Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Techniques pour induire et Quantifier cellulaire sénescence

doi: 10.3791/55533 Published: May 1, 2017

Summary

Cellulaire sénescence, l'état irréversible de l'arrêt du cycle cellulaire, peut être induite par diverses contraintes cellulaires. Ici, nous décrivons les protocoles pour induire la sénescence cellulaire et des méthodes pour évaluer les marqueurs de sénescence.

Abstract

En réponse au stress cellulaire ou les dommages, les cellules qui prolifèrent peuvent induire un programme spécifique qui déclenche un état d'arrêt du cycle cellulaire à long terme, appelé sénescence cellulaire. L' accumulation de cellules sénescentes se produit avec le vieillissement organismal et par mise en culture continue in vitro. Les cellules sénescentes influencent de nombreux processus biologiques, y compris le développement embryonnaire, la réparation et la régénération des tissus, la suppression des tumeurs et le vieillissement. Poinçons de cellules sénescentes comprennent, mais sans s'y limiter, l'augmentation de l'activité β-galactosidase associée sénescence (SA-β-gal); p16 INK4a, p53 et p21 niveaux; des niveaux plus élevés de dommages à l'ADN, y compris les γ-H2AX; la formation d'hétérochromatine associée à la sénescence Foci (SAHF); et l'acquisition d'une sécrétoire associée sénescence Phénotype (SASP), un phénomène caractérisé par la sécrétion d'un certain nombre de cytokines pro-inflammatoires et des molécules de signalisation. Ici, nous décrivons les protocoles pour les réplicative etADN sénescence dommages induits dans les cellules en culture. De plus, nous mettons en évidence des techniques pour surveiller le phénotype sénescent en utilisant plusieurs marqueurs associés à la sénescence, y compris SA-β-gal, γ-H2AX et la coloration SAHF, et de quantifier les niveaux de protéines et d'ARNm des régulateurs du cycle cellulaire et les facteurs SASP. Ces méthodes peuvent être appliquées à l'évaluation de la sénescence dans divers modèles et tissus.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Il y a plus d' un demi - siècle, Hayflick et ses collègues ont décrit comment les cellules prolifèrent dans la culture non transformée, mais seulement pour une période de temps limitée 1. la culture à long terme des fibroblastes humains a provoqué les cellules pour arrêter la prolifération; cependant, ils étaient métaboliquement actifs, ce qui a été appelé sénescence cellulaire. Sénescence peut être bénéfique pour inhiber la tumorigenèse, mais il peut aussi être préjudiciable, car on pense contribuer à la perte de la capacité de régénération qui se produit avec le vieillissement 2, 3. Les cellules sénescentes ont été montré à accumuler dans les tissus humains comme 4 ans et ont été impliqués dans un certain nombre de processus biologiques, y compris le développement embryonnaire, la cicatrisation des plaies, la réparation des tissus et l' inflammation liée à l' âge 2.

repiquage continue des cellules en culture induit la sénescence réplicative, qui a été liéeà télomère attrition et de l'instabilité génomique. Divers stress cellulaires, y compris les lésions de l' ADN et des oncogènes, peuvent également provoquer la sénescence 3. Sénescence causés par des facteurs autres que l' attrition des télomères est souvent appelé sénescence induite par le stress ou prématurée et dépend généralement de la voie INK4A / Rb p16 5. Bien que la prolifération, les cellules non transformées apparaissent généralement broche en forme, des cellules sénescentes peuvent être identifiés comme ayant certaines caractéristiques, comprenant un plat, une grande morphologie et augmentation de l' activité β-galactosidase associé à la sénescence (SA-β-gal) (figures 1 et 2). Les cellules sénescentes accumulent également ADN marqueurs de dégâts, y compris γ-H2AX (Figure 3) 6, et, éventuellement, des foyers d'hétérochromatine associée sénescence (SAHF) (Figure 4) 7. Les cellules sénescentes ont des niveaux plus élevés de régulateurs du cycle cellulaire, y compris les p 16 (p16 INK4A) et / ou p21 et p53 (Figure 5) 8, 9. De plus, des données récentes ont montré que les cellules sénescentes peuvent avoir des effets non autonomes en sécrétant un certain nombre de cytokines pro-inflammatoires et des chimiokines appelé le phénotype sécrétoire associée sénescence (SASP) 10. Bien que ce phénomène de SASP peut varier d'un type de cellule du type de cellule, en général, il est démontré par une augmentation de l'interleukine-6 ​​(IL-6), IL-8, les colonies de granulocytes-macrophages facteur de stimulation (GM-CSF), growth- réglementé oncogène α (GRO-α), et GRO-β, entre autres (Figure 6). La contrainte particulière ou des dommages qui induit sénescence peuvent également influencer le phénotype sécrétoire 11, 12, 13. SASP peut être détectée en mesurant les niveaux de protéines sécrétées à l'aide de tests ELISA ou des réseaux cytokine / protéines = "xref"> 10, 14. Bien que les mécanismes post-transcriptionnel peuvent réguler les taux de protéines 11, 15 SASP, 16, 17, des changements dans de nombreux cas peuvent également être détectés dans les niveaux d' ARNm. Ces changements sont généralement plus sensibles et plus faciles à quantifier que les mesures de niveau de protéines. D' autres marqueurs de sénescence peuvent également être évalués, y compris les lésions de l' ADN nucléaire persistante foyers, appelés segments d'ADN avec des altérations de la chromatine de renfort sénescence (ADN-CICATRICES) 18 et divers autres marqueurs 3, 19, 20.

Ici, nous décrivons des techniques communes pour induire la sénescence dans les cellules en culture et aussi pour mesurer plusieurs marqueurs de sénescence, y compris SA-β-Gal, γ-H2AX, SAHF, et la protéine et l'ARNm de sénescencence molécules-associé.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Induire réplicative sénescence

  1. Décongeler les fibroblastes diploïdes humains à faible passage (par exemple, WI-38 et IMR-90) ou d' autres lignées cellulaires.
    REMARQUE: Ici, les fibroblastes diploïdes humains ont été utilisés, mais ces protocoles peuvent être utilisés pour évaluer la sénescence dans d'autres types de cellules, comme endothéliales, épithéliales ou cellules souches mésenchymateuses. conditions de culture peuvent être optimisées pour les différents types de cellules utilisées en raison de différents taux de croissance ou des conditions de croissance.
    REMARQUE: Les cellules doivent être proliférer et ont une morphologie de la broche (voir la figure 1 pour un schéma et la figure 2 pour des exemples). Idéalement, les cellules doivent avoir une population Doubler niveau (PDL) de <30 au début des expériences pour éviter d'éventuelles cellules sénescentes répliquées.
    1. Calculer le PDL des cellules en utilisant l'équation suivante PDL = log (N f / N 0) / log2, où N f est le nombre final de cellules et <em> N 0 est le nombre initial de cellules ensemencées 21.
  2. Culture WI-38 dans les cellules de Eagle modifié par Dulbecco (DMEM) complété avec 10% de sérum bovin fœtal (FBS), 1% d'acides aminés non essentiels et 1% de pénicilline / streptomycine.
  3. Cultiver des cellules IMR-90 dans du DMEM supplémenté avec 10% de FBS et 1% de pénicilline / streptomycine.
  4. Croître toutes les cellules à 37 ° C et 5% de CO 2 se développer continuellement les cellules et diviser toutes les 2 - 4 d lorsque les cellules atteignent ~ 70 - 80% de confluence. Surveiller la confluence des cellules à l'aide d'un microscope optique. Évitez les cellules avec confluence plus, car cela peut affecter la croissance des cellules en raison de l'inhibition de contact.
  5. Surveiller les cellules sous un microscope optique pour l'aspect morphologique des cellules sénescentes (voir figures 1 et 2) et pour quand il n'y a pas de changement dans une sous - culture de PDL à l'autre.

2. ADN sénescence dommages induits par

    (par exemple, WI-38, IMR-90, ou un autre type de cellule) à une faible densité (ie ~ 300.000 cellules / 6 cm plat) dans un plat approprié pour le type d'analyse ( par exemple un plat de 6 cm pour la protéine / marqueurs d'ARN ou d'une boîte de 6 puits pour la coloration SA-β-gal). Utiliser les cellules passage précoce qui sont jeunes et proliférer (<30 PDL) et les plaque de sorte que les cellules sont à peu près 50 - 60% confluentes le lendemain.
  1. Retirer le milieu de croissance en utilisant une pipette en verre relié à un vide et laver les cellules en ajoutant 1x solution saline tamponnée au phosphate (PBS). Répétez cette étape pour un total de deux lavages. Ajouter une couche mince de PBS (~ 750 ul pour une boîte de 6 cm) à la fois une « maquette » et traité pour un rayonnement ionisant (IR) état traité.
  2. Utilisez un irradiateur gamma afin d'exposer les cellules à une dose unique de 10 Gray (Gy) de l'IR; c'est une exposition typique pour la plupart des lignées cellulaires. Dans un capot, retirez le PBS et le remplacer par un milieu de croissance. En variante, le traitement des cellules avec bleomycin à 20 ug / ml pendant 2 h.
  3. Changer le support sur les cellules toutes les 48 -7 2 ​​h et diviser les cellules si nécessaire.
  4. Surveiller les cellules sous un microscope optique pour les changements morphologiques (voir la figure 1 pour une vue schématique et la figure 2 pour des images représentatives de cellules) et dosage des marqueurs sénescentes 7-10 d après le traitement IR.
    NOTE: Ce protocole décrit la sénescence induite par IR. La sénescence peut également être induite par d' autres contraintes, notamment la bléomycine (voir ci - dessus pour les conditions), H 2 O 2 22, 23, des médicaments chimiothérapeutiques 24, la fumée de cigarette 25, facteur de croissance transformant (TGF) -β1 26, 27, et d' autres méthodes 21 , 28, 29.

3. Cel Stainingls pour β-galactosidase associé à la sénescence

  1. Avant la coloration, examiner les cellules au microscope optique pour surveiller les changements morphologiques.
    REMARQUE: Les cellules sénescentes sont généralement agrandies et plat, à la différence des cellules proliférantes, qui ont une morphologie de broche (Voir la figure 1 pour une vue schématique et la figure 2 pour obtenir des résultats représentatifs). Les cellules en prolifération peuvent être utilisés comme témoin négatif, et les cellules traitées avec l'IR ou un autre agent endommageant l'ADN (voir la section 2) peuvent être utilisées comme témoins positifs.
  2. Quantifier l' activité SA-β-gal en utilisant des réactifs à partir d' un kit commercial (voir le tableau des matériaux). Décongeler tous les réactifs et les amener à la température ambiante en les chauffant à 37 ° C.
    1. Calculer la quantité de solution de coloration et une solution de fixatif nécessaire.
      NOTE: En règle générale, un volume de 1 ml est suffisante pour un puits dans une plaque à 6 puits. Les différentes tailles de plaques peuvent être utilisées, mais une taille de plaque à 6 puits est well adapté pour effectuer un essai en triple pour chaque condition. Cette densité fournit généralement un nombre suffisant de cellules par champ à compter sans utiliser un nombre excessif de cellules.
    2. Diluer la solution coloration 1:10 avec de l'eau distillée.
    3. Diluer la solution fixatif 1:10 avec de l'eau distillée.
    4. Préparer une solution 20x mère de X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside) dans du N, N-diméthylformamide (DMF, par exemple, 20 mg de X-gal dans 1 ml de DMF). Pour optimiser l'utilisation du kit, mesurer X-gal à la quantité nécessaire pour chaque essai, puis ajouter la quantité calculée de DMF à se dissoudre. Vous pouvez également stocker la solution mère à -20 ° C dans un tube protégé par la lumière pendant un mois. Utilisation des tubes en polypropylène seul (opaque) pour diluer et stocker des solutions X-gal.
    5. Préparer une solution de coloration β-gal: 930 ul de solution de coloration 1x, 10 ul de complément de coloration A, 10 ul de complément de coloration B, et 50 ul de 20 mg / mL Xdans le DMF ßgal. Faites un mélange maître selon le nombre de puits doivent être colorés.
  3. Retirez délicatement le support des cellules à l'aide d'une pipette de transfert ou l'équivalent.
  4. Lavez délicatement les cellules une fois avec la température ambiante 1x PBS.
  5. Ajouter 1 ml de solution de fixateur 1x à chaque puits et incuber pendant 10 - 15 min à température ambiante.
  6. Retirez la solution de fixation avec une pipette de transfert.
    REMARQUE: La solution de fixation (1x) contient 2% de formaldéhyde et 0,2% de glutaraldéhyde et doit être mis au rebut en tant que déchets dangereux selon les recommandations du bureau de la sécurité en laboratoire.
  7. Lavez délicatement les cellules deux fois avec du PBS 1x.
  8. Retirer le complètement du PBS et on ajoute une solution de coloration 1x β-gal dans les puits (1 ml / puits d'une plaque à 6 puits). Couvrir la plaque complètement avec une feuille d'aluminium et laisser incuber pendant 24 - 48 h dans un incubateur à 37 ° C ( de préférence en l'absence de CO 2, comme cela peut abaisser le pH du tampon et d' affecter la coloration).
    1. Vérifiez les cellules à 24 h pour la coloration, et si la tache est trop léger, laisser incuber pendant 24 h.
  9. Après le temps d'incubation, on élimine la solution β-gal et le remplacer par du PBS 1x.
    REMARQUE: Cette étape supprime une partie de la couleur d'arrière-plan lorsque l'imagerie et empêche également dangereux déversement de la solution X-gal.
    REMARQUE: Éliminez la solution β-gal correctement, selon les recommandations du Bureau de la sécurité des laboratoires.
  10. Examiner les cellules sur un microscope optique avec une caméra fixée à l'aide d'un objectif 10x ou supérieur; cellules SA-β-gal positif sera bleu. Acquérir le nombre souhaité d'images pour l'expérience. Si le comptage du pourcentage de cellules SA-β-gal positif, d'acquérir le nombre approprié d'images (> 5) pour la quantification par puits. Assurez-vous que les images ne se chevauchent pas de divers champs de vision au sein de chaque puits.
  11. Compter le nombre de cellules SA-β-gal-positives (bleue) par rapport au nombre total de cellulespour calculer le pour cent des cellules SA-β-gal-positives. Compter> 100 cellules par condition.
    NOTE: Les images représentant peuvent également être utilisés pour les chiffres. Notez que la cellule est confluence critique si les cellules de comptage, comme trop de cellules, il est difficile de différencier chaque cellule et trop peu ne peut pas donner un nombre suffisant de cellules pour la quantification et des statistiques. Photos pour les chiffres de publication sont à la meilleure résolution si elle est enregistrée sous forme de fichiers .tiff, bien que les fichiers .jpeg sont également appropriés. Les images couleur doivent être 300 dpi.

4. Les cellules de coloration pour γ-H2AX

  1. Plaquer les cellules de Sections 1 ou 2 sur des lamelles de verre dans une plaque à 24 puits.
  2. Le lendemain, laver les cellules avec du PBS 1x. Rincer soigneusement, comme les cellules sénescentes n'adhèrent pas bien et peuvent facilement lamelles être enlevés au cours des lavages. Vous pouvez également fixer directement les cellules sans se laver.
  3. Retirer le PBS et fixer les cellules avec 3,7% de formaldehyde fraîchement préparée dans du PBS pendant10 min à température ambiante.
  4. Retirer la solution et perméabiliser les cellules avec 0,2% de Triton X-100 dans du PBS pendant 10 min.
  5. Retirer la solution et le bloc de 5% de FBS dans du PBS pendant 2 h à TA.
  6. Incuber avec un anticorps anti-phospho-H2AX γ (Ser139) et un conjugué FITC à 5% de FBS / PBS pendant 2 h à 37 ° C ou O / N à 4 ° C. Protéger de la lumière.
  7. Laver 3 - 6x avec du PBS à 37 ° C pour un total de 30 - 60 min.
  8. Teinture avec DAPI (dilué à 1: 15000 dans du PBS) pendant 10 min à température ambiante.
  9. Laver 3x avec PBS.
  10. laver rapidement avec de l'eau pour éliminer les sels et monter la lamelle couvre-objet sur une lame de verre à l'aide de 3 - 5 ul de réactif antifade. En variante, utiliser une solution de montage contenant DAPI.
  11. Laissez-O / N sec et visualiser les cellules colorées sur un microscope à fluorescence ou confocale en utilisant un objectif 63X ou plus.
  12. Quantifier les foyers γ-H2AX en utilisant une des deux méthodes décrites ci-dessous. Note pour les deux protocoles à l'oeil à l'aide d'un microscope à fluorescence. Idéalement, nousea microscope confocal. Prendre Z-sections et se condenser en une seul plan afin de visualiser tous les foyers détectable (images représentatives pour la coloration γ-H2AX dans des cellules proliférantes et sénescentes sont représentés sur la figure 3). Compter les foyers à l'oeil nu en utilisant un logiciel d'imagerie; en général, ~ 100 - 200 noyaux suffisent pour le comptage.
    1. Afin de quantifier le pourcentage de cellules qui ont des foyers γ-H2AX positives, compter chaque cellule qui comporte au moins une mise au point visible et diviser par le nombre total de noyaux colorés au DAPI.
    2. Pour quantifier le nombre de foyers γ-H2AX, compter les foyers γ-H2AX par cellule.
      NOTE: Les niveaux de γ-H2AX peuvent varier en fonction du facteur de stress spécifiques ou des dommages qui induit la sénescence.

5. Cellules pour marqueurs SAHF Staining

REMARQUE: les cellules sénescentes humaines ont souvent des régions nucléaires d'ADN / chromatine condensée. Dans les cellules sénescentes, ces régions hétérochromatiqueson pense à inhiber l'expression de gènes favorisant la prolifération, comme les membres de la famille E2F. SAHF peut être visualisée par la réorganisation du DAPI; par la présence de marques d'histone associé hétérochromatine, y compris les di- et tri-méthylation de Lys9 sur Histone H3 (H3K9me2 et H3K9Me3); et par les protéines de la réorganisation de la chromatine, y compris la protéine HP1 de l' hétérochromatine 1 (HP1), HIRA (histone répresseur A), et ASF1a (anti-silencing fonction 1a) à la chromatine 30. Nous avons choisi d'utiliser un modèle de sénescence oncogène induite (OIS), comme SAHF est plus important dans les modèles OIS 30. Les cellules IDH4 prolifèrent en présence de dexaméthasone en raison de la présence de l' antigène grand T de SV40 , mais deviennent sénescentes après la suppression de la dexaméthasone à partir du milieu 31. SAHF peut être détectée par une coloration DAPI et par coloration avec des anticorps contre les marqueurs spécifiques énumérés ci-dessus. Ici, nous décrivons DAPI et H3K9me2 pour la visualization de SAHF dans des cellules 28.

  1. Cultiver des cellules IDH4 dans du DMEM supplémenté avec 10% de FBS, 1% de pénicilline / streptomycine et 1 pg / ml de dexaméthasone. Pour induire la sénescence, retirer la dexaméthasone et changer le milieu pour qu'il contienne FBS charbon dénudée; après avoir progressé pendant environ 10 jours dans ce nouveau milieu, les cellules deviennent sénescentes IDH4 31.
  2. Plate cellules ou des cellules de IDH4 Sections 1 ou 2, décrits ci-dessus, sur des lamelles de verre dans une plaque à 24 puits.
  3. Le lendemain, laver les cellules avec du PBS 1x. Rincer soigneusement, comme les cellules sénescentes n'adhèrent pas bien et peuvent être des lamelles facilement enlevés au cours des lavages. Vous pouvez également fixer directement les cellules sans se laver.
  4. Retirer le PBS et fixer les cellules avec 3,7% de formaldehyde fraîchement préparée dans du PBS pendant 10 min à température ambiante.
  5. Laver les cellules 3 fois avec PBS 1x.
  6. Retirer la solution et perméabiliser les cellules avec 0,2% de Triton X-100 dans du PBS pendant 5 min.
  7. Laver les cellules avec 1xPBS. Retirer le PBS et bloquer les lamelles en ajoutant un tampon de blocage contenant 3% de BSA (p / v) dans du PBS pendant 5 min à température ambiante. Toujours filtrer des solutions contenant de la BSA avant utilisation pour éliminer les matières particulaires.
  8. Retirer le tampon de blocage et incuber les cellules avec des anticorps primaires contre des marqueurs SAHF tels que des anticorps anti-H3KMe2 (Figure 4; voir le tableau des matériaux pour les détails). Diluer les anticorps dans du tampon de blocage et incuber pendant 1 - 2 h à TA.
  9. Retirer la solution d'anticorps primaire et laver les lamelles 3 fois avec 1% (v / v) de Triton X-100 dans du PBS.
  10. Diluer les anticorps secondaires dans un tampon de blocage (Matériaux Table) et incuber pendant 1 h à température ambiante. Protéger de la lumière.
  11. Laver les cellules deux fois avec PBS 1x. Teinture avec DAPI (dilué à 1: 15000 dans du PBS, voir le tableau des matériaux) pendant 10 min à température ambiante.
  12. Laver les lamelles 3x avec PBS 1x.
    1. Laver rapidement à l'eau pour éliminer les sels d'unnd monter chaque lamelle couvre-objet sur une lame de verre à l'aide de 3 - 5 ul de réactif antifade. En variante, utiliser une solution de montage contenant DAPI.
    2. Soit O sec / N et visualiser les cellules colorées sur un microscope à fluorescence ou confocale en utilisant un objectif 63X ou plus (voir les résultats représentatifs de la figure 4). Quantifier le SAHF comme décrit à la section 4.
      NOTE: les anticorps primaires de contrôle isotype ou pas d' anticorps primaire (seul secondaire) doit être utilisé comme témoin négatif pour la coloration par immunofluorescence.

6. Analyse de protéines associées sénescence par immunotransfert

NOTE: Le phénotype de sénescence est caractérisée par la régulation positive des régulateurs du cycle cellulaire, y compris p16 INK4A, p21, et p53. Ce protocole décrit la quantification des niveaux de ces protéines dans les lysats cellulaires. Ces techniques peuvent être utilisées pour évaluer la sénescence induite en utilisant une variété deMéthodes 21, 28, 29.

  1. Induire la sénescence cellulaire , comme décrit dans les sections 1 et 2 ou en utilisant un autre procédé 21, 28, 29. Pour analyser les marqueurs de sénescence cellulaire, une plaque les cellules dans boîtes de 6 cm et d'analyser à la fois la protéine et l'ARN simultanément (voir la section 7 pour des instructions d'isolement de l'ARN).
  2. Retirez le milieu de culture cellulaire. Mettez les cellules sur un plateau de glace.
    1. Laver les cellules 2 fois avec du PBS froid 1x. Inclinez le plat pour faire en sorte que tout le PBS est aspiré de manière à être aussi précis en termes de volumes utilisés pour la procédure.
    2. Après le dernier lavage d'aspiration de PBS, ajouter 200 pi de froid 1x PBS (pour un plat de 6 cm) au plat. Racler les cellules en utilisant un grattoir à cellules.
    3. Pipeter le mélange de cellules / PBS dans un tube exempt de RNase pour l'isolement de l'ARN. Prenez environ 150 &# 181; L de ce mélange et la pipette dans un nouveau tube. Cette aliquote sera utilisée pour l'analyse des protéines, alors assurez-vous de la pipette la même quantité de chaque tube.
  3. Lyser les cellules en ajoutant 75 à 100 ul de tampon modifié de l'échantillon de Laemmli 2x (Tris-HCl 60 mM 6,8, 12,5% de glycerol, 2% de SDS, 5% β-mercaptoéthanol (BME) et de bleu de bromophénol, peuvent être constitués en tant que un gros lot, aliquotés et stockés à -20 ° C jusqu'à utilisation) ou un tampon équivalent de l'échantillon.
    1. En variante, lyser les cellules dans 75 à 100 ul de tampon de lyse et centrifugation à 15 000 xg pendant 10 min à 4 ° C pour éliminer les débris cellulaires. Retirer le surnageant et la pipette dans un tube propre. Un dosage des protéines de Bradford ou un dosage des protéines équivalentes peuvent être utilisées sur des lysats pour assurer la charge égale de protéines.
      NOTE: Les tests protéiques ne peuvent pas être effectuées sur des échantillons lysées dans un tampon échantillon.
    2. Retirez ~ 25 pi de lysat et l'ajouter à 15 pi de tampon 2x échantillon. Aspirer et fairewn dans le tampon d'échantillon à lyser les cellules.
      REMARQUE: Les volumes de tampon de lyse ou d'un tampon d'échantillon peut être ajustée en fonction de la confluence des cellules. Si l'échantillon est « gluant » en raison de lytique nucléaire, ajouter un tampon d'échantillon ou PBS pour diluer. Les échantillons peuvent être conservés à -20 ° C jusqu'à utilisation.
  4. Faire bouillir les échantillons pendant 5 min à 95 ° C sur un bloc chauffant (ou matériel équivalent) et de la charge ~ 40 pi d'échantillon lysé dans un tampon d'échantillon sur un gel Tris-Glycine 18%.
    REMARQUE: Un gel à gradient (4-15%) ou un gel à 14% Tris-Glycine sont également suffisantes pour détecter des protéines de faible poids moléculaire. Différents types de gels d'acrylamide peuvent également être utilisés, mais faire en sorte que les gels et systèmes sont appropriés pour la détection de protéines de faible poids moléculaire.
    1. Exécuté en utilisant un tampon de migration 1x à 100 V constante pendant 20 minutes (à travers le gel d'empilement) et ~ 60 min à 180 V. Surveiller le gel de sorte que le front de colorant fonctionne juste à côté ou se trouve au fond du gel, de sorte que le faible poids moléculaire protéines de poids ne font pas run hors du gel.
  5. Transférer le gel d'acrylamide à une membrane de PVDF (pré-trempées avec 100% de methanol pour activer). Si vous effectuez un transfert humide, seulement 1 h est nécessaire pour le transfert (par rapport à la normale ~ 1,75 h). Ajuster en conséquence pour le système de transfert approprié; en utilisant des marqueurs de masse moléculaire pré-coloré peut aider à évaluer l'efficacité du transfert.
  6. Laver la membrane dans l'eau. Utiliser un colorant Ponceau pour surveiller le chargement égal des échantillons. Laver le Ponceau avec de l'eau.
    1. Bloquer la membrane dans 5% de lait écrémé sec dans du TBST (Tris-HCl pH 7,5 50 mM, NaCl 150 mM, et 0,1% de Tween-20) pendant 1 h à température ambiante ou O / N à 4 ° C avec agitation.
  7. Laver une fois avec TBST blot et incuber avec l' anticorps primaire dilué dans 5% de lait TBST (voir le tableau des matériaux pour des dilutions d' anticorps et les recommandations) pendant 1 h à température ambiante.
  8. Effectuer deux lavages rapides avec TBST puis laver deux fois sur un agitateur pour un total de ~ 30 min (~ 15 min chacun étaith).
  9. Incuber avec un anticorps secondaire pendant 40 min à température ambiante. Répétez l'étape 6.10.
  10. Avec un substrat Incuber Western blot fraîchement préparé et de développer le film ou le lire sur un lecteur de chimiluminescence.
  11. Sonde immunoblot avec des anticorps p16 INK4a des premier (figure 5). Bande de la membrane par incubation pendant 15 min avec de l'eau, 15 min avec du NaOH 0,2 N, et 15 min avec de l'eau. Passez à l'étape 6.9 en utilisant des anticorps anti-p21.
  12. Bande de la membrane en utilisant Tris-HCl pH 6,8 62,5 mM et 2% de SDS avec 300 ul de BME fraîchement ajouté par 50 ml de solution de décapage.
  13. Incuber à 50 ° C pendant 30 min et laver abondamment avec du TBS, puis TBST. La sonde avec des anticorps anti-actine ou anti-GAPDH de contrôle de chargement de protéines (Figure 5 montre des résultats représentatifs).
    REMARQUE: les niveaux de p53 peuvent également être évalués sur les mêmes membranes. Cependant, étant donné que p53 est un poids moléculaire plus élevé, il est mieux résolue sur un (par exemple gel de pourcentage inférieur,

7. L'analyse des ARNm niveaux de sénescence marqueurs

REMARQUE: Lors de l'isolement de l'ARN, assurez-vous que les surfaces de travail sont nettoyés avec des solutions d'élimination RNase ou équivalent et que les matériaux sont sans RNase.

  1. Utilisation du mélange de cellules / PBS à l'étape 4.2, ajouter 1 ml de solution d'extraction d'ARN et vortex pendant 30 s (il devrait y avoir aucun amas visibles ou des débris cellulaires).
  2. Ajouter 200 pi de chloroforme et agiter vigoureusement pendant 15 s.
  3. Centrifuger à vitesse maximale (> 15 000 xg) pendant 15 min à 4 ° C.
  4. Retirer ~ 400 ul de la phase aqueuse de l'ARN supérieure et la pipette dans un nouveau tube de microcentrifugation.
  5. Ajouter 400 ul d'isopropanol (1: 1 avec le volume total de la phase aqueuse à la pipette à l'étape précédente) et 4 pi de precipitant à la couche d'ARN.
  6. Centrifuger pendant 15 à 30 min à la vitesse maximale (> 15 000 xg) et 4 ° C pour sédimenter les ARN.
  7. Retirer le surnageant et ajouter 1 ml de 75% d'éthanol glacé.
  8. Centrifuger pendant 1 min à vitesse maximale (> 15 000 xg) et 4 ° C.
  9. Eliminer le surnageant et centrifuger pendant 1 min à vitesse maximale (> 15 000 xg) et 4 ° C.
  10. Pipeter sur autant de liquide que possible à sec et de l'air pendant 2 min.
  11. Remettre en suspension dans 10 pi de tampon 10x DNase, 85 ul de H 2 O, et 5 ul de DNase 1.
  12. Incuber à 37 ° C pendant 30 min.
  13. Ajouter 200 pi de tampon NT2 (Tris-HCl 50 mM pH 7,4, 150 mM de NaCl, 1 mM de MgCl2, et 0,05% de Nonidet P-40) et ajouter 300 uL de la couche inférieure d'acide phénol-CHCl 2.
  14. Vortex pendant 1 min et centrifugation à température ambiante pendant 5 min à vitesse maximale (> 15 000 xg).
  15. Recueillir 250 pi de la couche d'ARN supérieure (2 x 125 pi), ajouter 25pi de 3 M à pH 5,2 d'acétate de sodium, 625 ul d'éthanol à 100% par de la glace, et 5 pi d'agent de précipitation. Bien mélanger et précipiter O / N à -20 ° C.
  16. Le lendemain, mélanger et centrifuger à la vitesse maximale (> 15 000 xg) et 4 ° C pendant 30 minutes et éliminer le surnageant.
  17. Répétez les étapes 06.08 à 06.11.
  18. Remettre en suspension le culot dans 12 pi d'eau sans nucléase et conserver à -80 ° C jusqu'à utilisation.
    NOTE: D'autres procédures d'isolement de l'ARN et des kits peuvent être utilisés.
  19. Effectuer la transcription inverse avec des hexamères aléatoires et la transcriptase inverse SSII selon le protocole du fabricant.
    NOTE: Compte tenu de la faible quantité d'ARN isolé à partir des cellules sénescentes, il est préférable d'utiliser l'ensemble de l'ARN (12 pL) pour la synthèse de la transcription inverse. En variante, l'ARN peut être quantifié en utilisant un spectrophotomètre, et des quantités égales d'ARN peut être utilisée pour la transcription inverse.
  20. Analyser les niveaux d'ARNm à l'aide quantitative en temps réel qPCR (RT-qPCR) amplification et maître PCR SYBR-green mélange avec des amorces spécifiques de gènes.
    1. Comme dans une réaction de RT-qPCR typique, diluer l'ADNc 01h30 (dans RNase / eau DNase) et ajouter 3 pi au temps réel plaque à 96 puits pour une meilleure précision de pipetage. Préparer un mélange maître de réaction de gène spécifique amorces sens et antisens (concentration de 2,5 uM, ajouter 5 ul / réaction), mélange de PCR SYBR-green (6,25 ul / réaction; utiliser moins de la recommandation du fabricant) et 5,75 ul de RNase / l'eau de DNase sans pour un volume réactionnel final de 20 ul (17 ul d'amorces / SYBR vert / eau et 3 pi d'ADNc).
    2. Effectuer une amplification RT-qPCR en utilisant un appareil en temps réel par PCR; suivez le protocole du fabricant.
      NOTE: Une liste des humains validée avant et arrière amorces en temps réel se trouve dans le tableau 1. Ces gènes comprennent des protéines SASP et d'autres marqueurs associés à la sénescence et / ou de gènes. Les résultats représentatifs de la sénescence IR induite sont présentés dans

8. Quantifier SASP Les teneurs en protéines

  1. Induire la sénescence en utilisant des sections 1 ou 2 ou en utilisant une autre méthode. Plaque les cellules sur 6 ou 10 cm plaques, comme décrit ci-dessus (~ 250.000 cellules / plaque 6 cm ou ~ 650000 / plaque de 10 cm).
  2. Soit avec des cellules 10 d traitement post-IR ou avec des cellules sénescentes réplicatives (et des cellules de contrôle appropriées), laver les cellules trois fois avec 1 x PBS et ajouter un milieu sans sérum avec des antibiotiques dans un petit volume (2,5 ml pour 6 cm ou 5 ml pour 10 cm).
  3. Incuber pendant une nuit à 37 ° C et 5% de CO2 dans un incubateur de culture tissulaire. Le lendemain, recueillir le moyen et le mettre dans un tube conique sur la glace.
  4. Laver les cellules 2 fois avec du PBS, puis ajouter 1 ml de trypsine (pour un plat de 6 cm). Compter les cellules à l'aide d'un hémocytomètre pour ajuster plus tard, les concentrations en fonction du nombre de cellules.
  5. Centrifuger le milieu pendant 5 min à 300 x g.
  6. Filter le milieu en utilisant un filtre à seringue de 0,45 um.
  7. Aliquoter le moyen et congeler à -80 ° C jusqu'à utilisation ou le dosage ELISA direct en utilisant des dosages ou équivalents.
  8. Calculer le nombre de concentration des cellules / mL en prenant le nombre total de cellules / volume de milieu ont été recueillies.
  9. Effectuer un essai par immunosorbant lié à une enzyme appropriée (ELISA) conformément aux instructions du fabricant. Voir le tableau des matériaux pour les kits ELISA pour le dosage recommandé pour l' IL-6, IL-8, GROa, et d' autres cytokines / chimiokines (figure 6B).
  10. Pour veiller à ce que les facteurs mesurés se situent dans la plage linéaire du kit ELISA, faire des dilutions du milieu de cellule sénescente par rapport au milieu des cellules proliférantes. Compte de ces dilutions et le volume lors du calcul de la quantité d'IL-6. Afin d'acquérir la quantité d'IL-6 sécrétée par cellule et par jour, de calculer la valeur d'IL-6 obtenu à partir du kit (en pg) par concentration cellulaire diluée par ml (frétape om 7,8).
    NOTE: D'autres méthodes, telles que des réseaux de cytokines, peut être utilisée pour détecter les niveaux de protéines SASP et peut convenir pour le criblage d'un grand nombre de facteurs SASP. Les taux de protéines des facteurs SASP peuvent varier en fonction du temps après l'induction de la sénescence, le type de cellule, ou le type de sénescence induit.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Les figures 2 - 6 montrent des résultats représentatifs de coloration SA-β-gal; coloration pour la γ-H2AX et SAHF; l' évaluation des niveaux de protéines de p16 INK4a p21 et p53; et de l'ARNm et des protéines de molécules sénescentes associée. Une coloration accrue SA-β-gal se produit avec réplicatif et de l'ADN de la sénescence induite par endommagement. En outre, observer les changements morphologiques qui se produisent à la sénescence. Les cellules se dilatent et stable par rapport à l'apparition de la broche de fibroblastes prolifèrent. Pour ce paradigme expérimental, les cellules ont été colorées et de l'ARN / protéine ont été isolés 7 jours après l'exposition IR. Des résultats plus robustes peuvent se produire en attendant plus après l' exposition IR (c. -à- d 10). Conditions doivent être déterminées pour chaque condition et la configuration expérimentale. Ces résultats sont représentatifs et ces marqueurs peuvent également être détectés lorsque la sénescence est induite par d'autres méthodes.

figure 6, les noms de gènes sont répertoriés et correspondent à CXCL1 (GROa), CXCL2 (GROß) et CSF2 (GM-CSF). La régulation positive des taux d'ARNm de certains, mais pas tous, des facteurs ont été observés après SASP sénescence induite par IR dans les cellules WI-38. D' autres ARNm associé à la sénescence, y compris CDKN1A (code pour p21) et CDKN2A (code de p16 INK4a), ont été régulés à la hausse. Autres mARN (EDN1 et ANKRD1) ont également été inclus et ont déjà été révélés être plus élevés dans les cellules sénescentes 15. Apprêts sont énumérés dans le tableau 1.

Figure 1
Figure 1: Prolifération et sénescentes de fibroblastes. Une représentation schématique de proliférer (à gauche) et les fibroblastes sénescents (à droite). Des exemples de Inducteurs de sénescence sont présentés dans le yeboîte llow. La sénescence est associée à des niveaux plus élevés des marqueurs indiqués. SA-β-gal, l'activité β-galactosidase associé à la sénescence; SASP, phénotype sécrétoire associée sénescence; SAHF, des foyers d'hétérochromatine associée sénescence; DDR, réponse ADN dégâts. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre

Figure 2
Figure 2. Caractéristiques et augmentation morphologique Activité SA-β-gal de cellules sénescentes. les cellules WI-38, soit la prolifération des "jeunes" (PDL 27), sénescence réplicative (PDL 40), ou ceux qui sont exposés à des rayonnements ionisants (RI), ont été colorées pour l'activité β-SA-gal. IMR-90 cellules, soit proliférer "jeune" (PDL 30), sénescence réplicative (PDL 52), ou ceux qui sont exposés à des rayonnements ionisants (RI), étaient staINED activité SA-β-gal. Les articles 1 - 2 décrivent l'induction et de l'ADN réplicative sénescence dommages induits, et la section 3 explique coloration pour SA-β-gal. Les cellules ont été colorées 7 d après IR. Con, le contrôle. Barre d'échelle = 50 pm. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

figure 3
Figure 3. Augmentation de γ-H2AX foyers dans les cellules sénescentes. WI-38 cellules, soit proliférer "jeune" (PDL 30) ou de sénescence réplicative (PDL 53), ont été fixées et colorées avec des anticorps anti-y-H2AX et DAPI. Notez l'augmentation du nombre de foyers γ-H2AX dans les cellules sénescentes. Les images ont été obtenues sur un microscope confocal. Z-sections ont été prélevés, et la projection d'intensité maximale a été utilisée pour obtenir une image plane unique pour visualiser tous détecfoyers de table. Barre d'échelle = 20 pm. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4. fluorescence des SAHF dans les cellules sénescentes. (A) la prolifération des cellules WI-38 (PDL 27) sont non traitées ou exposées aux rayonnements ionisants (RI). Au bout de 10 jours, les cellules ont été colorées avec du DAPI pour visualiser SAHF (note coloration dense / punctate DAPI dans les cellules IR-traitées) (B) IDH4 ont été cultivées en présence de dexaméthasone (proliférer) ou FBS charbon dénudée pour induire la sénescence ( sénescence). Après 10 jours, les cellules ont été colorées avec des anticorps contre H3K9me2 et DAPI. Les images ont été obtenues sur un microscope confocal. Z-sections ont été prélevés, et la projection d'intensité maximale a été utilisée pour obtenir un seul planimage. Les cellules en prolifération dans (A) et (B) présentent une coloration DAPI diffuse, alors que les cellules sénescentes ont punctate coloration DAPI. Dans (B), les cellules de contrôle ont diffuse, coloration très léger pour H3K9me2, alors que la coloration H3K9me2 est plus robuste et colocalisée avec des foyers colorées au DAPI dans des cellules sénescentes. Barre d'échelle = 20 pm. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5. Quantification des protéines associées sénescence. La protéine a été isolée à partir soit proliférantes "jeune" (PDL 30) IMR-90 des cellules (-) ou des cellules IMR-90 qui ont été exposés à 10 Gy de radiations ionisantes (IR). Le milieu a été changé toutes les 48 h et les cellules ont été lysées 7 d après IR. Les échantillons ont été analysés par SDS-PAGE, immunotransfert anti-p16 INK4A Antibomeurt et sondé re-anti-p21 et ensuite des anticorps anti-p53. GAPDH a été utilisé comme un contrôle de chargement de protéines. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Figure 6
Figure 6. Quantification des protéines et des ARNm associés SASP sénescence. (A) ARN a été isolé à partir soit proliférantes "jeune" (PDL 27 ou 34) des cellules WI-38 (-) ou des cellules WI-38 qui ont été exposés à 10 Gy de radiations ionisantes (IR). Le milieu a été changé toutes les 48 h et l'isolement de l'ARN a été effectuée 7 jours après IR. RT-qPCR a été utilisé pour quantifier les niveaux des ARNm associés à la sénescence indiquées en utilisant les amorces spécifiques de gènes énumérés dans le tableau 1. Niveaux 18S ont été utilisés pour la normalisation. Les histogrammes représentent la moyenne t normaliséeo ± non traitée de 5 SEM expériences indépendantes. (B) des cellules WI-38 (PDL) 26 ont été exposés à 10 Gy d'IR; 10 d plus tard, le milieu a été changé en milieu sans sérum (voir la section 7). Au bout de 24 h, le milieu conditionné a été recueilli et l'IL-6, IL-8, GROa et les niveaux ont été quantifiés en utilisant des dosages ELISA. L'histogramme représente la moyenne ± SEM de 3 expériences. * P <0,05 et P *** <0,001 par le test t de Student. S'il vous plaît cliquer ici pour voir une version plus grande de ce chiffre.

Primaires humaines Vers l'avant Sens inverse
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGA GGA ACT AGT GGT CACTGG TGG GCT AGA AGA T GTCTTC AGT
CDKN1A (P21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 ACG CAGTCT TAG GCG CTG AG ACTCTT CCA TCA GGG TAT ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tableau 1: Amorces RT-qPCR pour des ARNm associés sénescence. des amorces avant et inverse pour l'utilisation de la technologie de SYBR-green RT-qPCR sont indiqués.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Ici, nous avons décrit des méthodes pour réplicative induite et l'ADN des dommages sénescence en utilisant des fibroblastes diploïdes humains. En outre, les techniques de quantification de la protéine et les taux d'ARNm de différentes protéines associées à la sénescence sont incluses, ainsi que pour la coloration SA-β-gal et pour le marqueur d'ADN dommages γ-H2AX. Ces protocoles peuvent être largement utilisés pour évaluer phénotypes sénescentes in vitro et in vivo, bien que de nombreuses mises en garde existent pour caractériser la sénescence in vivo 20. D'autres cellules peuvent exprimer des marqueurs de sénescence, même si elles ne sont pas des cellules sénescentes. Par exemple, des cellules telles que des ostéoclastes et des macrophages ont des niveaux plus élevés d'activité β-gal 32, 33. De plus, de nombreuses cellules cancéreuses ont une régulation positive p16 INK4A 34. Les cellules peuvent également accumuler des dommages à l'ADN (par exemple, des foyers γ-H2AX) et ne pas être sénescence. Les facteurs peuvent également être SASP par une régulation positivediverses conditions physiologiques ou pathologiques normales qui peuvent ou peuvent ne pas impliquer les cellules sénescentes. Par conséquent, de multiples marqueurs de sénescence devraient être utilisés, en particulier lors de l' évaluation de la sénescence in vivo.

Bien que les cellules sénescentes ont été trouvées être augmenté dans les tissus normaux du vieillissement il y a plus de 20 ans 4, il est seulement maintenant que nous apprécier pleinement la pléthore de rôles que les cellules sénescentes jouent dans les deux homéostasie des tissus normaux et dans des conditions pathologiques. L'emploi récent des modèles de souris pour éliminer p16 INK4a -positifs cellules sénescentes a permis aux chercheurs de mieux et d' apprécier précisément le rôle des cellules sénescentes dans les tissus et organes 35, 36, 37. Ces modèles ont découvert que les cellules sénescentes contribuent à une multitude de pathologies liées à l' âge, la tumorigenèse et la durée de vie de souris 35 </ sup>, 36, 37. Compte tenu de ces découvertes récentes et la validation de l'importance des cellules sénescentes en physiologie, le temps est venu pour plus de recherche sur ces cellules spécifiques. Par exemple, des études utilisant des stratégies pour éliminer les cellules sénescentes ou thérapeutique pour retarder la sénescence pourrait être bénéfique pour les deux études healthspan et durée de vie.

Récemment, notre laboratoire a constaté que la metformine, un médicament couramment utilisé pour traiter le diabète sucré de type 2, diminue la sénescence cellulaire 38. La metformine est actuellement proposé comme thérapie anti-vieillissement et a des propriétés anti-cancer 39, 40, il sera intéressant à l'avenir pour déterminer si ce médicament, ou d' autres interventions de vieillissement, influent sur les résultats de santé en modulant la sénescence cellulaire.

Les protocoles que nous discutons ici sont communs et largement unetechniques ccepted pour évaluer le phénotype sénescent. Pour les cellules cultivées in vitro, il est essentiel de suivre l' évolution des cellules à partir d' une broche en forme à une morphologie aplatie, afin de veiller à ce que les cellules sont sénescentes (voir les figures 1 et 2). Si les cellules ne sont pas positifs pour SA-β-gal ou d'autres marqueurs décrits ici, évaluer sénescence à LDP cellulaires plus élevées (pour sénescence réplicative) ou à une augmentation du temps après l'ADN sénescence des dommages induits par. De plus, ces protocoles peuvent avoir besoin d'être optimisé pour différents types de cellules. Pour l'évaluation des niveaux de protéines SASP, il est essentiel d'éliminer le sérum du milieu cellulaire, car cela entraînera des niveaux élevés de fond dans le test ELISA ou des réseaux de protéines. Par conséquent, gardez cela à l'esprit lors de la conception des expériences, comme il peut ne pas être idéal pour évaluer simultanément plusieurs marqueurs.

SA pour tacher-β-gal, tel que décrit ici, est limitée par le fait qu'il nécessite la fixation des cellules.En outre, la confluence des cellules a été montré pour influencer l'activité SA-β-gal. Les protocoles ont été développés pour évaluer l' activité SA-β-Gal en utilisant un substrat fluorogène pour l' activité β-gal, qui permet la quantification de ce marqueur dans les cellules vivantes en utilisant la cytométrie de flux 41, 42, 43. SA-activité β-gal peut également être mesurée dans les lysats cellulaires en utilisant un procédé de chimioluminescence 44. De plus, peut également être mesurée γ-H2AX en utilisant diverses autres méthodes, y compris la cytométrie en flux ou de l'immunoblot de lysats de cellules 45.

Il convient de noter que la formation est SAHF lignée cellulaire dépendante et est principalement associée à la sénescence oncogène induite par 20, 30, 46. Par conséquent, SAHF peut ne pas être présent dans tous les modèles de sénescence. L'utilité deSAHF comme marqueur sénescence dans les modèles de souris peuvent également être limité par le fait que SAHF est généralement pas observée dans les cellules sénescentes de souris 30, 46, 47. Ici, les anticorps contre H3K9me2 ont été utilisés, mais d'autres marqueurs moléculaires de SAHF peuvent être utilisés, y compris macroH2A, un groupe de mobilité élevée A (HMGA) des protéines, et de la lysine tri-méthylé 9 histone H3 (H3K9Me3) et des protéines HP1 liés. En outre, des analyses d'immunoprécipitation de la chromatine peuvent être utilisés pour évaluer les marques d'histone ou l'association des protéines de liaison à la chromatine de gènes cibles de E2F.

Il faut savoir qu'il existe différentes limites à caractériser sénescence, y compris l'hétérogénéité des marqueurs et le fait que ces marqueurs ne sont pas exprimés exclusivement dans les cellules sénescentes. Multiple (en général, 2 - 3) marqueurs devraient être utilisés pour évaluer la sénescence, y compris des marqueurs non décrits ici. Par exemple, l'ADN-scars, télomèresdommages et / ou la signalisation de dommages à l'ADN peut également être quantifié. De plus, comme la sénescence et, en particulier, le phénotype SASP, a récemment été démontré que d'être affectées par le facteur de stress spécifique ou des dommages qui induit la sénescence 11, 12, 13, il est important d'évaluer plusieurs marqueurs dans chaque paradigme expérimental.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgments

Cette étude a été soutenue par le Programme de recherche intra-muros des Instituts nationaux de la santé, l'Institut national sur le vieillissement. Les auteurs tiennent à remercier Myriam Gorospe et Kotb Abdelmohsen pour de nombreuses discussions utiles sur la sénescence et Kotb Abdelmohsen pour la lecture aussi critique du manuscrit. Nous remercions également les membres de notre laboratoire, en particulier Douglas Dluzen pour la lecture critique du manuscrit.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Techniques pour induire et Quantifier cellulaire sénescence
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter