Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

Tek hücre TCR yalıtım ve üretme-in Vitro için Retroviral Vektörler ve In Vivo ifade insan TCRs aerodinamik

doi: 10.3791/55379 Published: September 10, 2017

Summary

Geçerli protokol birleştiren tek hücre insan TCR alpha ve beta zinciri sıralama ile eşleştirilmiş retroviral vektörler vitro ve in vivo TCR ifade ile uyumlu nesil aerodinamik.

Abstract

Sıralama eşleştirilmiş T hücre reseptör (TCR) Alfa ve beta zincirleri tek T hücrelerden için çeşitli yöntemler geliştirilmiştir rağmen hiçbiri defa TCR heterodimers aşağı akım için elverişli vivo içinde fonksiyonel analiz edilmiştir. Biz neden olan bir insan TCR alpha ve beta zincirleri değişken bölgeleri kapsayan bir PCR ürünü bir iki adım multiplex iç içe PCR, dayalı gelişmiş bir iletişim kuralı geliştirdik. Benzersiz kısıtlama siteleri tanımlama ve onları PCR astar birleşmeyle, PCR ürünü doğrudan şablon retroviral vektör alt klonlama ile uyumlu yaptık. Elde edilen retroviral yapı chimeric insan/fare TCR fare hücreleri veya vivo içinde fare modelleri fonksiyonel bir fare hücre içi etki ile kodlar. Genel olarak, burada açıklanan protokol eşleştirilmiş insan tek hücre TCR alpha ve beta zinciri kimlik retroviral vektörler kolayca uyarlanabilir aerodinamik nesil vitro ve in vivo TCR ifade ile birleştirir. Böylece kritik adımları takip ve potansiyel tuzaklar kaçınılmalıdır olabilir video ve eşlik eden malzeme tek hücre PCR, son derece ayrıntılı bir tanımını vermek için tasarlanmıştır. Ayrıca, biz klonlama ifade vektör oluşturmak için gereken adımları ayrıntılı bir açıklamasını sağlar. Kez hakim, tüm prosedürü tek hücreden TCR ifade için sıralama kısa bir iki haftalık süre içinde gerçekleştirilebilir.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

T hücre reseptör (TCR) T hücre kaderi karar geliştirme, kararlı duruma/homeostazı ve çevre1,2,3' te antijenik stimülasyon sırasında belirler. Son teknolojileri sıralama derin genişlemesi antijen belirli T hücre yanıt içinde daha önce değersiz bir TCR çeşitlilik ortaya çıkardı. TCR çeşitlilik işlevsel olarak geniş T hücre yanıt için bir potansiyel göstermektedir. TCR dizi repertuar analizi TCR fonksiyonel deneyleri ile entegrasyon için sıralama yaklaşımlar deneysel sistemleri ve seçin sonraki fonksiyonel analiz için kullanılan vivo içinde modelleri ile uyumlu olacak şekilde tasarlanmış olmalıdır TCRs. Biz insan TCR sıra izolasyonu için etkili bir yaklaşım geliştirdik ve TCR ifade HLA insanlaşmış fareler4ile uyumlu bir chimeric insan/fare TCR şablon vektör içine alt klonlama aerodinamik. Heterodimeric TCRs karşılık gelen alpha ve beta zincirleri yalıtımı PCR güçlendirme tek bir hücreden her iki zincirlerinin gerektirir. Rağmen birkaç tek hücreli TCR klonlama protokol geliştirilen ve kullanılan, hiçbiri defa kolayca yüksek üretilen iş kolaylaştırılmış doğrudan bilinmeyen Vα/Vβ TCRs retroviral vektörler yeniden ifade için içinde vivo gerekli içine klonlama ile uyumlu olması 4,5,6,7. Önceki çalışmalarda iki ana yaklaşım, ya seçerek sıra tahmin veya tüm TCR sıra4,5,6 yükseltmek için yeterli TCR sınırlı bir bölümünü yükseltmek için kullanılan , 7. ilk yaklaşım elde edilen TCR sıralarının aşağı akım fonksiyonel analiz gerektirir pahalı silico montaj ve de novo inşaat TCR. İkinci yaklaşım tam TCR sıra sağlamasına karşın, insan sabit bölge fare modellerinde klonlanmış TCRs vivo içinde ifade ile uyumlu değildir. Yaklaşımımız TCRs in vivo fare modelleri fonksiyonel analiz ile uyumlu olacak şekilde özel olarak tasarlanmıştır. Bir verimli ve rahat tek hücre doğrudan PCR parçalarının şablon ifade vektör alt klonlama için sağlar PCR Protokolü geliştirdik.

Bizim yaklaşım iki adımda gerçekleştirilen bir son derece hassas multiplex iç içe PCR reaksiyon kullanır. İlk multiplex tepki adım 40 astar V-beta zincirler için belirli bir havuz ve 44 astar tüm V-Alfa zincirleri TCR-alfa veya TCR-beta (Tablo 1) serisi ön bilgi olmadan yükseltmek için kullanılan belirli bir havuz. İleri astar 5' PCR ürününün dahil bir adaptör sırası vardır. Ters astar TCR sabit bölge üzerinde temel alır. Biz belirledik benzersiz kısıtlama siteleri yok insan değişken veya kavşak TCR bölgeler ve bunlar yeni redesigned TCRα ve TCRβ astar (şekil 1) içine dahil. İkinci iç içe geçmiş tepki olarak bir astar olarak adaptörü sırası için belirli ve sürekli bölgesi içinde iç içe geçmiş bir ters astar daha da artan özgüllük ile (Tablo 1, şekil 1) TCR zincir yükseltmek için kullanılır. Tek hücre izolasyon sonra iki PCR yuvarlar (ilk tepki Vα ve Vβ astar havuzu olan ve ikinci adaptör astar ile) neden doğrudan şablon retroviral vektör alt klonlanmış bir PCR ürünü olup. Son TCR yapı, bir tek açık okuma çerçevesi (ORF), 'kendi kendine sıyırmada' protein sırayla bağlı fare sürekli bölgeleri ile birlikte insan değişken bölgeler içinde kodlar P2A (hVα-mCα-P2A-hVβ-mCβ)8. P2A sırası birden çok sistemlerinde kullanılan ve TCRs8,9,10,11Ifade özellikle kapsamlı olarak sınanmıştır. Her ne kadar sonra çeviri P2A sıra kalır çoğu bağlı için C-terminus beta zinciri sinyal sıra ek bir prolin, bu değişiklik ise esnek bir bağlayıcı tarafından bağlı Alfa zincirinin TCR işlevi üzerinde zararlı bir etkisi yoktur. Fare sürekli bölgesi insan yerine yapısında sinyal akış yönündeki bileşenlere ile potansiyel değişmiş etkileşimleri önlemek için kullanılır ne zaman fare hücrelerinde yeniden dile getirdi. Tek ORF alpha ve beta zincirleri9,11stokiometrik ayrı ifade neden olur. Geçerli protokol reaktifler ve yaygın olarak kullanılan yaklaşımlar dayanmaktadır ve aerodinamik ve verimli bir şekilde yapılması için tasarlanmıştır. Biz özellikle otoimmün diyabet karıştığı self-reactive T hücrelerden TCRs tahlil için bu tekniği kullanmış olsa da, biz bu protokolü kimlik ve insan TCRs için belirli bir işlevsel değerlendirme için yaygın olarak uygulanabilir olabilir tahmin Otoimmün epitopları, kanser epitopları veya yanıt patojenlerin ve aşılar.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. ilgi T hücre nüfusu tanımlamak.

Not: antijen belirli hücre bölünmesi boya (gibi Carboxyfluorescein succinimidyl ester, CFSE) ile birlikte nükleer silahların yayılmasına karşı-ebilmek var olmak kullanılmış-T hücreleri izole etmek için onların nükleer silahların yayılmasına karşı yanıt olarak antijenik stimülasyon dayalı. PBMCs başlayan, 7 günlük vitro genişleme bir antijen belirli CFSE düşük nüfus 12 tanımlamak için yeterli olmalıdır.

  1. Mix PBMCs besleyici MHC eşlemeli hücreleri ve etiket 5 µM CFSE hücre bölünmesi boya ile 1:1.
  2. Plaka 2-2,5 x 10 5 hücre başına iyi bir 96-şey yuvarlak-alt plaka 200 µL % 10 FCS tam RPMI medya kültür.
    Not: Tam RPMI içeren 2 mM l-glutamin, 1 mM sodyum pyruvate, 100 µM MEM önemli olmayan amino asitler, 5 mM HEPES, 5.5 × 10 − 5 2-mercaptoethanol birimleri, 100 U mL − 1 penisilin ve 100 µg mL − 1 streptomisin.
  3. Teşvik hücreleri 25 µM peptid antijen ile.
  4. Kültür dördüncü gününde dikkatle kaldırın ve medya 100 µL değiştirin.
    Not: Peptit-HLA tetramers 13 kullanımı antijen spesifik T hücre kimliği için daha uygun bir yaklaşımdır. Tetramer boyama sağlar antijen özgüllük gibi HLA-kısıtlama eşzamanlı değerlendirilmesi için.

2. Tek hücre sıralama ayarlayın.

  1. Perform tüm yordamları bir başlık veya belirlenmiş bir alanda güçlendirilmiş şablon / ücretsiz. Aliquot, kontaminasyon reaktifleri temiz tüm çalışma yüzeyleri ve mümkünse, ekipman % 10 ile çamaşır suyu önce PCR Kur. Filtre ipuçları, RNAse ve Dnaz ücretsiz reaktifler ve plastik PCR ve adımları klonlama vektör kullanın. Anahtar reaktifler Malzemeler tablo bulundu.
    Not: Çoklu PCR reaksiyon son derece duyarlıdır ve kirlenme seviyesinin düşük güçlendirilmiş üründe neden olur.
  2. Generate 10 x RT tepki birleştirerek ters transkripsiyon ana mix tampon, 25 X DNTPs, 9 U RT enzim, % 0,01 Triton-X, 0.7 U RNAse inhibitörü ve 383 nM (Tablo 1 ' de listelenen) her RT-TCR astar steril pipetting Reservoir. Pipetting sırasında sıvı kaybı telafi etmek için her 96-şey plaka için 10 ek reaksiyonlar (Toplam 106), için yeterli ana karışımını oluşturur. Reaksiyon bileşenleri ve iyi başına tutarları için bkz: Tablo 2.
  3. Hazırlama bir 96-şey PCR koleksiyon plaka hücre başına iyi bir çok kanallı pipet ile ters transkripsiyon ana karışımı pipetting 6 µL sıralama için. Plaka buz veya soğuk bir blok içinde devam.
  4. Etiket (örneğin, CD4 ve CD3, veya CD8 ve CD3, her biri 2 µg/mL, hücre bölünmesi boya veya boyama tetramer) yüzey işaretleyicileri hücre için antikorlar içeren hücreleri.
  5. Bir sıralama T hücreleri hücre başına iyi, bir negatif kontrol görev yapacak on ikinci satır atlanıyor.
    Not: Sıralama verimliliğini kesin toplama plaka hizalama plaka sahibi gibi hücreleri ve plakaları cDNA reaksiyon önce düşük ısıda muhafaza içinde bağlı olacaktır. Koleksiyon tabakları buz üzerinde her zaman, dışında onlar içinde soğutma plaka tamir ederken, sıralama sırasında tutulmalıdır. Tüm sorters bir sıcaklık düzenlenmiş plaka sahibi ile donatılmıştır; Ancak, bir kullanımı önerilir. Sıralama genellikle yaklaşık 10-15 dk plaka başına alır bu yana, olup olmadığını RNA bozulması için artan bir potansiyel plaka bir düşük sıcaklıkta korunmaz.
  6. Pozitif bir denetim olarak hücreleri (100 hücreleri) daha çok sayıda el ile bir pipet ile kuyuları için bu aşamada ekleyin. Alternatif olarak, daha önce izole RNA havuza alınan hücrelerden bir olumlu denetim 10, kullanılabilir ng iyi başına.
    Not: saf denetim RNA hassasiyetle pipet ve Çapraz bulaşma diğer wells ve yanlış pozitif sonuçlar önlemek için dikkat.
  7. Yapıştırıcı film ile plaka mühür ve spin aşağı vasıl 1000 x g 5 min için saat 4'te ° C.
  8. Hemen uyarlamak RNA cDNA için 25 ° c 10 dk, 37 ° C için 45 dk, plaka kuluçka ve 10 dk. 85 ° C
    Not: verimli PCR reaksiyon emin olmak için ilk PCR reaksiyon aynı gün yapılması önerilir. Alternatif olarak, kopya etmek plakaları-80 ° C'de 2 aya kadar tutulabilir.

3. Multiplex iç içe PCR gerçekleştirmek

Not: tüm ana karıştırır kirlenmesini önlemek için bir temiz ücretsiz şablon alanda hazırlayın.

  1. Sulandırmak her değişken bölge astar Dnaz ve RNAse free H 2 O. ile 100 µM Daha sonra her birinin V-Alfa astar havuzu oluşturmak için 44 astar 20 µL birleştirin. Astar havuzu V-beta oluşturmak için her biri 40 V-beta astar artı 80 µL Dnaz ve RNAse free H 2 O. dizileri Tablo 1 ' de listelenen astar 20 µL birleştirir. Havuza alınmış bir kez her astar karışımında 2.3 µM bölgedir.
  2. Sabit bölge astar Dnaz 100 µM hisse senedi çözüm için sulandırmak ve RNAse free H 2 O. Dilute 10 µM çalışma çözüm ve aliquot kullanılmak için sabit bölge astar.
  3. İki ayrı ana karışımları TCR-Alfa ve TCR-beta amplifikasyon için hazır olun. 5 X birleştirerek ana karışımları oluşturmak tampon, 80 µM dNTPs, % 3 DMSO, 2 µM astar Havuzu (46 son konsantrasyonu nM her astar için), 200 nM TCR-sabit bölge ters astar, 1 U DNA polimeraz ve Dnaz ve RNAse free H 2 O (Tablo 2 < / strong >). Pipetting sırasında sıvı kaybı telafi etmek için yeterli ana mix 10 ek reaksiyonlar (Toplam 106), için her 96-şey plaka için makyaj.
    Not: Son şey, nerede 22.5 µL ana PCR karışımı 2.5 µL cDNA şablonu ile birleştirilmiştir başına 25 µL PCR hacmi hesaplamaları dayanır.
  4. Plaka cDNA buz veya soğuk bir blok ile tutun. Bir çok kanallı TCR-beta tepki yeni bir 96-şey PCR tabak içine 22.5 µL pipet için kullanın. Sonra cDNA 2.5 µL PCR plaka aktarmak için bir çok kanallı kullanın.
  5. Bir çok kanallı TCR-Alfa tepki içine doğrudan cDNA kalan içeren plaka 22.5 µL pipet kullanın.
  6. Yapıştırıcı, yavaşça girdap ve spin aşağı vasıl 1000 x g 5 min için saat 4'te plakalarının ° C.
  7. Multiplex PCR reaksiyon ile aşağıdaki devir çalıştırın: 95 ° C'de 5 dk 20 34 döngüsü tarafından takip s 95 ° c, 30 s 54 ° c ve 1 dk. 72 ° C'de 72 7 dakika izledi ° C.
  8. Taşıma 25 son bir hacim içinde iç içe geçmiş PCR reaksiyon dışarı µL, multiplex PCR karışımı 2.5 µL şablon olarak kullanarak.
    1. İle Dnaz ve RNAse free H 2 O. olun 10 µM aliquots çalışan hisse senedi için 100 µM için iç ve adaptör astar reconstitute.
    2. İki ayrı ana karışımları TCR-Alfa ve TCR-beta ampl için hazırlanın.ification. Mix 5 X arabellek, 25 X DNTP, % 3 DMSO, 200 nM ileri adaptör astar, 200 nM ters iç içe astar, 1 U DNA polimeraz ve DNA polimeraz ve nükleaz ücretsiz H 2 O 22.5 µL (Tablo 2) son bir birim için. Pipetting sırasında sıvı kaybı telafi etmek için yeterli ana mix 10 ek reaksiyonlar (Toplam 106), için her 96-şey plaka için makyaj.
      Not: ikinci PCR reaksiyon kullanımda 5 X PCR tampon yükleme özel jel kolaylaştırmak için içeren yükleme boya.
    3. Bir çok kanallı, kullanarak ana karışımları iyi başına 22,5 µL adlı TCR-Alfa ve TCR-beta tepkiler iki yeni 96-şey PCR tabak içine pipette.
    4. Şey başına 2.5 µL, multiplex PCR reaksiyon şablonu ekleyin.
      Not: Kalan ilk PCR reaksiyon gereken mühürlü ve gerekli olursa ek şablon, bir kaynağı olarak hizmet için-20 ° C'de depolanan (4.3 Not adım bkz:).
    5. Plakaları, yavaşça girdap ve spin aşağı vasıl 1000 x g 5 min için saat 4'te mühür ° C.
    6. İç içe geçmiş PCR reaksiyon ile aşağıdaki devir çalıştırın: 95 ° C'de 5 dk 20 34 döngüsü tarafından takip s 95 ° c, 30 s 56 ° c ve 1 dk. 72 ° C'de 72 7 dakika izledi ° C.
    7. Çalıştırmak 5 µL % 1 özel olarak tepki son jel içeren etidyum bromür (negatif ve pozitif kontrol wells de dahil olmak üzere).
      Not: Beklenen grup yaklaşık 500 bp boyutunda çalıştırmalısınız. Şekil 2 ' deki bir örnek tepki.
    8. Bir 96-şey biçimi PCR arıtma seti kullanarak ikinci reaksiyon (20 µL) kalan arındırmak, 70 ° C H 2 O şey başına 15 µL ile elute ve Sanger gerçekleştirmek sıralama. (Tablo 1) sıralama için uygun TCR-alfa veya TCR-beta adaptör ileri astar kullanın.
      Not: Dizileri online kullanılabilir immunogenetics yazılımı ile çözümlenebilir.

4. PCR zincirleri Alfa ve beta alt klonlama.

Not: ilk tepki olarak kullanılan ileri astar ve ikinci PCR reaksiyon geriye doğru astar havuzu kısıtlama siteleri birleştirmek için kullanılır. Bu nedenle, elde edilen alpha ve beta zinciri PCR ürünleri sırayla alt şablon retroviral vektör ( şekil 1) klonlanmış olmaya hazır mısınız.

Belgili tanımlık beta Urun
  1. Özet arıtılmış PCR iç içe tepki ile BstbI ve MfeI (Tablo 3).
    Not: 5 µg Ekle aşmamaktadır.
  2. Paralel olarak, BstbI ve MfeI (Tablo 3) ile şablon vektör sindirmek. 1-2 µg şablon vektörünün TCR başına kullanın. Üzerinde bir özel jel sindirilir vektör çalıştırmak ve daha büyük grup (~ 7500 bp) yalıtır. Bir jel DNA arıtma kiti ile vektör arındırmak.
    Not: restriksiyon enzimi Özet sırasında şablon fare TCR-beta değişken bölge, insan TCR-beta değişken bölge eklenmesi için izin kaldırılır.
  3. Arındırmak PCR arıtma kiti kullanılarak sindirilir PCR ürünleri.
    Not: kit ile birlikte sütunları DNA arıtma kapasitesine doğrulayın; birden fazla sütun kullanın. Arıtılmış ekleme başarılı tüp ligasyonu reaksiyon için gerekli minimum meblağ 50 dır 10 ng/µL en az bir konsantrasyon, ng. Arıtılmış Ekle tutar için başarılı bir ligasyonu yeterli değilse, ikinci PCR reaksiyon tekrar edilebilir.
  4. 37 ° C'de ısı inactivation 75 10 dk ardından kendini ligasyonu önlemek için şablon vektör 1 h için 10 U CIP enzim ile tedavi ° C. arındırmak DNA ile bir PCR arıtma Kiti (Tablo 3).
  5. Ligate TCR-beta takın ve oda sıcaklığında 30 dk için DNA ligaz 6 molar aşırı ucun 20 µL toplam birimi kullanarak vektör.
    Not: Toplamda, yaklaşık 150 ligasyonu tepki içermelidir ng DNA (Tablo 3).
  6. Dönüştürmeleri için ligasyonu tepki 8 µL 80 µL kimyasal olarak yetkili E.coli DH5α hücrelerinin (Malzemeler tablo) ile karıştırın ve 30 dk. 45 s. eklemek 500 µL için 42 ° C'de ısı şok buz üzerinde kuluçkaya Super En iyi suyu Catabolite bastırma (S.O.C.) orta ve sallamak için 1,5 saat 37 ° c
  7. Plaka 250 dışarı µL bakteriyel kültür Lysogeny suyu (LB) agar plaka içeren bir Ampisilin üzerinde. Plaka gecede (~ 16 h) 37, kuluçkaya ° C.
  8. Ertesi gün bakteri kolonileri almak ve gecede Ampisilin içeren 3 mL LB ortamda büyümek. DNA plazmid arıtma kit kullanarak plazmid DNA izole.
  9. Beta zincirinin başarılı ekleme tarafından küçük ölçekli test Özeti enzimleri BstbI ve MfeI ile onaylayın. Bir 12 µL toplam reaksiyon hacminde 200-500 µg plazmid DNA, 0,25 µL her enzim ve 10 X enzim tampon (Tablo 3) oluşur. Reaksiyon dışarı Ekle grup boyutunu onaylamak için etidyum bromür içeren bir % 1'özel jel üzerinde çalıştırmak (~ 500 bp).
  10. Ekleme varlığı onayladıktan sonra sıra IRES ters astar (Tablo 1) kullanarak vektör TCR-beta bölümü.
  11. Sıra onay TCR-beta ucun takip Alfa değişken bölge ekleme için benzer işlemler gerçekleştirmek. Alfa iç içe tepki ve SnaBI ve SacII ile vektör içeren yeni oluşturulan TCR-beta INSERT arıtılmış PCR Urun sindirmek.
    Not: restriksiyon enzimi Özet sırasında şablon fare TCR-Alfa değişken bölge, insan TCR-Alfa değişken bölge eklenmesi için izin kaldırılır.
  12. Ligate Alfa ekler içine oda sıcaklığında 30 dk için DNA ligaz 6 molar aşırı ucun 20 µL toplam birimi kullanarak karşılık beta değişken bölge kodlaması TCR vektörel çizimler.
    Not: Toplamda, yaklaşık 150 ligasyonu tepki içermelidir ng DNA (Tablo 3).
  13. Dönüştürmeleri için ligasyonu tepki 8 µL 80 µL kimyasal olarak yetkili E.coli DH5α hücrelerinin (Malzemeler tablo) ile karıştırın ve 30 dk. 45 s. eklemek 500 µL S.O.C. için 42 ° C'de ısı şok buz üzerinde kuluçkaya Orta ve sallamak için 1,5 saat 37 ° c
  14. Plaka 250 dışarı µL bakteriyel kültür Lysogeny suyu (LB) agar plaka içeren bir Ampisilin üzerinde. Plaka gecede (~ 16 h) 37, kuluçkaya ° C.
  15. Ertesi gün bakteri kolonileri almak ve gecede Ampisilin içeren 3 mL LB ortamda büyümek. DNA plazmid arıtma kit kullanarak plazmid DNA izole.
  16. Alfa zinciri başarılı ekleme tarafından küçük ölçekli test Özeti enzimleri SnaBI ve SacII ile onaylayın. 12 µL toplam reaksiyon hacminde 200-500 µg plazmid DNA, 0,25 µL her enzim ve 10 x enzim tampon (Tablo 3) oluşur. Reaksiyon dışarı Ekle grup boyutunu onaylamak için etidyum bromür içeren bir % 1'özel jel üzerinde çalıştırmak (~ 500 bp).
  17. Ekleme varlığı onayladıktan sonra sıra MSCV2 ileri astar (Tablo 1) kullanarak vektör TCR-alfa bölümünü.
  18. Alfa zinciri sıra doğrulandıktan sonra sıralama ile TCR-beta-ters ve IRES mütedavil astar (Tablo 1) tarafından tam TCR Ekle doğrulayın.

5. TCR hücre yüzey ifade ve özgüllük doğrulayın.

Not: HEK293T hücreleri başarılı TCR zincir PARI sınamak için kullanılırNG ve hücre ifade ( şekil 3A) 8 yüzey. Peptid-MHC tetramer boyama da gerçekleştirilebilir antijenik özgüllük yazı TCR gen yalıtımı ( şekil 3B) saklamak için test etmek için transfected HEK293T hücrelerde.

  1. Plaka dışarı HEK293T hücreler 12-iyi doku kültürü plakaları, 1 mL tam DMEM medya içeren % 5 FCS kuyuda başına 1 x 10 5 hücre ve kültür gecede at 37 ° C. plaka ayrı wells her yeni TCR için tanımladığınız için yeterince hücre dışarı , denetim şablonu TCR vektör, CD3 vektör sadece, kontrol TCR vektör tek ve bir transfected de.
    Not: Transfection bir şablonla tam olarak fare TCR vektör (mTCR-pMIA) kombinasyonu ile mCD3εγδζ-pMIG vektör, vektör yalnız, mTCR-pMIA ve mCD3εγδζ-pMIG vektör yalnız pozitif ve negatif denetimler kullanılır.
    Not: Tam DMEM 2 mM L-glutamin, 1 mM sodyum Pyruvate, 100 µM içerir Sigara-esansiyel Amino asitler, 5 mM HEPES tampon, 5,5 x 10 -5 ünite 2-mercaptoethanol, 100 U/ml penisilin/streptomisin.
  2. Ertesi gün 1 µg chimeric h/mTCR-pMIA vektör, 1 µg fare CD3εγδζ-pMSCVII-GFP (pMIG) vektör ve üretici talimatları lipozom tabanlı transfection reaktif hücrelerle transfect.
  3. Her TCR için 6 µL transfection reaktif 100 µL oda sıcaklığına, serum-Alerjik DMEM ekleyin. Kısaca girdap ve 15 dakika süreyle oda sıcaklığında kuluçkaya
  4. Ayrı 1,5 mL tüpler TCR-pMIA vektör 1 µg 1 µg fare CD3εγδζ-pMSCVII-GFP (pMIG) vektör veya denetimler için ayrı her vektör 1 µg birleştirin.
  5. Dropwise, vektör DNA içeren tüpler transfection reaktif/DMEM çözüm ekleyin. 15 dakika süreyle oda sıcaklığında kuluçkaya
  6. Dropwise, HEK293T hücrelere transfection reaktif/DMEM/DNA çözüm ekleyin. Yavaşça karıştırın için plaka dokunun. 24 h için 37 ° C'de kuluçkaya
  7. Sonra 24 h ortamı, değiştirin ve hücreler kültür ek 24 h için tutmak
  8. Kaldırmak hücreleri plaka dinç pipetting tarafından ve anti-fare CD3 antikor (2,5 µg/mL) Akış Sitometresi tarafından chimeric TCR yüzey ifade doğrulamak için hücrelerle leke.
  9. CD3 ifade benzer bir seviyeye transfected hücreler arasında karşılaştırmak için
  10. kapı hücreleri floresan muhabir molekülleri (CD3 kompleksinin için GFP ve Ametrine TCR ifade vektör için) benzer yüksek düzeyde ifade analiz. En iyi şekilde, analiz geçişli GFP + Ametrine + 10 içindeki hücreleri 4 ' e 10 5 floresan yoğunluğu ( şekil 3A).
    Not: Sahip chimeric yapı transfected hücrelerin CD3 ifade düzeyini kontrol fare (özgün şablon) vektör ( şekil 3A) yakın olabilir. Oluşturulan TCR retroviral vektörler vivo içinde ifade sistemleri ile uyumlu yukarıda açıklanan 4.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Multiplex iç içe PCR reaksiyon verimliliğini adım 3.2.7 (Şekil 2) bir özel jel ikinci reaksiyon 5µL çalıştırarak kontrol edilir. Ortalama TCR-beta amplifikasyon verimliliğini TCR-Alfa tepki verimliliğini yaklaşık %50 genellikle düşük ise yaklaşık % 80, olması bekleniyor4. Sadece eşlenmiş zincirleri TCR-Alfa ve TCR-beta-ebilmek var olmak kullanılmış için TCR ifade; Ancak, tüm PCR ürünleri TCR sıra ve repertuar bilgi edinmek için sıralı.

Gene susturmak yalnızca belirli T hücre içinde ifade edilecek tek bir TCR-beta zinciri izin verecektir. Ancak, T hücre ikinci TCR-Alfa zinciri yeniden düzenleme yeteneğine sahiptir ve T hücrelerinin yaklaşık % 25 ikinci bir çerçeve TCR-Alfa ifade 14zincir. Bu bazı oranla izole TCR-Alfa zincirleri "doğru" Alfa zinciri yerine ikincil Alfa olacağı bekleniyor. İkincil Alfa zinciri kez en iyi bağlama ortak TCR-beta zinciri ile değil; Sonuç olarak, bu tüm klonlanmış TCRs istikrarlı bir karmaşık ve hızlı hücre yüzeyinde oluşturacak bekleniyor. Bu nedenle, uygun TCR zincir eşleştirme ve hücre yüzey ifade HEK293T hücreleri (şekil 3A) transfecting tarafından onaylanması gerekir.

Figure 1
Resim 1 . Aerodinamik multiplex iç içe PCR ve tek T hücrelerden retroviral yapı geliştirme. PCR iki tur neden karşılık gelen TCR alpha ve beta zincirleri amplifikasyon içinde. Kısıtlama siteleri astar gömülü aerodinamik alt klonlama ve insan/fare chimeric vektör nesil fare hücrelerinde ifade için izin verir. Şablon fare vektör kolayca değişken fare bölgeler bir chimeric insan/fare TCR retroviral vektör ifade ile uyumlu fare hücrelerinde üreten insan için dışarı geçiş yapmak için kullanılabilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 . Tek hücre PCR örneği. T hücre reseptör beta ve alfa zincirleri tek insan T hücreleri bir 96-şey plaka göre iç içe geçmiş PCR güçlendirme multiplex. Gösterilmiştir tek hücreden karşılık gelen (üst ve alt) PCR ürünleri güçlendirilmiş TCR beta ve TCR Alfa zincirleri insan PBMCs. NC - şablon kontrol, PC - pozitif kontrol. Tepki küçük bir bölümünü bir özel jel (5 µL) çalıştırarak, tek hücre alpha ve beta zinciri PCR reaksiyonları verimliliğini sıralama. PCR ürünü önce doğruladı Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3 . Doğrulama hücre yüzey chimeric TCR ifade ve özgüllüğü. (A)HEK293T hücre ile transfected TCR veya bir insan/fare fare fare CD3εγδζ ile birlikte chimeric TCR. Hücre yüzey TCR ifade anti-mCD3ε antikor ile ölçüldü. Strateji geçişi: ilk olarak, analiz Ametrine ve GFP Çift Kişilik pozitif hücrelerinin üzerinde (G2) işlenir. Tek vektör denetimler söz konusu olduğunda çoğunluğuna tek floresan (G1) dayanması gerekiyor. İkinci olarak, G1 ve G2 hücrelerden CD3ε ifade düzeyi için analiz edilir. (B) TCR özgüllüğü olduğunu doğruladı DRB1 ile 293T hücrelerinin tetramer boyama * 0401:GAD115-127 tetramer. Analiz GFP + Ametrine + CD3ε + hücreler, (A) gösterildiği gibi işlenir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

HEDEF GEN ASTAR YÖNLENDİRME SIRA
Ters transkripsiyon
TRAC cDNA AGCTGGACCACAGCCG
TRBC1 cDNA GAAATCCTTTCTCTTGACCATG
TRBC2 cDNA GCCTCTGGAATCCTTTCTCT
TCR Alfa PCR reaksiyon 1
TRAV1-1 İleri CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGCTTTCCTTCTCTATGTTT
TRAV1-2 İleri CGGTTCAGCAGGAATGCCtacgtaATGTGGGGAGTTTTCCTTCTTTATGTTTC
TRAV2 İleri CGGTTCAGCAGGAATGCCtacgtaATGGCTTTGCAGAGCACTCTGG
TRAV3 İleri CGGTTCAGCAGGAATGCCtacgtaATGGCCTCTGCACCCATCTCG
TRAV4 İleri CGGTTCAGCAGGAATGCCtacgtaATGAGGCAAGTGGCGAGAGTGATC
TRAV5 İleri CGGTTCAGCAGGAATGCCtacgtaATGAAGACATTTGCTGGATTTTCGTTC
TRAV6 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAGTCATTCCTGGGAGGTGTTT
TRAV7 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGATGCGGAGACCTGTC
TRAV8-1 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGTTGCTCATACCAGTGC
TRAV8-2 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGCTGCTCGTCCC
TRAV8-3 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTCCTGGAGCTTATCCCACTG
TRAV8-7 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTCTTAGTGGTCATTCTGCTGCTT
TRAV9-1 İleri CGGTTCAGCAGGAATGCCtacgtaATGAATTCTTCTCCAGGACCAGCG
TRAV9-2 İleri CGGTTCAGCAGGAATGCCtacgtaATGAACTATTCTCCAGGCTTAGTATCTCTGATACTC
TRAV10 İleri CGGTTCAGCAGGAATGCCtacgtaATGAAAAAGCATCTGACGACCTTCTTG
TRAV12-1 İleri CGGTTCAGCAGGAATGCCtacgtaATGATATCCTTGAGAGTTTTACTGGTGATCC
TRAV12-2 İleri CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTAGTGATCC
TRAV12-3 İleri CGGTTCAGCAGGAATGCCtacgtaATGATGAAATCCTTGAGAGTTTTACTGGTG
TRAV13-1 İleri CGGTTCAGCAGGAATGCCtacgtaATGACATCCATTCGAGCTGTATTTATATTCC
TRAV13-2 İleri CGGTTCAGCAGGAATGCCtacgtaATGGCAGGCATTCGAGCTTTATTT
TRAV14 İleri CGGTTCAGCAGGAATGCCtacgtaATGTCACTTTCTAGCCTGCTGAAGGTG
TRAV16 İleri CGGTTCAGCAGGAATGCCtacgtaATGAAGCCCACCCTCATCTCAGTG
TD > TRAV17 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAAACTCTCCTGGGAGTGTCTTTG TRAV18 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTGTCTGCTTCCTGCTCAGG TRAV19 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTGACTGCCAGCCTGTTGAG TRAV20 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAGAAAATGTTGGAGTGTGCATTC TRAV21 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAGACCCTCTTGGGCCTG TRAV22 İleri CGGTTCAGCAGGAATGCCtacgtaATGAAGAGGATATTGGGAGCTCTGCT TRAV23 İleri CGGTTCAGCAGGAATGCCtacgtaATGGACAAGATCTTAGGAGCATCATTTTTAG TRAV24 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAGAAGAATCCTTTGGCAGCC TRAV25 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTACTCATCACATCAATGTTGGTCTTAT TRAV26-1 İleri CGGTTCAGCAGGAATGCCtacgtaATGAGGCTGGTGGCAAGAGTAACTG TRAV26-2 İleri CGGTTCAGCAGGAATGCCtacgtaATGAAGTTGGTGACAAGCATTACTGTACTCC TRAV27 İleri CGGTTCAGCAGGAATGCCtacgtaATGGTCCTGAAATTCTCCGTGTCC TRAV29 İleri CGGTTCAGCAGGAATGCCtacgtaATGGCCATGCTCCTGGGGG TRAV30 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAGACTCTCCTGAAAGTGCTTTCAG TRAV34 İleri CGGTTCAGCAGGAATGCCtacgtaATGGAGACTGTTCTGCAAGTACTCCTAGG TRAV35 İleri CGGTTCAGCAGGAATGCCtacgtaATGCTCCTTGAACATTTATTAATAATCTTGTGG TRAV36 İleri CGGTTCAGCAGGAATGCCtacgtaATGATGAAGTGTCCACAGGCTTTACTAGC TRAV38-1 İleri CGGTTCAGCAGGAATGCCtacgtaATGACACGAGTTAGCTTGCTGTGGG TRAV38-2 İleri CGGTTCAGCAGGAATGCCtacgtaATGGCATGCCCTGGCTTCCT TRAV39 İleri CGGTTCAGCAGGAATGCCtacgtaATGAAGAAGCTACTAGCAATGATTCTGTGG TRAV40 İleri CGGTTCAGCAGGAATGCCtacgtaATGAACTCCTCTCTGGACTTTCTAATTCTGA TRAV41 İleri CGGTTCAGCAGGAATGCCtacgtaATGGTGAAGATCCGGCAATTTTTG TRAC dış Ters CAGACAGACTTGTCACTGGATTTAGAGTCTC TCRbeta PCR reaksiyon 1 TRBV2 İleri CAGAAGACGGCATACGAGATcaattgATGGATACCTGGCTCGTATGCTGG TRBV3-1 İleri CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTCCTCTG TRBV4-1 İleri CAGAAGACGGCATACGAGATcaattgATGGGCTGCAGGCTGCTCTG TRBV5-1 İleri CAGAAGACGGCATACGAGATcaattgATGGGCTCCAGGCTGCTCTGTT TRBV5-3 İleri CAGAAGACGGCATACGAGATcaattgATGGGCCCCGGGCTCC TRBV5-4 İleri CAGAAGACGGCATACGAGATcaattgATGGGCCCTGGGCTCCTCT TRBV5-8 İleri CAGAAGACGGCATACGAGATcaattgATGGGACCCAGGCTCCTCTTCT TRBV6-1 İleri CAGAAGACGGCATACGAGATcaattgATGAGCATCGGGCTCCTGTGC TRBV6-2 İleri CAGAAGACGGCATACGAGATcaattgATGAGCCTCGGGCTCCTGTG TRBV6-4 İleri CAGAAGACGGCATACGAGATcaattgATGAGAATCAGGCTCCTGTGCTGTG TRBV6-6 İleri CAGAAGACGGCATACGAGATcaattgATGAGCATCAGCCTCCTGTGCTG TRBV7-1 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGCTCCTCTGC TRBV7-2 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTTCT TRBV7-3 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCCTCTG TRBV7-6 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACCAGTCTCCTATGCTG TRBV7-7 İleri CAGAAGACGGCATACGAGATcaattgATGGGTACCAGTCTCCTATGCTGGG TRBV7-9 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACCAGCCTCCTCTG TRBV9 İleri CAGAAGACGGCATACGAGATcaattgATGGGCTTCAGGCTCCTCTGCT TRBV10-1 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACGAGGCTCTTCTTCTATG TRBV10-2 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACCAGGCTCTTCTTCTATG TRBV10-3 İleri CAGAAGACGGCATACGAGATcaattgATGGGCACAAGGTTGTTCTTCTATGTG TRBV11-1 İleri CAGAAGACGGCATACGAGATcaattgATGAGCACCAGGCTTCTCTGCTG TRBV11-3 İleri CAGAAGACGGCATACGAGATcaattgATGGGTACCAGGCTCCTCTGCTG TRBV12-3 İleri CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCTTCTGCTGT TRBV12-4 İleri CAGAAGACGGCATACGAGATcaattgATGGACTCCTGGACCCTCTGCTG TRBV12-5 İleri CAGAAGACGGCATACGAGATcaattgATGGCCACCAGGCTCCTCTG TRBV13 İleri CAGAAGACGGCATACGAGATcaattgATGCTTAGTCCTGACCTGCCTGACTC TRBV14 İleri CAGAAGACGGCATACGAGATcaattgATGGTTTCCAGGCTTCTCAGTTTAGTGT TRBV15 İleri CAGAAGACGGCATACGAGATcaattgATGGGTCCTGGGCTTCTCCACT TRBV16 İleri CAGAAGACGGCATACGAGATcaattgATGAGCCCAATATTCACCTGCATCA TRBV17d >İleri CAGAAGACGGCATACGAGATcaattgATGGATATCTGGCTCCTCTGCTGG TRBV18 İleri CAGAAGACGGCATACGAGATcaattgATGGACACCAGAGTACTCTGCTGTGC TRBV19 İleri CAGAAGACGGCATACGAGATcaattgATGAGCAACCAGGTGCTCTGCTG TRBV20 İleri CAGAAGACGGCATACGAGATcaattgATGCTGCTGCTTCTGCTGCTTCT TRBV24-1 İleri CAGAAGACGGCATACGAGATcaattgATGGCCTCCCTGCTCTTCTTCTG TRBV25-1 İleri CAGAAGACGGCATACGAGATcaattgATGACTATCAGGCTCCTCTGCTACATGG TRBV27 İleri CAGAAGACGGCATACGAGATcaattgATGGGCCCCCAGCTCCTTG TRBV28 İleri CAGAAGACGGCATACGAGATcaattgATGGGAATCAGGCTCCTCTGTCG TRBV29-1 İleri CAGAAGACGGCATACGAGATcaattgATGCTGAGTCTTCTGCTCCTTCTCCT TRBV30 İleri CAGAAGACGGCATACGAGATcaattgATGCTCTGCTCTCTCCTTGCCCT TRBC dış Ters GTGGCCAGGCACACCAGTGTG TCR Alfa PCR reaksiyon 2 TRAC iç Ters CAGCTGGTACAccgcggGGTCAGGGTTCTG TRAV adaptörü İleri CGGTTCAGCAGGAATGCCtacgtaATG TCR beta PCR reaksiyon 2 TRBC iç Ters CTCTGCTTCTGATGGttcgaaCACAGCGACCTCGG TRBV adaptörü İleri CAGAAGACGGCATACGAGATcaattgATG Sıralama astar pMSCV-II İleri CCTCCTCTTCCTCCATCCGCC TCRbeta Ters GCCAAGCACACGAGGGTAGCC IRES Ters AACGCACACCGGCCTTATTCC * Küçük harf harfler astar dizileri içinde eklenen restriksiyon enzimi siteleri kesmek gösterir

Tablo 1: Ters transkripsiyon, PCR ve sıralama astar.

Adım 2.2 iyi başına tutarları
RT-PCR reaksiyon (6μL) (μL)
10 x arabellek 0,6
2 x dNTP 0,24
% 10 Triton X 0,06
3 TCR özgü astar (10mM ea.) 0,23 ea. (x 3 = 0,69)
Enzim 0.18
Rnase inhibitörü 0,28
NF(nuclease-Free)-H2O 3,95
Adım 3.1
PCR reaksiyon 1 (25μL) (μL) b PCR reaksiyon 1 (25μL) (μL)
5 x arabellek 5 5 x arabellek 5
dNTP (10mM) 1 dNTP (10mM) 1
DMSO 0,75 DMSO (% 3) 0,75
bir havuz (F astar) (2.3μM) 0,3 b Havuzu (F astar) (2.3μM) 0,5
bir dış R astar (10uM) 0,6 b dış R astar (10μM) 1
DNA polimeraz 0,2 Taq polimeraz git 0,2
RT-PCR cDNA 2.5 RT-PCR cDNA 2.5
NF-H2O 14,65 NF-H2O 14,05
Adım 3.8
PCR reaksiyon 2 - için aynı bir ve b (25μL) (μL)
5 x arabellek 5
dNTP (10mM) 1
DMSO 0,75
Adaptör F astar (10μM) 1
İç R astar (10μM) 1
DNA polimeraz 0,2
PCR rxn 1 ürün 2.5
NF-H2O 13.55

Tablo 2. Ters transkripsiyon ve PCR reaksiyonları.

Adım 4.2 ve 4.3
TRBV Özet reaksiyon (50μL) (μL) mTCR-pMIA vektör Özet (500μL) (μL)
DNA (~ 20μg) DNA (~ 20μg)
MfeI 2 MfeI 20
BstbI 2 BstbI 20
10 x arabellek 5 10 x arabellek 50
H2O H2O
Adım 4.4
CIP reaksiyon (100μL) (μL) DNA(~1.5mG)
> Sindirilmiş & vektör DNA saf 84 10 x arabellek 10 CIP enzim 6 Adım 4.5 Tüp ligasyonu reaksiyon (20μL) (μL) Sindirmek/CIPed vektör DNA (Toplam Ekle ve vektör tutardır ~ 150ng) DNA Ekle (vektör için 6 molar erişim) Ligaz arabellek x 2 10 Ligaz enzim 1 H2O Adım 4,9 Test Özet reaksiyon (12μL) (μL) DNA (100-300ng) 1 MfeI 0,25 BstbI 0,25 10 x arabellek 1.2 H2O 9,3 Adım 4.11 TRAV Özet reaksiyon (60μL) (μL) İçeren Beta - mTCR-pMIA vektör Özet (120μL) DNA(~1.5μg) DNA (~ 3μg) SnaBI 3 MfeI 6 SacII 2 BstbI 4 10 x arabellek 6 10 x arabellek 10 H2O H2O

Tablo 3. Klonlama reaksiyonlar vektör.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Geçerli protokol tek hücre TCR amplifikasyon ve sonraki eşleştirilmiş TCR alpha ve beta zincirleri bir şablon retroviral ifade vektör alt klonlama için verimli bir yöntem açıklanmaktadır. Her ne kadar bazı tek hücre PCR protokollerine geliştirilmiştir, hiçbiri defa hemen bir ifade vektör alt klonlama ile uyumlu olması. Çoğu durumda, son derece değişken CDR3 bölgeleri kapsayan bir kısmi sıra, değişken bölge ulaşmak için yeterli sırası ile güçlendirilmiş. Bu daha küçük PCR ürün boyutu yüksek PCR verimliliği destekler, ancak de novo TCR gen sentezi için fonksiyonel çalışmaları gerektirir. Geçerli protokol CDR3 odaklı daha önce yayımlanmış tek hücre TCR sıralama iletişim kuralları, aynı zamanda tüm değişken bölge klonlama için uygun içeren daha uzun bir amplicon verimli verimliliğini tutar. Bu nedenle, açıklanan sistem işlev çıktı yanı sıra bir nicel sıra vererek artan bir esnekliğe sahiptir.

Bilimsel soru ele bağlı olarak, kaynak ve özgüllük analiz T hücrelerinin değişebilir. Ancak, nihai hedef proje içinde vivo TCR işlevi analizi ise, HLA kısıtlama izole T hücrelerinin biliyorum gereklidir. Geçerli protokol vivo içinde TCR ifade HLA insanlaşmış farelerde ile uyumlu olacak şekilde özel olarak tasarlanmıştır. Çoğu bu fareler üretilen ve şimdi HLA-A2.1, HLA-DQ8 dahil olmak üzere ticari olarak kullanılabilir (HLA-DQA1 * 301, HLA-DQB1 * 302), HLA-DQ6 (DQA1 * 0102, HLADQB1 * 0602), HLA-DR4 (DRB1 * 0401), HLA-DR1 (DRA * 0101, DRB1 * 0101), HLA-A11 (A * 11:01 / K), HLA-B2705, HLA-A24 ve HLA - B * 0702 transgenik suşları. Bu iletişim kuralı başarıyla retroviral aracılı kemik iliği kök hücre ifade insan TCRs4,15,16için daha önce yayımlanmış protokolü ile kombine edilebilir. Otoimmün, beklediğimiz insanlaşmış TCR retrogenic sistemi uygulanabilir ve çeşitli insan TCRs fonksiyonel analiz için son derece yararlı olacak kanser ve enfeksiyon modelleri.

Şu anki tek hücre PCR Protokolü kritik adımları açıklar ve eşleştirilmiş TCR-Alfa ve TCR-beta sahneleri başarılı amplifikasyon için gerekli öneriler verir. İlk kritik adım cDNA transkripsiyon zamanında performansını ve çoklu PCR sonraki ilk tur olduğunu. Tüm adımları yer-meli var olmak kılınmak zamanında ve tüm reaktifler ve hücrelerin RNA ve cDNA yıkımı önlemek için buz tuttu. İkinci olarak, iletişim kuralı şablonu seviyesinin düşük son derece hassas olmak için tasarlandığından, kirlenme için son derece duyarlı. Bu nedenle, güçlendirilmiş PCR ürünleri veya vektör TCR klonlama uzak bir ücretsiz şablon alanında çalışmak şarttır. Bir ayrı oda ya da hood cDNA ve PCR reaksiyonları ayarlamak için kullanılır. İlk PCR reaksiyon şablonundan farklı bir alanda nerede PCR kurmak--dan eklenmesi gerekir. Bölünmemeli reaktifler ayrı bir kümesi tek hücre PCR deneyler için kullanılması tavsiye edilir.

Bu iletişim kuralı özellikle Malzemeler tabloiçinde listelenen reaktifler kullanarak optimize edilmiş ve herhangi bir oyuncu değişikliği reaktifler içinde ek optimizasyonu gerektirir. Antijen spesifik hücreleri ilk kimlik peptid-MHC tetramers kullanmak için değiştirilebilir. Tetramer boyama antijen özgüllük gibi HLA-kısıtlama eşzamanlı değerlendirmesi için sağlar. Upregulation erken harekete geçirmek işaretleri veya inflamatuar sitokinlerin salgılanmasını gibi antijen reaktivite tespiti için alternatif yöntemler tetramer reaktifler olmaması durumunda kabul edilebilir. Örneğin, çift özgüllük füzyon antikorlar T hücre antijen ve IFNγ için özel antijen reaktif IFNγ üreten hücreler için zenginleştirmek için manyetik boncuk yalıtım ile kombine edilebilir.

Bizim iletişim kuralında tanımlanan chimeric insan/fare yapı fare hücreleri ile uyumluluğunu sağlar iken, insan CD3 kompleksinin ile uyumluluk düzeyi bilinmiyor. Resmen değil bizim tarafımızdan test rağmen diğerleri chimeric TCR yapıları fare sürekli bölgeleriyle insan lenfosit17yüzeyinde ifade edilebilir göstermiştir. Bu fare TCR sürekli bölgeler insan CD3 karmaşık sinyal ile etkileşim destekleyebilir gösterir. Ancak, Eğer amaç insan Primer hücre veya Jurkat hücreleri gibi insan hücre hatları tespit TCRs ifade etmek için tamamen insan bir yapı kullanan için daha iyi bir yaklaşım olabilir. Bu vektör içinde fare sürekli bölgeler insan sürekli bölgeleriyle swapping tarafından gerçekleştirilebilir.

Tanımlanan bir TCR değişken bölge klonlama için kullanılan kısıtlama sitelerinden birini içeriyorsa, TCR Servisi vektör eklenmesi gereken ve daha sonra kısıtlama içinde sessiz nükleotid değişim ikna etmek için bir site yönettiği mutagenesis kit kullanarak mutasyona uğramış site kesmek. TCR değişken bölge istenmeyen kısıtlama sitesi dışlamak için modifiye ilgi de novo sentezi bir alternatif yaklaşımdır.

Ana bu teknik yetersizlik ikincil 'sitoplazmik' Alfa zincirleri amplifikasyon ortadan kaldırmak için kısıtlamadır. TCR-Alfa gen TCR-beta genler gibi allelic dışlama ile böylece T hücreleri önemli bir bölümünü ikincil 'sitoplazmik' Alfa zinciri14hızlı gitme. Açıklanan PCR Protokolü sadece güçlendirilmiş Alfa zinciri ile güçlendirilmiş beta zinciri çifti değil 'sitoplazmik' Alfa zinciri olup olmadığını ama bir TCR Alfa zinciri amplifikasyon sonuçlanır. Bu nedenle, başarılı zincir eşleştirme sağlamak için HEK293T hücrelerde TCR hücre yüzey ifade sınamak için şarttır.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Bu çalışmada JDRF 1-FAC-2014-243-A-N, ADA 7-14-JF-07, NIH 5 P30 DK079638-05 PILOT PJ ve Robert ve Janice McNair Vakfı tarafından finanse edildi.

Biz Sandra Pena ve Andrene McDonald hasta işe alım, Samuel Blum için teknik destek, Dr George Makedonas antikorlar ve kontrol DNA PCR optimizasyonu için kullanılan hediye için teşekkür ederim.

Materials

Name Company Catalog Number Comments
CFSE  eBioscience  65-0850-84 5 mM
anti-human CD4 (OKT4) BV421 Biolegend  317433 2 mg/mL
anti-human CD3 (OKT3) PerCP/Cy5.5 Biolegend  317336 2 mg/mL
anti-mouse CD3 AF647 Biolegend  100322 2.5 mg/mL
Recombinant RNAse inhibitor biotech grd 2.5KU   VWR 97068-158 0.7 U
Applied Biosystems High capaity cDNA RT kit  Invirtogen  4368814 9 U (RT enzyme) 
NF-H2O: Nuclease-free water 1000mL Invirtogen  AM9932
Gotaq DNA polymerase 2500U VWR PAM3008 1 U
96 Well Half Skirt PCR Plate Phenix MPX-96M2
MicroAmp Clear Adhesive Film  ThermoFisher  4306311
UltraPure Agarose  Invirtogen  15510-027
SnaBI New England Biolabs  R0130 15 U (insert) 30 U (vector)
SacII New England Biolabs  R0157 40 U (insert) 80 U (vector)
MfeI New England Biolabs  R3589S 40 U (insert) 80 U (vector)
BstBI New England Biolabs  R0519 40 U (insert) 80 U (vector)
Calf Intestinal Phosphatase (CIP) New England Biolabs  M0290S 10 U
Quick ligase  New England Biolabs  M2200S
Wizard Plus minipreps DNA purification systems  Promega  A1460
Wizard Plus midipreps DNA purification systems  Promega  A7640
DNA clean & concentrator-25 kit Genesee Scientific  11-304C
ZR-96 DNA clean & concentrator-5 kit Genesee Scientific  11-306A
QIAquick gel extraction kit Qiagen 28704
QIAquick PCR purification kit Qiagen 28104
Subcloning Efficiency DH5a Competent Cells  ThermoFisher  18265017
Transit LT-1 Reagent 1mL (transfection reagent) Mirus  MIR2300
BD FACS Aria II (sorter) BD
BD Fortessa (flow cytometer) BD 

DOWNLOAD MATERIALS LIST

References

  1. Germain, R. N. T-cell development and the CD4-CD8 lineage decision. Nat Rev Immunol. 2, (5), 309-322 (2002).
  2. Singer, A., Adoro, S., Park, J. H. Lineage fate and intense debate: myths, models and mechanisms of CD4- versus CD8-lineage choice. Nat Rev Immunol. 8, (10), 788-801 (2008).
  3. Tubo, N. J., et al. Single naive CD4+ T cells from a diverse repertoire produce different effector cell types during infection. Cell. 153, (4), 785-796 (2013).
  4. Sprouse, M. L., et al. Rapid identification and expression of human TCRs in retrogenic mice. J Immunol Methods. (2016).
  5. Lennon, G. P., et al. T cell islet accumulation in type 1 diabetes is a tightly regulated, cell-autonomous event. Immunity. 31, (4), 643-653 (2009).
  6. Dash, P., et al. Paired analysis of TCRalpha and TCRbeta chains at the single-cell level in mice. J Clin Invest. 121, (1), 288-295 (2011).
  7. Kobayashi, E., et al. A new cloning and expression system yields and validates TCRs from blood lymphocytes of patients with cancer within 10 days. Nat Med. 19, (11), 1542-1546 (2013).
  8. Szymczak, A. L., et al. Correction of multi-gene deficiency in vivo using a single 'self-cleaving' 2A peptide-based retroviral vector. Nat Biotechnol. 22, (5), 589-594 (2004).
  9. Szymczak, A. L., Vignali, D. A. Development of 2A peptide-based strategies in the design of multicistronic vectors. Expert Opin Biol Ther. 5, (5), 627-638 (2005).
  10. Bettini, M. L., Bettini, M., Vignali, D. A. T-cell receptor retrogenic mice: a rapid, flexible alternative to T-cell receptor transgenic mice. Immunology. 136, (3), 265-272 (2012).
  11. Holst, J., Vignali, K. M., Burton, A. R., Vignali, D. A. Rapid analysis of T-cell selection in vivo using T cell-receptor retrogenic mice. Nat Methods. 3, (3), 191-197 (2006).
  12. Mannering, S. I., et al. A sensitive method for detecting proliferation of rare autoantigen-specific human T cells. J Immunol Methods. 283, (1-2), 173-183 (2003).
  13. James, E. A., LaFond, R., Durinovic-Bello, I., Kwok, W. Visualizing antigen specific CD4+ T cells using MHC class II tetramers. J Vis Exp. (25), (2009).
  14. Corthay, A., Nandakumar, K. S., Holmdahl, R. Evaluation of the percentage of peripheral T cells with two different T cell receptor alpha-chains and of their potential role in autoimmunity. J Autoimmun. 16, (4), 423-429 (2001).
  15. Lee, T., Shevchenko, I., Sprouse, M. L., Bettini, M., Bettini, M. L. Retroviral Transduction of Bone Marrow Progenitor Cells to Generate T-cell Receptor Retrogenic Mice. J Vis Exp. (113), (2016).
  16. Bettini, M. L., Bettini, M., Nakayama, M., Guy, C. S., Vignali, D. A. Generation of T cell receptor-retrogenic mice: improved retroviral-mediated stem cell gene transfer. Nat Protoc. 8, (10), 1837-1840 (2013).
  17. Cohen, C. J., Zhao, Y., Zheng, Z., Rosenberg, S. A., Morgan, R. A. Enhanced antitumor activity of murine-human hybrid T-cell receptor (TCR) in human lymphocytes is associated with improved pairing and TCR/CD3 stability. Cancer Res. 66, (17), 8878-8886 (2006).
Tek hücre TCR yalıtım ve üretme-in <em>Vitro </em>için Retroviral Vektörler ve <em>In Vivo</em> ifade insan TCRs aerodinamik
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).More

Sprouse, M. L., Blahnik, G., Lee, T., Tully, N., Benarjee, P., James, E. A., Redondo, M. J., Bettini, M. L., Bettini, M. Streamlined Single Cell TCR Isolation and Generation of Retroviral Vectors for In Vitro and In Vivo Expression of Human TCRs. J. Vis. Exp. (127), e55379, doi:10.3791/55379 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video
Waiting X
Simple Hit Counter