюс 80 мкл DNAse и РНКазы бесплатно H 2 O. Primer последовательности, перечислены в таблице 1. После объединения, концентрация каждого праймера в смеси составляет 2.3 мкм.
  2. Восстановить грунты постоянном регионе до 100 мкм Стоковый раствор с DNAse и РНКазы свободной H 2 O. развести грунты постоянном регионе 10 мкм рабочего раствора и Алиготе для использования.
  3. Подготовить два отдельных мастер смеси для TCR-альфа- и бета-TCR амплификации. Генерировать основной смеси путем объединения 5 X буфер, 80 мкм дНТФ, 3% ДМСО, 2 мкм грунтовка бассейн (конечная концентрация 46 Нм для каждого праймера), 200 Нм TCR-постоянн региона обратный грунтовка, 1 U ДНК-полимеразы и DNAse и РНКазы бесплатно H 2 O (Таблица 2 < / сильные >). Для каждой пластины 96-луночных, составляют достаточно мастер смесь для 10 дополнительных реакций (всего 106), для того, чтобы компенсировать потерю жидкости во время закупорить.
    Примечание: Расчеты основаны на окончательный объем ПЦР 25 мкл в колодец, где 22,5 мкл мастер смесь ПЦР сочетается с 2,5 шаблон cDNA мкл.
  4. Держите пластины с cDNA на льду или в блоке холодной. Используйте многоканальный для Пипетка 22,5 мкл TCR-бета-реакции в новую плиту 96-луночных ПЦР. Затем используйте многоканальный для передачи 2,5 мкл cDNA в пластину ПЦР.
  5. Использовать многоканальный для Пипетка 22,5 мкл TCR альфа реакции непосредственно в пластину, содержащий оставшуюся часть cDNA.
  6. Печать пластины с клей, нежно вихря и спин вниз на 1000 x g 5 мин на 4 ° C.
  7. Запуск мультиплексной ПЦР реакции с следующие циклы: 5 мин при 95 ° C, после чего 34 циклов 20 s при 95 ° C, 30 s на 54 ° C и 1 мин при 72 ° C, а затем 7 мин в 72 ° C.
  8. Носить из вложенных реакции PCR в окончательный объем 25 мкл, используя 2.5 мкл мультиплексной ПЦР смеси в качестве шаблона.
    1. Восстановить внутренние и адаптер грунтовки до 100 мкм с DNAse и РНКазы бесплатно H 2 O. сделать 10 мкм аликвоты для рабочих акций.
    2. Подготовить два отдельных мастер смеси для TCR-альфа- и бета-TCR амплification. Mix 5 X буфер, 25 X DNTP, 3% ДМСО, 200 Нм вперед адаптер грунт, 200 Нм обратный вложенных грунт, 1 U ДНК-полимеразы и ДНК-полимеразы и свободной от нуклеиназы H 2 O для окончательного объема 22,5 мкл (Таблица 2). Для каждой пластины 96-луночных, составляют достаточно мастер смесь для 10 дополнительных реакций (всего 106), чтобы компенсировать потерю жидкости во время закупорить.
      Примечание: В второй использования реакции PCR 5 X PCR буфера содержащий краситель загрузки для облегчения загрузки геля агарозы.
    3. С помощью многоканальный, Пипетка мастер смеси для TCR альфа- и бета-TCR реакции в 22,5 мкл в колодец в два новых 96-луночных ПЦР планшетов.
    4. В 2,5 мкл за хорошо добавить мультиплексной ПЦР реакции шаблона.
      Примечание: Оставшиеся первой реакции PCR должны быть опечатаны и температуре 20 ° C до служить источником дополнительных шаблонов, если это станет необходимым (см. Шаг 4.3 Примечание).
    5. Уплотнение пластины, вихревой мягко и спин вниз на 1000 x g 5 мин на 4 ° C.
    6. Запускать вложенные реакции PCR с следующие циклы: 5 мин при 95 ° C, после чего 34 циклов 20 s при 95 ° C, 30 s на 56 ° C и 1 мин при 72 ° C, а затем 7 мин на 72 ° C.
    7. Запуск 5 мкл окончательной реакции вне на агарозы 1% гель содержащий бромид ethidium (включая отрицательный и положительный контроль скважины).
      Примечание: Ожидается группы должны работать на около 500 bp размер. Реакция пример показан на рисунке 2.
    8. Очистить оставшуюся часть вторая реакция (20 мкл) с использованием формата 96-луночных комплект очистки ПЦР, элюировать с 15 мкл 70 ° C H 2 O на колодец и выполнять Сэнгер последовательности. Используйте соответствующие TCR альфа или бета-TCR адаптер вперед грунтовка для виртуализации (Таблица 1).
      Примечание: Последовательности могут быть проанализированы с программным обеспечением онлайн доступны иммуногенетики.

4. Югу клонирование альфа и бета-цепи ПЦР.

Примечание: бассейн вперед грунты, используются в первой реакции, и обратный грунтовки в второй реакции PCR используются для включения места ограничения. Таким образом, полученные альфа и бета-цепи ПЦР продукты готовы быть последовательно югу клонированных в шаблон антиретровирусные вектор ( рис. 1).

  1. Дайджест очищенный ПЦР продукты из бета-версии вложенных реакции с BstbI и MfeI (Таблица 3).
    Примечание: Не превышайте 5 мкг Вставка.
  2. Параллельно, дайджест вектора шаблона с BstbI и MfeI (Таблица 3). Используйте 1-2 мкг вектора шаблона в TCR. Запустите переваривается вектора на геле агарозы и изолировать более крупные группы (~ 7500 bp). Очищение вектора с гель комплект очистки ДНК.
    Примечание: Во время энзима ограничения обзору, мышиных TCR-бета-переменная область шаблона удаляется, позволяя для добавления человека TCR-бета переменной региона.
  3. Очистить переваривается продукты PCR, используя комплект для очистки ПЦР.
    Примечание: Проверка возможности очистки ДНК столбцов, включенных в комплект; При необходимости используйте несколько столбцов. Минимальное количество очищенной вставки, необходимых для успешного лигирование реакции составляет 50 нг в минимальной концентрации 10 нг/мкл. Если сумма очищенный вставка не достаточно для успешного перевязки, второй реакции PCR может быть повторен.
  4. Лечения вектора шаблона с 10 U CIP фермента за 1 ч при 37 ° C для предотвращения самолигирование, следуют тепловой инактивации 10 мин на 75 ° C. очистить ДНК с комплектом очистки ПЦР (Таблица 3).
  5. Ligate TCR-бета вставки и вектор с помощью ДНК лигаза в общем объеме 20 мкл на 6 Молярная избыток вставки для 30 мин при комнатной температуре.
    Примечание: В общей сложности, реакции перешнуровки должен содержать около 150 нг ДНК (Таблица 3).
  6. Для преобразований, Смешайте 8 мкл реакции перешнуровки с 80 мкл химически компетентных E.coli DH5α клеток (Таблица материалов) и инкубировать на льду на 30 мин теплового шока при 42 ° C для 45 s. добавить 500 мкл супер Оптимальное бульон с Catabolite подавления (S.O.C.) средний и встряхнуть для 1,5 ч при 37 ° с.
  7. Пластина из 250 мкл бактериальной культуры на ампициллин, содержащих агар пластины Lysogeny бульон (LB). Инкубировать пластину на ночь (~ 16 h) при 37 ° с.
  8. Следующий день выбрать бактериальных колоний и расти их в 3 мл LB носитель, содержащий ампициллина на ночь. Изолировать плазмида ДНК, используя комплект для очистки плазмида ДНК.
  9. Подтверждают успешное включение бета-цепи небольших испытаний-дайджест с энзимами ограничения BstbI и MfeI. В 12 томе µL общая реакция объедините 200-500 мкг плазмидной ДНК, 0,25 мкл каждого фермента и 10 X буфер фермента (Таблица 3). Запуск реакции вне на геле агарозы 1%, содержащие бромид ethidium подтвердить размер вставки группы (~ 500 bp).
  10. После подтверждения наличия insert, последовательность TCR-бета-раздел вектора использование IRES обратный грунтовка (Таблица 1).
  11. После подтверждения последовательности TCR-бета-вставки, выполните аналогичный процесс для вставки альфа-переменной региона. Дайджест очищенных продуктов ПЦР из альфа-вложенные реакции и созданный Вставка TCR-бета, содержащий вектор, с SnaBI и SacII.
    Примечание: Во время энзима ограничения обзору, мышиных TCR альфа переменная область шаблона удаляется, позволяя для добавления человека переменной региона TCR альфа.
  12. Ligate альфа вставляет в TCR векторов кодирования соответствующий бета переменной региона с помощью ДНК лигаза в общем объеме 20 мкл на 6 Молярная избыток вставки для 30 мин при комнатной температуре.
    Примечание: В общей сложности, реакции перешнуровки должен содержать около 150 нг ДНК (Таблица 3).
  13. Для преобразований, Смешайте 8 мкл реакции перешнуровки с 80 мкл химически компетентных E.coli DH5α клеток (Таблица материалов) и инкубировать на льду на 30 мин теплового шока при 42 ° C для 45 s. добавить 500 мкл S.O.C. Средний и встряхнуть для 1,5 ч при 37 ° с.
  14. Пластина из 250 мкл бактериальной культуры на ампициллин, содержащих агар пластины Lysogeny бульон (LB). Инкубировать пластину на ночь (~ 16 h) при 37 ° с.
  15. Следующий день выбрать бактериальных колоний и расти их в 3 мл LB носитель, содержащий ампициллина на ночь. Изолировать плазмида ДНК, используя комплект для очистки плазмида ДНК.
  16. Для подтверждения успешного включения альфа-цепи небольших испытаний дайджест с энзимами ограничения SnaBI и SacII. В 12 томе µL общая реакция объедините 200-500 мкг плазмидной ДНК, 0,25 мкл каждого фермента и 10 x буфер фермента (Таблица 3). Запуск реакции вне на геле агарозы 1%, содержащие бромид ethidium подтвердить размер вставки группы (~ 500 bp).
  17. После подтверждения наличия insert, последовательность TCR альфа раздел вектора с использованием MSCV2-вперед грунт (Таблица 1).
  18. После проверки последовательности альфа-цепи, проверьте полный TCR вставки путем sequencing грунтом TCR-бета реверс и IRES-реверс (Таблица 1).

5. Проверка поверхности выражения TCR клеток и специфичность.

Примечание: HEK293T клетки используются для проверки успешного TCR цепи паринг и клеток поверхности выражение ( Рисунок 3А) 8. Пептид-MHC Тетрамер окрашивания могут также выполняться на transfected клеток HEK293T для тестирования для удержания антигенной специфичности пост TCR гена изоляции ( рис. 3B).

  1. Пластина, HEK293T клетки культуры ткани 12-ну плит на 1 х 10 5 ячеек на скважину в 1 мл полный DMEM СМИ содержащих 5% FCS, и культура ночь в 37 ° C. пластины из достаточно клетки были назначены отдельные колодцы для каждого нового TCR , элемент управления шаблона TCR вектор, CD3 вектора только, контролировать TCR вектора только и не transfected хорошо.
    Примечание: Transfection с полностью мыши шаблон TCR вектор (РКРТ pMIA) в сочетании с mCD3εγδζ-pMIG вектор, РКРТ pMIA вектор в одиночку, и mCD3εγδζ-pMIG вектора только используются в качестве положительной и отрицательной контроля.
    Примечание: Полный DMEM содержит 2 мм L-глютамином, 1 мм пируват натрия, 100 мкм Non-essential аминокислоты, 5 мм HEPES буфера, 5.5 x 10 -5 единиц 2-меркаптоэтанол, 100 ед/мл пенициллина/стрептомицина.
  2. Следующий день, transfect клетки с 1 мкг химерных вектор h/РКРТ pMIA, 1 мкг мыши CD3εγδζ-pMSCVII-GFP (pMIG) вектор и реагент на основе липосом трансфекции, следуя инструкциям производителя.
  3. Для каждого TCR, добавить 6 мкл Реагента трансфекции комнатной температуре 100 мкл, DMEM сыворотки бесплатно. Кратко вихрь и инкубации при комнатной температуре 15 мин
  4. В отдельных 1,5 мл трубки объединить 1 мкг TCR-pMIA вектора с 1 мкг мыши CD3εγδζ-pMSCVII-GFP (pMIG) вектор, или 1 мкг каждого вектора отдельных элементов управления.
  5. Dropwise, добавить решение реагент/DMEM трансфекции в пробирки, содержащие дна вектора. Инкубации при комнатной температуре 15 мин
  6. Dropwise, добавить решение реагент/DMEM/ДНК transfection клетки HEK293T. Аккуратно нажмите пластину для смешивания. Инкубируйте на 37 ° C в течение 24 ч.
  7. После 24 h заменить СМИ и сохранить клетки в культуре для дополнительных 24 h.
  8. Удалить клетки от плиты, энергичные закупорить и пятно клетки с анти мыши антитела CD3 (2,5 мкг/мл) для проверки поверхности выражение химерных TCR подачей cytometry.
  9. Для того чтобы сравнить CD3 выражение между ячейками, которые были transfected на аналогичный уровень строба анализ на клетки, выражая аналогичные высокий уровень флуоресцентные репортер молекул (GFP для CD3 комплекса и Аметрин для вектора выражения TCR). Оптимально, анализ должен быть закрытого GFP + Аметрин + клеток в течение 10 4 – 10 5 интенсивности флуоресценции ( рис. 3A).
    Примечание: Уровень CD3 выражения в клетках transfected с химерных конструкции должны быть сопоставимыми с управления мышью (исходный шаблон) вектор ( рис. 3A). Сгенерированный TCR ретровиральных векторов совместимы с системами в vivo выражение как описано 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Эффективность реакции PCR мультиплекс вложенные проверяется на шаге 3.2.7 (рис. 2), запустив из 5мкл второй реакции на геле агарозы. В среднем эффективность усиления TCR-бета, как ожидается, составит около 80%, в то время как эффективность реакции TCR альфа обычно ниже, около 50%4. Только парные TCR-альфа и TCR-бета-цепи могут быть использованы для выражения TCR; Однако все продукты PCR может виртуализации для получения последовательности TCR и репертуар информации.

Экспрессию гена позволит только один TCR-бета-цепи выражаться в данной Т-клеток. Однако Т-клеток способна переставляя второй TCR альфа-цепи, и около 25% клеток T будет выражением второй в кадр TCR альфа-цепи 14. Ожидается, что некоторые доля изолированных TCR альфа-цепи будет вторичной альфа вместо «правильной» альфа-цепи. Вторичные цепи альфа часто не является партнером оптимальное связывание с TCR-бета-цепи; Следовательно предполагается, что не все клонированные TCRs образует стабильный комплекс и Экспресс на поверхности клетки. Таким образом, надлежащее TCR цепи сопряжения и клеток поверхности выражение имеет быть подтверждены transfecting HEK293T клеток (рис. 3A).

Figure 1
Рисунок 1 . Обтекаемый мультиплекс вложенные ПЦР и развития ретровирусной конструкции от одного Т-клеток. Два раунда ПЦР привести усиление соответствующих TCR альфа и бета-цепи. Встроен в праймеры места ограничения позволяют обтекаемый югу клонирования и поколения человека/мыши химерных вектора выражения в клетки мыши. Вектор мыши шаблон может использоваться для легко переключаться из переменной мыши регионов для человека, создания химерных человека/мыши TCR ретровирусной вектор совместимы с выражением в клетки мыши. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 . Пример Одноячеистый PCR. Мультиплекс вложенных амплификации PCR Т-клеток рецептора бета и альфа-цепочки из одного человека Т-клеток, отсортированный в одну плиту 96-луночных. Приведены соответствующие продукты PCR (сверху и снизу) от одноклеточного усиленный TCR бета и альфа-цепочки TCR от человека репликацию. NC - не шаблон управления, PC - положительный контроль. Запустив небольшую часть реакции на геле агарозы (5 мкл), эффективность одноклеточного альфа и бета-цепи реакций PCR подтверждается до продукта ПЦР секвенирования. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3 . Проверка ячейки поверхности химерных выражения TCR и специфичность. (A) HEK293T были transfected клеток с мыши TCR или человека и мыши химерных TCR в сочетании с мыши CD3εγδζ. Клетки поверхности TCR выражение было измерено с анти mCD3ε антител. Строб стратегия: во-первых, анализ является воротами на позитивные клетки Аметрин и GFP двойной (G2). В случае одного вектора контроля стробирования должен основываться на одной флюоресценция (G1). Во-вторых для уровня экспрессии CD3ε анализируются клетки от G1 и G2. (B) TCR специфика подтверждается Тетрамер окрашивания клеток 293T с DRB1 * 0401:GAD115-127 Тетрамер. Анализ является воротами на GFP + Аметрин + CD3ε + клеток, как показано на (A). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

ЦЕЛЕВОГО ГЕНА ГРУНТОВКА ОРИЕНТАЦИЯ ПОСЛЕДОВАТЕЛЬНОСТЬ
Обратная транскрипция
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR альфа-реакции PCR 1
TRAV1-1 Вперед CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 Вперед CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 Вперед CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 Вперед CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 Вперед CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
ТД > TRAV17 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 Вперед CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 Вперед CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 Вперед CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 Вперед CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 Вперед CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC внешние Реверс CAGACAGACTTGTCACTGGATTTAGAGTCTC Реакция TCRbeta PCR 1 TRBV2 Вперед CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 Вперед CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 Вперед CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 Вперед CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 Вперед CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 Вперед CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 Вперед CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 Вперед CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 Вперед CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 Вперед CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 Вперед CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 Вперед CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 Вперед CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 Вперед CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 Вперед CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 Вперед CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >Вперед CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 Вперед CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 Вперед CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 Вперед CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 Вперед CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 Вперед CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 Вперед CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 Вперед CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 Вперед CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 Вперед CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT Внешняя TRBC Реверс GTGGCCAGGCACACCAGTGTG TCR альфа-реакции PCR 2 TRAC внутреннего Реверс CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV адаптер Вперед CGGTTCAGCAGGAATGCCtacgtaATG TCR бета реакции PCR 2 TRBC внутреннего Реверс CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV адаптер Вперед CAGAAGACGGCATACGAGATcaattgATG Секвенирование грунтовки pMSCV-II Вперед CCTCCTCTTCCTCCATCCGCC TCRbeta Реверс GCCAAGCACACGAGGGTAGCC IRES Реверс AACGCACACCGGCCTTATTCC * Строчные буквы в рамках последовательностей праймера указывают что включены энзима ограничения вырезать сайты

Таблица 1: Обратный транскрипции, ПЦР и секвенирования грунты.

Шаг 2,2 суммы по хорошо
ПЦР-реакции (6μL) (МКЛ)
10 x буфер 0.6
2 x dNTP 0,24
10% Тритон X 0,06
3 TCR-специфические праймеры (10 мм шт.) 0.23 е.а. (x 3 = 0,69)
Фермент 0,18
АБС битор РНКазы 0.28
NF(nuclease-Free)-H2O 3.95
Шаг 3.1
реакция PCR 1 (25μL) (МКЛ) b реакция PCR 1 (25μL) (МКЛ)
5 x буфер 5 5 x буфер 5
dNTP (10 мм) 1 dNTP (10 мм) 1
ДМСО 0.75 ДМСО (3%) 0.75
бассейн (праймера F) (2.3μM) 0,3 b бассейн (праймера F) (2.3μM) 0.5
Внешняя грунтовка R (10uM) 0.6 b внешние R грунт (10мкм) 1
ДНК-полимераза 0.2 Перейти полимеразы Taq 0.2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14.65 NF-H2O 14.05
Шаг 3,8
Реакции PCR 2 - же для и b (25μL) (МКЛ)
5 x буфер 5
dNTP (10 мм) 1
ДМСО 0.75
Переходник F грунт (10мкм) 1
Внутренние R грунт (10мкм) 1
ДНК-полимераза 0.2
Rxn 1 продукт PCR 2.5
NF-H2O 13.55

Таблица 2. Обратная транскрипция и реакций PCR.

Шаги, 4.2 и 4.3
TRBV дайджест реакция (50μL) (МКЛ) Дайджест вектор РКРТ pMIA (500μL) (МКЛ)
ДНК (~ 20μg) ДНК (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x буфер 5 10 x буфер 50
H2O H2O
Шаг 4.4
CIP реакция (100μL) (МКЛ) DNA(~1.5mg)
> Переваривается & очищенный дна вектора 84 10 x буфер 10 CIP фермента 6 Шаг 4.5 Реакции перешнуровки (20μL) (МКЛ) ДНА вектора переваривается/CIPed (общая сумма insert и вектор ~ 150ng) Вставка ДНК (6 Молярная доступ к вектор) 2 x лигаза буфера 10 Лигаза фермента 1 H2O Шаг 4.9 Дайджест реакция испытания (12μL) (МКЛ) ДНК (100-300ng) 1 MfeI 0.25 BstbI 0.25 10 x буфер 1.2 H2O 9.3 Шаг 4.11 TRAV дайджест реакция (60μL) (МКЛ) Содержащие бета - дайджест вектор РКРТ pMIA (120μL) DNA(~1.5μg) ДНК (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x буфер 6 10 x буфер 10 H2O H2O

Таблица 3. Вектор клонирования реакций.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

В текущем протоколе мы описываем эффективный метод для одной ячейки TCR амплификации и последующей югу клонирования парных TCR альфа и бета-цепи в шаблон антиретровирусные выражение вектор. Хотя, были разработаны несколько Одноячеистый PCR протоколы, никто до настоящего времени были совместимы с немедленной югу клонирования в выражении vector. В большинстве случаев частичная последовательность охватывающих высоко вариабельные CDR3 регионах усиливается, с достаточно последовательности экстраполировать переменной региона. Это меньший размер продукта PCR поддерживает более высокую эффективность ПЦР, но требует de novo синтеза гена TCR для функциональных исследований. Текущий протокол поддерживает эффективность ранее опубликованные ориентированных CDR3 одноклеточного TCR последовательность протоколов, в то время как в то же время, приносит больше ампликонами, содержащий весь переменной региона подходит для клонирования. Таким образом система, описанная имеет повышенную гибкость в давая количественную последовательности, а также функциональных вывода.

В зависимости от научной вопрос источник и специфика Т-клеток, проанализированы может варьироваться. Однако если конечной целью проекта является анализ функционирования в vivo TCR, это необходимо знать ограничением HLA изолированные Т-клеток. Текущий протокол был специально разработан, чтобы быть совместимым с в vivo TCR выражение HLA-очеловеченное мышей. Многие из этих мышей были созданы и в настоящее время коммерчески доступных, в том числе HLA-А2.1, HLA-DQ8 (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-А11 (A * 11:01 / K), HLA-B2705, HLA-A24 и HLA - B * 0702 трансгенных штаммов. Этот протокол может успешно вместе с ранее опубликованной протоколом для выражения ретровирусной опосредованной костного стволовых клеток человека TCRs4,,1516. Мы ожидаем, что гуманизированные TCR retrogenic система будет применимо и весьма полезным для функционального анализа человеческого TCRs в различных аутоиммунных, рака и инфекционных модели.

Текущий одноклеточного протокол постановки ПЦР описывает важнейшие шаги и дает предложения, необходимые для успешного амплификации парных TCR-альфа и TCR-бета-последовательностей. Первым важным шагом является своевременное выполнение cDNA транскрипции и последующего первый раунд мультиплексной ПЦР. Все этапы должны выполняться своевременно, и все реагенты и клетки на льду для предотвращения деградации РНК и cDNA. Во-вторых потому что протокол предназначен для очень чувствительны к низким уровням шаблона, это очень чувствительны к загрязнению. Таким образом крайне важно работать в шаблон-зоне, вдали от усиленные продукты PCR или TCR вектор клонирования. Отдельную комнату или капот должны использоваться для настройки cDNA и реакций PCR. В другой области от где ПЦР установлено следует добавить шаблон из первой реакции PCR. Рекомендуется использовать отдельный набор aliquoted реагентов для экспериментов Одноячеистый PCR.

Этот протокол был специально оптимизирован с использованием реагентов, перечисленные в Таблице материалов, и любые замены в реагенты потребует дополнительной оптимизации. Первоначальное определение антиген специфические клетки могут быть модифицированы для использования тетрамера пептид MHC. Тетрамер окрашивание позволяет одновременной оценки антигена специфику, а также HLA-ограничение. Альтернативные методы для обнаружения антигена реактивности, например upregulation ранних маркеров активации или секрецию воспалительных цитокинов может рассматриваться в отсутствие Тетрамер реагентов. Например двойной специфика синтез антител специфических для антигена для Т-клеток и IFNγ могут быть объединены с магнитной бусины изоляции для обогащения для антигена реактивной IFNγ производства клеток.

Хотя конструкция химерных человека и мыши, описанные в нашей протокол обеспечивает совместимость с клетки мыши, уровень ее совместимости с человека CD3 комплекса неизвестна. Хотя формально не проверяются нами, другие показали, что химерных TCR конструкции с мышиных постоянной регионах может быть выражена на поверхности лимфоцитов человека17. Это означает, что мышиных TCR постоянной регионах может поддерживать взаимодействие с человека сигнализацией CD3 комплекса. Однако если цель заключается в том, чтобы выразить выявленных TCRs в клетки человека начальных или линий клеток человека, таких как клетки Jurkat, более оптимальный подход может быть использовать конструкцию полностью человеком. Это достигается путем замены мышиных постоянной регионов внутри вектор с постоянной зоны человека.

Если выявленные TCR переменной региона содержит один из сайтов ограничений, используемых для клонирования, TCR должен быть вставлен Трансфер вектор и впоследствии мутировал, с помощью сайта Направленный мутагенез kit побудить немого нуклеотидных изменений в пределах ограничения вырежьте сайта. Альтернативный подход является de novo синтез TCR переменной региона интерес, чтобы исключить нежелательные ограничения сайта.

Основным ограничением этой методики является неспособность устранить усиление вторичного «цитоплазматических» альфа-цепи. TCR альфа гены не проходят через аллельные исключения как TCR-бета генов, таким образом, значительная доля клеток T будет выразить вторичных «цитоплазматических» альфа-цепи14. Описывается протокол PCR только приводит к амплификации одной TCR альфа-цепи, но если усиливается альфа-цепи «цитоплазматических» альфа-цепи, которую он может не пару с усилителем бета-цепи. Таким образом важно проверить TCR клеток поверхности выражение в HEK293T клетках для обеспечения успешной цепи сопряжения.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Это исследование финансировалось JDRF 1-FAC-2014-243-A-N, Ада 7-14-JF-07, низ 5 Р30 DK079638-05 пилот PJ и Роберт и Дженис McNair фонда.

Мы благодарим Сандра пена и Andrene Макдональд за пациента вербовки, Самуэль Blum для оказания технической помощи, д-р Джордж Makedonas за дар антител и управления для оптимизации ПЦР ДНК.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Упорядочение одноклеточного TCR изоляции и поколения ретровиральных векторов для <em>In Vitro </em>и <em>In Vivo</em> выражение человека TCRs
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter