Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

기술은 유도 및 정량화 세포 노화하기

doi: 10.3791/55533 Published: May 1, 2017

Summary

세포 노화, 세포주기 정지의 비가역적인 상태는 다양한 세포 스트레스에 의해 유도 될 수있다. 여기, 우리는 노화의 마커를 평가하기 위해 세포 노화 및 방법을 유도 프로토콜을 설명합니다.

Abstract

세포 스트레스 또는 손상에 대한 응답으로 증식하는 세포는 세포 노화이라고 장기 세포주기 정지의 상태를 개시하는 특정 프로그램을 유도 할 수 있습니다. 노화 세포의 축적은 생명체의 노화와 체외에서 계속 배양을 통해 발생합니다. 노화 세포는 배아 발달, 조직 복구 및 재생, 종양 억제, 노화 등 많은 생물학적 과정을, 영향을 미친다. 노화 세포의 특징을 포함하지만, 증가 된 노화 - 관련 β 갈 락토시다 제 활성 (SA-β-gal을)에 한정되지 않는다; P16의 INK4A, p53의, 그리고 P21 수준; γ-H2AX을 포함하여 DNA 손상의 높은 수준; 노화 관련 이질 병소 (SAHF)의 형성; 및 노화 관련 분비 표현형 (SASP), 염증성 사이토 카인 시그널링 분자의 수 분비를 특징으로하는 현상 획득. 여기, 우리가 모두 복제 성을위한 프로토콜을 설명하고DNA의 배양 세포에 노화를 유발 손상. 또, SA-β-gal을, γ-H2AX 및 SAHF 얼룩 등 여러 노화 - 관련 마커를 이용한 노화의 표현형을 모니터링하고, 세포주기 조절제 및 SASP 인자 단백질의 mRNA 수준을 정량화하는 방법을 강조. 이 방법은 다양한 모델과 조직에서 노화의 평가에 적용 할 수 있습니다.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

반 세기 이상 전 헤이 플릭와 동료들은 문화 확산 방법 변형되지 않은 세포를 설명하지만, 시간이 1 만 한정된 기간 동안. 인간의 섬유 아 세포의 장기 배양이 확산 막을 수있는 세포를 발생; 그러나, 그들은 대사 활동했고, 이것은 세포 노화라고했다. 노화 종양 억제에 도움이 될 수 있지만,이 에이징 (2, 3)에 발생하는 회생 용량의 감소에 기여하는 것으로 생각된다으로도 불리 할 수있다. 노화 세포는 4 세를 인간과 배아 발달, 상처 치료, 조직 복구 및 나이와 관련된 염증이 포함 생물학적 과정의 숫자에 연루되어있다으로 조직에 축적하는 것으로 나타났다.

문화에 세포의 지속적인 계대이 연결되었습니다 복제 성 노화를 유도마찰과 게놈의 불안정성을 텔로미어합니다. DNA 손상과 암 유전자를 포함한 다양한 세포 스트레스는 또한 노화 3가 발생할 수 있습니다. 텔로미어 (telomere)의 감소가 아닌 다른 요인에 의한 노화는 종종 스트레스 유발 또는 조기 노화라고 일반적으로 P16의 INK4A / Rb는 경로 (5)에 따라 결정된다. 증식 있지만, 형질 전환되지 않은 세포는 일반적으로 형상 스핀들 표시, 노화 세포는 특정 특성을 갖는 평평하고 넓은 형태 증가 노화 관련 β 갈 락토시다 제 활성 (SA-β-gal을) (도 12)를 포함하는 것으로 식별 될 수있다. 노화 세포는 γ-H2AX (도 3) (6), 및 잠재적으로 노화 관련 이질 병소 (SAHF) (도 4) (7)을 포함하여, DNA 손상 마커 축적된다. 노화 세포는 P를 포함하는 세포주기 규제의 높은 수준을 가지고 16 (P16의 INK4A) 및 / 또는 (P21) 및 p53의 (도 5) (8, 9). 또한, 최근의 데이터는 노화 세포는 염증성 사이토 카인 및 케모카인 중 다수를 분비하여 비 - 자율적 인 영향을 미칠 수있는 노화 - 관련 분비 표현형 (SASP) 10이라고 나타났다. 이 SASP 현상이 셀 타입에 세포 유형에 따라 다를 수 있지만, 일반적으로는 인터류킨 -6 (IL-6), IL-8, 과립구 - 대 식세포 콜로니 자극 인자 (GM-CSF), 성장 -의 증가에 의해 증명된다 종양 유전자의 조절 α (GRO-α), 및 β-GRO, 그 중에서도 (도 6). 노화를 유도 특정 응력이나 손상도 분비 표현형 11, 12, 13에 영향을 미칠 수있다. SASP는 ELISA를 카인 / 단백질 어레이를 사용하는 분비 단백질의 수준을 측정함으로써 검출 될 수있다S = "외부 참조"> 10, 14. 전사 후 메커니즘 SASP 단백질 농도 11 조절할 수 있지만, 15, 16, 17 mRNA 수준의 변화 또한 많은 경우에 검출 될 수있다. 이러한 변화는 일반적으로 더 민감하고 단백질 수준 측정보다 정량화하기 쉽다. 기타 노화 마커는 영속 DNA 손상 병소 핵 노화 (DNA-SCARS) (18)을 보강 염색질 변형 불려 DNA 세그먼트, 및 다양한 다른 마커 3, 19, 20을 포함하여 평가할 수있다.

여기서는 SA-β-갈, γ-H2AX, SAHF 포함한 노화 여러 마커를 측정하는 또 배양 세포에서 노화를 유도하고 공통 기술을 설명하고 senesce의 단백질 및 mRNA를NCE 분자가 회합.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. 유도하는 증식 및 노화

  1. 해동 저역 통과 인간의 배수체 섬유 아세포 (예를 들면, WI-38 및 IMR-90) 또는 다른 세포주.
    참고 : 여기, 사람 이배체 섬유 아세포가 사용되었지만, 이러한 프로토콜은 이러한 내피 세포, 상피, 또는 중간 엽 줄기 세포와 같은 다른 종류의 세포에서 노화를 평가하는 데 사용할 수 있습니다. 배양 조건으로 인해 상이한 성장 속도 또는 성장 조건을 사용하는 다른 세포 유형에 대해 최적화 될 수있다.
    주 : 세포를 증식하고, 스핀들 형태를 (개략과 예 2도도 1 참조)를 가져야한다. 이상적으로는, 세포는 가능한 복제 성 세포 노화를 피하기 위해 실험 시작 30 <인구 두배 레벨 (PDL)를 가져야한다.
    1. 하기 식 PDL 로그 = N의 F는 최종 세포 수이며 (N의 F / N 0) /은 log2를 이용하여 세포의 PDL을 계산 <EM> N 0 시드(21)의 초기 개수이다.
  2. 둘 베코 변형 이글 중간 (DMEM)에서 배양 WI-38 세포를 10 % 소 태아 혈청 (FBS), 1 % 비 필수 아미노산, 1 %의 페니실린 / 스트렙토 마이신이 보충.
  3. 10 % FBS와 1 % 페니실린 / 스트렙토 마이신이 보충 된 DMEM에서 IMR-90 세포를 성장한다.
  4. 37 ℃에서 모든 셀을 성장시키고, 5 % CO 2는 지속적으로 세포의 성장과 각 2 분할 - 80 % 합류 - 세포 ~ (70)에 도달하면 (4) D를. 광학 현미경을 사용하여 세포의 합류를 모니터링합니다. 이 억제를 접촉에 의한 세포 성장에 영향을 미칠 수있는, 높은 합류로 세포를 피하십시오.
  5. 다음에서 배양 한 PDL에 변화가 없을 때, 노화 세포의 형태 학적 외관 광 현미경으로 세포를 모니터링을위한 (도 12 참조).

2. DNA 손상 - ​​유도 노화

    (예를 들면, WI-38, IMR-90, 또는 다른 세포 유형) 희소 밀도 (즉, ~ 300,000 세포 / 6cm 접시) 분석의 유형 (단백질 6cm 접시 적절한 접시 / RNA 마커 또는 SA-β-gal을 염색하는 6- 웰 접시). 다음 날에 60 %의 합류 - 젊고 (<30 PDL)을 증식하고 세포가 약 50이되도록 그들을 플레이트를 사용하여 초기 통로 세포.
  1. 진공에 연결된 유리 피펫을 사용하여 성장 배지를 제거하고, 1X 인산 완충 생리 식염수 (PBS)을 첨가하여 세포를 세척한다. 두 세척 총에 대해이 단계를 반복합니다. 모두 "모의"치료와 전리 방사선 (IR)에 대한 처리 조건 (A 6cm 요리에 대한 ~ 750 μL)를 PBS의 얇은 층을 추가합니다.
  2. IR 10 그레이 (Gy의)의 단일 투여에 셀을 노출시키기 위해 감마 조사 장치를 사용한다; 이것은 대부분의 세포 라인에 대한 일반적인 노출이다. 후드에서 PBS를 제거하고 성장 배지로 교체하십시오. 선택적으로, B 세포와 치료2 시간 동안 20 ㎍ / mL의에 leomycin.
  3. 세포에있는 모든 48 -7 2 ​​시간을 매체를 변경하고 필요한 경우 셀을 분할합니다.
  4. 10 D를 IR 처리 후 - 7 노화 마커 형태 변화 (세포의 대표적인 이미지를 개략적으로도 2의도 1 참조), 분석 용 광학 현미경 하에서 세포를 모니터링.
    참고 :이 프로토콜은 IR에 의해 유도 된 노화를 설명합니다. 노화는, 블레오 마이신 (조건을 상기 참조)을 포함하는 다른 스트레스로 H 2 O 2 (22), (23), 화학 약품 (24), 담배 (25), 변형 성장 인자 (TGF) -β1 26, 27, 및 다른 방법 (21)을 유도 할 수있다 , 28, 29.

3. 염색 CEL노화 관련 β - 갈 락토시다 아제에 대한 LS

  1. 염색하기 전에, 형태 학적 변화를 모니터링하는 가벼운 현미경으로 세포를 검사합니다.
    주 : 노화 세포는 일반적으로, 스핀들 형태를 (개략 대표적인 결과를도 2에 대한도 1 참조)가 세포 증식 달리 확대 평면된다. 증식 세포를 음성 대조군으로 사용할 수 있고, IR 또는 다른 DNA를 손상 제 (섹션 2 참조)로 처리 된 세포를 양성 대조군으로 사용할 수있다.
  2. 상업용 키트 (재료 표 참조)에서 시약을 사용하여 SA-β-gal을 활성 정량화. 모든 시약을 녹여 37 ° C로 예열하여 실온에 가져.
    1. 염색 액 필요한 고정액 용액의 양을 계산한다.
      주 : 일반적으로, 1 mL의 부피를 6 웰 플레이트의 한 웰에 충분하다. 다른 판의 크기는 사용할 수 있지만, 6 웰 플레이트의 크기는 아입니다각 조건 중으로 분석법을 수행하기 위해 L이 적합한. 이 농도는 일반적으로 세포의 과잉 수를 사용하지 않고 계산하는 필드 당 세포의 충분한 수를 제공한다.
    2. 증류수로 염색 액의 1:10 희석.
    3. 증류수 정착액 용액 1:10 희석.
    4. 1 mL의 X-GAL 20 mg을, N, N- 디메틸 포름 아미드 (DMF 중의 X-Gal (5- 브로 모 -4- 클로로 -3- 인돌 릴 - β-D-갈 락토)의 20 배 스톡 용액 메이크업 DMF). 키트의 사용을 최대화하기 위해, 각각의 분석에 필요한 양의 X-GAL를 측정하고 용해 DMF의 계산 된 양을 추가한다. 또한, 한 달 동안 가벼운 보호 튜브에서 -20 ° C에서 원액을 저장합니다. 희석 X-GAL 용액을 저장하기위한 전용 폴리 프로필렌 (불투명) 튜브를 사용한다.
    5. 1X 염색 용액 930 μL, 염색 보조제 (A)의 10 μL, 염색 보충 B 10 μL, 20 mg을 50 μL / ㎖ X : β-gal을 염색 액을 준비DMF에 -Gal. 염색 할 필요가 얼마나 많은 우물에 따라 마스터 믹스를 확인합니다.
  3. 조심스럽게 전송 피펫 또는 동등하여 세포의 배지를 제거한다.
  4. 부드럽게 PBS 1X 실온 회 세포를 세척한다.
  5. 각 웰에 1 ㎖의 1X 정착액의 용액을 첨가하고 10 부화 - RT에서 15 분.
  6. 전송 피펫 정착액 솔루션을 제거합니다.
    주 : 고정 제 용액 (1 배)가 2 % 포름 알데히드 및 ​​0.2 % 글루 타르 알데히드를 포함하고 실험실 안전 사무실의 권고에 따른 유해 폐기물로서 폐기한다.
  7. 부드럽게 1X PBS로 두 번 세포를 씻으십시오.
  8. 완전히 PBS를 제거하고, 웰 (1 ㎖ / 웰을 6 웰 플레이트)에 1X β-gal을 염색 액을 추가한다. (이 버퍼의 pH를 낮추고 오염에 영향을 미칠 수 있으므로 바람직 CO 2의 부재) 37 ° C의 배양기에서 48 시간 - 알루미늄 호일로 완전히 커버 플레이트 (24)와 배양한다.
    1. 염색 24 시간에 세포를 확인하고 오염이 너무 밝을 경우, 또 다른 24 시간 동안 배양.
  9. 배양 시간 후, β-여자 솔루션을 제거하고 1X PBS로 교체하십시오.
    참고 :이 단계는 배경 색상의 일부를 제거 할 때 영상 또한 X-여자 솔루션의 위험한 유출을 방지 할 수 있습니다.
    참고 : 실험실 안전 사무실의 권고에 따라, 제대로 β-여자 솔루션을 폐기하십시오.
  10. 10 배 또는 그 이상의 목표를 이용하여 부착 된 카메라 광학 현미경에서 세포를 검사; SA-β-gal을 양성 세포는 파란색으로 표시됩니다. 실험에 대한 이미지의 수를 취득. SA-β-gal을 양성 세포의 비율을 계산하면, 화상의 해당 번호를 취득 (> 5) 정량 웰당. 이미지 내에서 각 웰 뷰의 다양한 분야에서 겹치지 않는 것을 보장한다.
  11. 총 세포 수에 비해 세포 SA-β-gal을 양성 (청색)의 수를 세어SA-β-gal을 양성 세포의 비율을 산출한다. 조건 당> 100 개 세포를 계산합니다.
    참고 : 대표 사진도 그림에 사용할 수 있습니다. 너무 많은 세포가 어려운 각 셀을 차별화하고 너무 적은 수의 정량 및 통계에 대한 세포의 충분한 수를 제공하지 않을 수 있도록으로, 그 세포 포화 상태가 계산 세포의 경우 중요합니다. .JPEG 파일도 적합하지만, .TIFF 파일로 저장 한 경우 게시를 위해 인물 사진은 최적의 해상도입니다. 컬러 이미지를 300 dpi로해야한다.

γ-H2AX 4. 염색 세포

  1. 24- 웰 플레이트에 커버 글라스의 섹션 1 또는 2로부터 셀 플레이트.
  2. 다음 날, 1X PBS로 세포를 씻어. 노화 세포가 커버 슬립에 잘 고착되지 않고 쉽게 세척시 제거 할 수 있기 때문에, 신중하게 씻어. 대안 적으로, 직접적으로 세척하지 않고 세포를 고정한다.
  3. PBS를 제거하고 PBS에서 새로 제조 한 3.7 %의 포름 알데히드와 세포를 고정RT에서 10 분.
  4. 용액을 제거하고 10 분 동안 PBS에서 0.2 % 트리톤 X-100 세포를 Permeabilize 하시려면.
  5. RT에서 2 시간 동안 PBS에서 5 % FBS에서 용액 블록을 제거한다.
  6. 39 ° C에서 37 ° C 또는 O / N에서 2 시간 동안 / 5 % FBS에 γ-H2AX (Ser139) 및 항 - 포스 FITC 접합체와 PBS를 부화. 빛으로부터 보호합니다.
  7. 60 분 - 30 합계 37 ℃에서 PBS로 6X - 3 씻는다.
  8. DAPI로 염색 (희석 1 : 15,000으로 PBS) RT에서 10 분 동안.
  9. PBS로 세척 배.
  10. antifade 시약 5 μL - 신속 염을 제거하고 3을 이용하여 유리 슬라이드의 커버 슬립을 장착하기 위해 물로 세척한다. 대안 적으로, DAPI를 포함하는 장착 용액을 사용한다.
  11. 그것을 건조 O / N하자 및 63X 대물 이상을 사용하여 형광 공 초점 레이저 주사 현미경에서 염색 된 세포를 시각화.
  12. 이하의 두 가지 방법 중 하나를 사용하여 γ-H2AX 병소 정량화. 형광 현미경을 이용하여 눈으로 두 프로토콜에 대한 점수. 이상적으로, 우리를개 공 초점 현미경. Z 섹션을 가지고 (도 3에 도시되어 증식 및 세포 노화에 γ-H2AX 염색 용 대표 화상) 모든 초점 검출을 시각화하기 위해서는 하나 개의 평면으로 집광. 이미징 소프트웨어를 사용하여 눈으로 초점을 카운트; 일반적으로, ~ 100-200 핵 계산 충분합니다.
    1. γ-H2AX 양성 병소가 세포의 백분율을 정량화하기 위해 DAPI 염색 핵의 전체 수에 의해 적어도 하나의 포커스 표시 및 분할을 가지고, 각 셀 카운트.
    2. γ-H2AX의 병소의 수를 정량화하기 위해 세포 당 γ-H2AX의 초점을 계산합니다.
      참고 : γ-H2AX의 수준은 노화를 유발하는 특정 스트레스 또는 손상에 따라 달라질 수 있습니다.

SAHF 마커 5. 염색 세포

참고 : 인간의 노화 세포는 종종 응축 DNA / 염색질의 핵 지역이있을 것이다. 노화 세포,이 염색질 지역에서같은 E2F 가족 구성원으로 확산 촉진 유전자의 발현을 억제하는 것으로 생각된다. SAHF은 DAPI의 개편에 의해 가시화 될 수있다; 히스톤 H3 (H3K9Me2 및 H3K9Me3)에 Lys9의 디 - 및 트리 - 메틸화 포함 이질 관련된 히스톤 마크의 존재; 및 HP1의 이질 단백질 1 (HP1)를 포함 염색질 단백질 재구성에 의해, HIRA (히스톤 리프레 A) 및 ASF1a (항 입을 함수 1A)는 30 염색질한다. SAHF는 OIS 모델 (30)에서 더 눈에 띄는대로 우리는 종양 유전자에 의한 노화 모델 (OIS)를 사용하도록 선택했습니다. IDH4 세포 때문에 SV40 큰 T 항원의 존재 덱사메타손의 존재 하에서 증식하지만, 매체 (31)로부터의 덱사메타손 제거 후의 노화된다. SAHF은 DAPI 염색에 의해 위의 특정 마커에 대한 항체로 염색하여 검출 할 수있다. 여기, 우리는 visualizat에 대한 DAPI와 H3K9Me2 염색을 설명셀 (28)의 이온 SAHF.

  1. 10 % FBS, 1 % 페니실린 / 스트렙토 마이신, 및 1 ㎍ / ㎖의 덱사메타손 보충 된 DMEM에서 IDH4 세포 성장. 노화를 유도하기 위해, 덱사메타손을 제거하고 목탄 - 스트립 FBS를 포함하도록 매체를 변경; 이 새로운 매체에 십일 ~에 대한 성장 후, IDH4 세포는 31 노화된다.
  2. 플레이트 IDH4 셀 또는 섹션 1 또는 2에서 세포는 24- 웰 플레이트에 커버 글라스에 상술.
  3. 다음 날, 1X PBS로 세포를 씻어. 노화 세포가 커버 슬립에 잘 고착되지 않고 쉽게 세척시 제거 할 수 있기 때문에, 신중하게 씻어. 대안 적으로, 세척없이 직접 세포를 고정한다.
  4. PBS를 제거하고 실온에서 10 분 동안 PBS에서 갓 제조 된 3.7 % 포름 알데히드로 세포를 고정한다.
  5. 1X PBS로 세포를 3 회 반복한다.
  6. 용액을 제거하고 5 분 동안 PBS에서 0.2 % 트리톤 X-100 세포를 Permeabilize 하시려면.
  7. 1 배와 세포를 씻으십시오PBS. PBS를 제거하고 3 % BSA를 함유하는 블록킹 완충액을 첨가하여 커버 슬립을 차단 (W / V) RT에서 5 분 동안 PBS있다. 항상 입자상 물질을 제거하기 위해 사용하는 BSA 전에 포함 된 솔루션을 필터링합니다.
  8. 차단 완충액을 제거하고 안티 H3KMe2 항체로서 SAHF 마커에 대한 일차 항체와 함께 세포를 배양한다 (도 4, 자세한 내용은 재료 표 참조). 차단 완충액을 항체 희석하고 1 부화 - RT에서 2 시간.
  9. 차 항체 용액을 제거하고 PBS에서 1 % (v / v) 트리톤 X-100으로 커버 슬립을 3 회 세척 하였다.
  10. 버퍼 (재료 표)를 차단하는 이차 항체를 희석하고, RT에서 1 시간 동안 배양한다. 빛으로부터 보호합니다.
  11. 1X PBS로 두 번 세포를 씻으십시오. RT에서 10 분 동안; DAPI와 얼룩이 (PBS 15,000 재료 표 1 참조 희석).
  12. 커버 슬립이 1X PBS로 3 배 씻으십시오.
    1. 빨리 염을 제거하기 위해 물로 씻어antifade 시약 5 μL - ND 3을 이용하여 유리 슬라이드에 각 커버 슬립을 장착. 대안 적으로, DAPI를 포함하는 장착 용액을 사용한다.
    2. 건조 O / N하자 및 63X 대물 이상을 (도 4의 대표적인 결과를 참조)를 사용하여 형광 공 초점 레이저 주사 현미경에서 염색 된 세포를 시각화. 4 절에 설명 된대로 SAHF 정량화.
      주 : (즉, 단독 보조) 이소 제어 일차 항체 또는 전혀 차 항체는 면역 형광 염색에 대한 대조군으로서 사용한다.

6. 면역 블 롯팅에 의해 노화 관련 단백질을 분석

주 : 노화의 표현형 INK4A P16, P21 및 p53의 세포주기를 포함한 레귤레이터의 상향 조절을 특징으로한다. 이 프로토콜은 세포 용 해물에서 이러한 단백질의 수준의 정량화를 설명합니다. 이러한 기술은 다양한 이용을 유도 노화를 평가하는데 사용될 수있다방법 21, 28, 29.

  1. 섹션 1, 2 또는 다른 방법 21, 28, 29을 사용하여 설명 된 것처럼 세포 노화를 유도한다. (RNA 분리 지시 7 항 참조) 6cm 접시에서 세포를 플레이트와 동시에 단백질과 RNA 양을 분석, 세포 노화 마커를 분석.
  2. 세포 배양 배지를 제거합니다. 얼음 트레이에 세포를 넣습니다.
    1. 차가운 1X PBS로 세포를 2 회 반복한다. 절차에 사용되는 볼륨의 측면에서뿐만 정확하게 할 수 있도록 모든 PBS가 흡입되는 것을 보장하기 위해 접시를 기울입니다.
    2. PBS의 마지막 세척을 흡입 한 후, 접시 (a 6cm 접시에 대한) 초기 1X PBS 200 μL를 추가한다. 셀 스크레이퍼를 사용하여 세포를 긁어.
    3. RNA 분리에 대한의 RNase없는 튜브에 세포 / PBS 혼합물을 피펫. 취 약 150181; 새 튜브에이 혼합물을 피펫으로의 L. 이 나누어지는 단백질 분석에 사용, 각각의 튜브에서 동일한 금액을 피펫해야한다.
  3. 75에 추가하여를 Lyse는 세포 - 개질 배 램리의 샘플 완충액 (60 개 mM 트리스 - 염산 pH를 6.8, 12.5 % 글리세롤, 2 % SDS, 5 % β 메르 캅토 에탄올 (BME), 및 브로 모 페놀 블루 100 μL은;로 구성 될 수있다 큰 일괄 분주하고 사용할 때까지 -20 ℃로) 또는 동등한 샘플 버퍼에 저장된다.
    1. 세포 파편을 제거하기 위해 4 ° C에서 10 분 동안 15,000 XG에 용해 완충액 원심 분리기 100 μL - 대안 적으로, 75에서 용균. 깨끗한 튜브에 뜨는 피펫을 제거합니다. 브래드 포드 단백질 분석 또는 동등한 단백질 분석법은 단백질의 동일한 로딩되도록 용 해물을 이용할 수있다.
      참고 : 단백질 분석은 샘플 버퍼에 용해 샘플을 수행 할 수 없습니다.
    2. 해물 ~ 25 μL를 가지고 2 배 샘플 버퍼의 15 μL에 추가합니다. 최대 피펫 및 수행샘플 버퍼는 WN 용균한다.
      주 : 용해 완충액 또는 샘플 버퍼 볼륨 셀 합류점에 따라 조정될 수있다. 샘플 인해 핵 용균에 "끈적 끈적한"인 경우, 희석 더 많은 샘플 버퍼 또는 PBS를 추가합니다. 샘플은 사용할 때까지 -20 ° C에 저장할 수 있습니다.
  4. 18 % 트리스 - 글리신 겔에서 5 열 블록에 95 ° C에서 분 (또는 이와 동등한 장비) 및 부하 시료 완충액에 용해 된 시료 ~ 40 μL를 위해 샘플을 끓인다.
    주 : 구배 겔 (4 % -15 %) 또는 14 % 트리스 - 글리신 겔은 저 분자량 단백질을 검출하기에 충분하다. 아크릴 아마이드 겔의 종류는 사용하지만, 겔 및 시스템은 저 분자량의 단백질을 검출하기위한 적절한 것을 보장 할 수있다.
    1. (적층 겔을 통해)을 20 분 동안 일정한 100 V에서 1X 런닝 버퍼를 이용하여 실행하고 염료 프론트 방금 실행 또는 겔 바닥 위에 오도록 ~ 180 V. 60 분 겔 모니터 저분자 있도록 체중 단백질 연구를하지 않습니다겔의 해제되지 않은.
  5. PVDF 막에 아크릴 아마이드 겔을 트랜스퍼 (활성화 100 % 메탄올로 예비 침지). 젖은 전송을하는 경우 만 1 시간이 (1.75 시간 ~ 정상 대) 전송을 위해 필요하다. 적절한 전송 시스템에 따라 조정; 사전 스테인드 분자량 마커를 사용하여 전송 효율을 평가하는데 도움이 될 수있다.
  6. 물에 막 씻으십시오. 샘플의 동일한 로딩 모니터링 할 개양귀비 빛의 얼룩을 사용합니다. 물에 떨어져 개양귀비 빛을 씻으십시오.
    1. 교반하면서 4 ℃에서 RT 또는 O / N에서 1 시간 용 TBST에서 5 % 무 지방 건조 우유에 막 (50 mM의 pH 7.5 인 Tris-HCl, 150 mM의 염화나트륨, 및 0.1 % 트윈 -20) 차단.
  7. 워시 TBST 회 도말하고 RT에서 1 시간 동안 5 % 우유 TBST (항체 희석액과 권고 재료 표 참조)에 희석 차 항체와 함께 배양한다.
  8. TBST 두 빠른 세척을 수행하고 ~ 총 ~ 30 분 (대한 쉐이커에 두 번 각각이었다 15 분을 씻어H).
  9. RT에서 40 분 동안 이차 항체로 인큐베이션. 단계를 반복 6.10.
  10. 갓 만든 웨스턴 블롯 기판에 품어 필름을 개발하거나 화학 발광 리더에서 읽어.
  11. 제 P16의 INK4A 항체와 면역 프로브 (도 5). 물을 15 분, 0.2 N NaOH로 15 분, 그리고 물을 15 분 동안 배양하여 멤브레인 스트립. 안티 P21 항체를 사용하여 단계 6.9를 계속합니다.
  12. 박리 액 50 ㎖마다 새롭게 추가 BME 300 μL 62.5 mM의 트리스 -HCl pH가 6.8, 2 % SDS를 사용하여 멤브레인 스트립.
  13. 30 분 동안 50 ℃에서 인큐베이션 한 후 TBS와 TBST로 광범위하게 세척 하였다. 단백질 로딩 컨트롤 항 - 액틴 또는 항 GAPDH 항체로 프로브 (도 5는 대표적인 결과를 나타낸다).
    참고 : p53의 수준은 같은 막으로 평가 될 수있다. p53의 더 높은 분자량이기 때문에, 더 나은 (낮은 비율 젤에 해결 예를 들어,

7. 노화 마커 mRNA의 수준을 분석

참고 : RNA를 분리 할 때, 작업 표면의 RNase 제거 솔루션 또는 이와 동등한로 청소 한 것을 확인하고 재료가 모두의 RNase없는 것을.

  1. 단계 4.2 셀 / PBS 혼합물을 사용하여 30 초 동안 RNA 추출 용액 및 와류 1 mL를 넣어 (보이는 세포 덩어리 또는 파편이 없어야한다).
  2. 클로로포름 200 μL를 추가하고 15 초 동안 적극적으로 흔들.
  3. 4 ℃에서 15 분 동안 최대 속도 (> 15,000 XG) 원심 분리기.
  4. 상부 수성층의 RNA ~ 400 μL를 제거하고 새로운 미세 원심 분리 튜브로 피펫.
  5. 및 PR 4 μL (총 이전 단계에서 피펫 수층의 용적 1) 400 μL의 이소프로판올을 추가RNA의 층 ecipitant.
  6. 최대 속도 (> 15,000 XG)에서 15-30 분, 39 ° C 원심 분리기는 RNA 펠렛.
  7. 상청액을 제거하고 75 %의 얼음처럼 차가운 에탄올 1 mL를 첨가.
  8. 최대 속도 (> 15,000 XG)와 4 ℃에서 1 분 동안 원심 분리기.
  9. 최대 속도 (> 15,000 XG)와 4 ℃에서 1 분 동안 원심 분리하고 상층 액을 제거한다.
  10. 2 분 동안 공기 건조하고 가능한 한 많은 액체를 피펫.
  11. 배 DNase의 완충액 10 μL, H 2 O 85 μL 재 중단하고 DNase의 1/5 μL.
  12. 30 분 동안 37 ℃에서 인큐베이션.
  13. 200 μL NT2 완충액 (50mM 트리스 - 염산 pH 7.4의 150 mM의 염화나트륨, 1 ㎜의 MgCl 2, 0.05 % Nonidet P-40)를 첨가하고, 아세트산, 페놀 - 클로로포름 (2)의 하층 300 μL를 추가한다.
  14. 최대 속도로 5 분 동안 실온에서 1 분간 원심 분리 용 소용돌이 (> 15,000 XG).
  15. 상부 RNA 층 (2 × 125 μL) 250 μL를 수집 추가 253 M 아세트산 나트륨 pH가 5.2, 100 %의 얼음처럼 차가운 에탄올 625 μL, 침전제 및 5 μL의 μL. 잘 섞어서 -20 ℃에서 O / N을 석출.
  16. 다음날 섞어 최대 속도 (> 15,000 XG) 30 분 동안 4 ℃에서 회전하고 상층 액을 제거한다.
  17. 반복 6.8-6.11 단계를 반복합니다.
  18. 사용할 때까지 -80 ° C에서 핵산 분해 효소가없는 물과 저장소의 12 μL의 펠렛을 다시 일시 중지합니다.
    참고 : 다른 RNA 분리 절차 및 키트는 물론 사용할 수 있습니다.
  19. 임의 헥사로 역전사를 수행하고 SSII는 제조 업체의 프로토콜에 따라 역전사.
    참고 : 노화 세포에서 분리 된 RNA의 낮은 양을 감안할 때, 그것은 역전사 합성 RNA (12 μL)을 모두 사용하는 것이 가장 좋습니다. 대안 적으로, RNA는 분광 광도계를 사용하여 정량 할 수 있고, 동일한 양의 RNA는 역전사를 위해 사용될 수있다.
  20. 양적 qPCR에 (RT-qPCR에) amplific을 실시간을 이용하여 mRNA 수준 분석ATION 및 유전자 특이 프라이머와 SYBR 녹색 PCR 마스터 믹스.
    1. 일반적인 RT-qPCR의 반응에서와 같이, (의 RNase / DNase의없는 물) cDNA를 1:30 희석하고 더 나은 피펫의 정확성을 위해 실시간 96 웰 플레이트에 3 μL를 추가합니다. 유전자 특이 적 순방향 반응 마스터 믹스를 제조 및 역방향 프라이머 (2.5 μM 농도의 5 μL / 반응을 추가), SYBR 그린 PCR 혼합물 (6.25 μL / 반응; 제조자의 권고 미만 사용)과의 RNase 5.75 μL / 20 μL (프라이머 / SYBR 그린 / 물 17 μL 및 cDNA의 3 μL)의 최종 반응 부피에 대한 DNase의없는 물.
    2. 실시간 PCR 기계를 사용하여 RT-qPCR의 증폭을 수행; 제조업체의 프로토콜을 따르십시오.
      참고 : 앞으로 검증 인간의 목록과 실시간 프라이머 역은 표 1에서 찾을 수 있습니다. 이 유전자는 SASP 단백질 및 기타 노화 관련 마커 및 / 또는 유전자를 포함한다. IR 유도 노화 대표 결과에 나타낸다

제 정량화 SASP 단백질 수준

  1. 섹션 1 또는 2 또는 다른 방법을 사용하여를 이용하여 노화를 유도한다. (~ 250,000 세포 / 6cm 판 또는 ~ 650,000 / 10cm 플레이트) 전술 한 바와 같이, 하나 또는 6 개 10cm 플레이트상에서 세포를 접시.
  2. 어느 6cm 또는 5 ㎖에 대해 (2.5 mL의 셀 (10) (D) 후의 IR 처리 또는 복제 성 노화 세포 (적절한 대조군 세포)와 함께, 1X PBS로 세포를 세 번 세척하고 소량의 항생제와 무 혈청 배지를 추가 10cm의 경우).
  3. 조직 배양 인큐베이터에서 CO 2, 37 ℃에서 밤새 인큐베이션하고, 5 %. 다음 날, 매체를 수집하고 얼음에 원뿔 튜브에 넣어.
  4. PBS로 세포를 2 회 반복 한 다음 (a 6cm 요리 용) 트립신 1 ㎖를 추가한다. 이후 세포 수에 따라서 농도 조정을 이용하여 혈구 세포를 카운트.
  5. 원심 300 × g으로 5 분 동안 매체.
  6. FILTER 배지 0.45㎛의 시린지 필터를 사용.
  7. 직접 ELISA 또는 동등한 분석법을 사용하여 이용 또는 분석 할 때까지 -80 ℃에서 동결 배지 나누어지는.
  8. 수집 된 매질의 총 세포 수 / 부피를 취하여 / ㎖ 농도 세포의 수를 계산한다.
  9. 제조업체의 지침에 따라 적절한 효소 면역 분석법 (ELISA)을 수행합니다. IL-6, IL-8, GROα, 기타 사이토킨 / 케모카인 (도 6B)에 대해 분석하는 추천 ELISA 키트 용 재료 표 참조.
  10. 측정 요소는 ELISA 키트의 선형 범위 내에 있도록하기 위해, 세포 증식 배지에 비해 노화 된 세포 배지 희석액을 만든다. 이 희석 및 IL-6의 양을 산출 부피를 차지한다. 일 셀당 분비 된 IL-6의 양을 확보하기 위해, 희석 mL의 세포 농도 별 (PG)에서 상기 키트로부터 얻어진 IL-6의 값을 계산 (FROM 단계 7.8).
    주 : 이러한 사이토 카인의 어레이와 같은 다른 방법으로는, SASP 단백질 수준을 검출하는데 사용될 수 SASP 인자 다수의 선별에 적합 할 수있다. SASP 인자 단백질 수준은 노화 유도, 세포 유형 또는 유도 된 노화의 종류 후의 시간에 따라 달라질 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

6 SA-β-gal을 염색에서 대표적인 결과를 보여준다 - 2도 γ-H2AX 및 SAHF위한 염색; P16의 INK4A, P21 및 p53의 단백질 수준의 평가; 및 mRNA의 노화와 관련된 분자의 단백질 수준. 증가 된 SA-β-gal을 염색 및 복제 성 DNA 손상 - ​​유도 노화 발생. 또한, 노화와 함께 일어나는 형태 학적 변화를 관찰한다. 세포는 섬유 아세포 증식 스핀들 외관에 비해 확대 된 평면이된다. 본 실험 패러다임, 세포를 염색하고, RNA / 단백질 IR 노광 후 7 (D)를 분리 하였다. 더 강력한 결과는 IR 노출 (예 : 10 D) 후 이상 대기에 의해 발생할 수 있습니다. 조건은 각 조건 및 실험 장치에 대해 결정해야합니다. 이들 결과는 대표적인 노화 및 다른 방법을 사용하여 유도 될 때 이러한 마커는 검출 할 수있다.

도 6 her.within 페이지 = "1"> 유전자 이름을 나열하고 CXCL1 (GROα) CXCL2 (GROβ) 및 CSF2 (GM-CSF)에 해당된다. SASP 요인의 일부의 mRNA 수준의 상향 조절, 전부는 아니지만은, WI-38 세포에서 IR에 의한 노화 후 관찰되었다. CDKN1A (P21 인코딩) 및 CDKN2A (P16의 INK4A을 인코딩)을 포함하여 기타 노화 관련의 mRNA는 상향 조절했다. 기타의 mRNA (EDN1ANKRD1)도 포함되어 있고 이미 노화 된 세포 15 높게 나타났다. 프라이머는 표 1에 나열되어 있습니다.

그림 1
그림 1 : 증식 및 노화 섬유 아세포. 증식 (왼쪽)과 노화 (오른쪽) 섬유 아세포의 개략도. 노화 유도제의 예로는 너희에 나타낸다llow 상자. 노화가 표시된 마커의 높은 수준과 연관되어 있습니다. SA-β-gal을 노화 관련 β 갈 락토시다 제 활성; SASP, 노화 관련 분비 표현형; SAHF, 노화 관련 이질 염색질의 초점; DDR, DNA-손상 응답. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오

그림 2
그림 2. 형태 학적 특성 및 노화 세포의 증가 SA-β-gal을 활동은. WI-38 세포, "젊은"(PDL 27), 복제 성 노화 (PDL 40), 또는 전리 방사선 (IR)에 노출 된 사람들, SA-β-gal을 활동을 위해 염색 확산 중. IMR-90 세포 증식 중 "젊은"(PDL 30), 복제 성 노화 (PDL 52) 또는 방사 (IR)를 이온화 방사선에 노출 것과 STA이었다SA-β-갤런 활동 이네. 섹션 (가) 1 - 2 및 복제 성 DNA 손상 - ​​유도 노화를 유도 기술 및 제 3 SA-β-gal을위한 염색을 설명한다. 세포 IR 후 7 일 이내를 염색 하였다. 콘, 제어 할 수 있습니다. 스케일 바는 50 μm의 =. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
그림 3. 노화 세포에서 γ-H2AX 초점을 증가. WI-38 세포 증식 중 "젊은"(PDL 30) 또는 복제 성 노화 (PDL 53)와 고정 반 γ-H2AX 항체 및 DAPI 염색 하였다. 노화 세포에서 γ-H2AX의 병소의 수의 증가를합니다. 이미지는 공 초점 현미경을 얻었다. Z 섹션 촬영하고, 그 최대 강도 투영 모든 detec 시각화 단일 평면 화상을 얻기 위해 사용 된테이블 초점. 스케일 바는 20 μm의 =. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 4
그림 노화 세포의 SAHF 4. 형광 염색. (A) 증식 WI-38 세포 (PDL 27) 미처리 또는 이온화 방사선 (IR)에 노출시켰다. 십일 후, 세포 SAHF (IR 처리 된 세포 밀도 / 점상 DAPI 염색 주) (B) IDH4는 덱사메타손의 존재하에 배양 하였다 (확산) 또는 노화를 유도하는 숯불 박탈 FBS하여 (시각화 DAPI 염색 하였다 늙은). 10 D 후, 세포 H3K9Me2 및 DAPI에 대한 항체로 염색 하였다. 이미지는 공 초점 현미경을 얻었다. Z 섹션 촬영하고, 최대 강도의 투영은 단일 평면을 수득 하였다영상. 노화 세포 DAPI 염색 반점이있는 반면 (A) 및 (B)에서 증식 세포 확산 DAPI 염색있다. H3K9Me2 염색보다 견고하고 노화 세포 DAPI 염색으로 초점 colocalizes 반면 (B)에서, 제어 셀들은 H3K9Me2 대한 확산, 매우 가벼운 오염을 갖는다. 스케일 바는 20 μm의 =. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 5
노화 관련 단백질의 그림 5. 정량화. 전리 방사선의 10 Gy의 (IR)에 노출 또는 IMR-90 세포 (-) 단백질 확산 "젊은"(PDL 30) IMR-90 세포 하나에서 분리 하였다. 매체는 48 시간마다 변화시키고, 세포 IR 후 7 (D)을 용해시켰다. 샘플 안티 P16의 INK4A의 antibo와 immunoblotted, SDS-PAGE로 분석 하였다다이 안티 P21하고 항 p53의 항체로 재 프로빙. GAPDH는 단백질 로딩 대조군으로 사용 하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 6
노화와 관련된 mRNA를 SASP 단백질의 정량도 6. (-) 이온화 방사선 (IR)의 10 Gy의 노출되었다 또는 WI-38 세포 (A) RNA 중 하나 확산 "젊은"(PDL 27 또는 34) WI-38 세포에서 분리 하였다. 매체는 48 시간마다 변화시키고, RNA를 분리 한 후 IR 7 D를 실시 하였다. RT-qPCR에 표 1에 기재된 유전자 특이 적 프라이머를 사용하여 표시된 노화 관련의 mRNA 수준을 정량화 하였다. 18S 수준은 정상화를 위해 사용되었다. 히스토그램의 평균을 나타내는 정규화 t5 개 독립적 실험 O 미처리 ± SEM. (B) WI-38 세포 (PDL 26)의 IR 10 Gy를 노출시켰다; 10 D 후, 배지를 무 혈청 배지로 변경 함. 24 시간 후, 배양 상청을 회수하고, IL-6, IL-8, GROα 및 수준은 ELISA 어 세이를 사용하여 정량화 하였다. 히스토그램은 세 실험으로부터 평균 ± SEM을 나타낸다. * 학생의 t 검정에 의한 P <0.05 *** P <0.001. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

인간 프라이머 앞으로
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT의 CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (P21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (P16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG의 CAGTCT의 TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL-6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

표 1 : 노화 관련 mRNA에 대한 RT-qPCR에 프라이머. RT-qPCR에가 SYBR 녹색 기술을 사용하기위한 순방향 및 역방향 프라이머가 표시됩니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

여기에서는 인간의 배수체 섬유 아세포를 이용하여 복제 성 및 DNA 손상 - ​​유도 노화에 대한 방법을 설명 하였다. 또한, 다양한 단백질 및 노화 관련 단백질의 mRNA 수준을 정량화하기위한 기술이 포함될뿐만 아니라, 염색 SA-β-gal을위한 상기 DNA 손상 - ​​마커 γ-H2AX위한 것이다. 많은주의가 생체 (20)에 노화의 특성이 존재하지만,이 프로토콜은 널리 생체 외 및 생체 내에서 모두 노화 표현형을 평가하는 데 사용할 수 있습니다. 다른 세포들이 노화 된 세포없는 경우에도, 노화 마커를 표현할 수 있습니다. 예를 들면, 파골 세포 및 대 식세포와 같은 세포는 β-gal을 활성 (32, 33)보다 높은 수준을 갖는다. 또한, 많은 암 세포는 P16의 INK4A (34)을 상향 조절했다. 세포는 DNA 손상 (예를 들면, γ-H2AX의 초점) 및 노화하지를 축적 할 수있다. SASP 요인도에 의해 상향 조절 될 수있다각종 정상 생리 학적 또는 또는 노화 된 세포를 포함하지 않을 수있다 병적 상태. 생체의 노화를 평가할 때 특히 따라서 여러 노화 마커가 이용되어야한다.

노화 세포는 20 년 전 4 정상 노화 조직에서 증가하는 것으로 확인되었지만, 그것은 단지 지금 우리가 완전히 노화 된 세포가 모두 정상 조직의 항상성과 병적 인 상태에서 재생하는 것이 역할의 과다를 감상하는 것입니다. P16의 INK4A 양성 노화 세포를 제거하기 위해 마우스 모델의 최근 고용은 연구자 더 명확를 허용하고 정확하게 조직 및 기관 35, 36, 37에서 노화 세포의 역할에 감사하고있다. 이 모델은 노화 세포가 노화 관련 병리, 종양의 군중에 기여하는 것을 발견하고, 마우스 수명 35</ SUP>, 36, 37. 이러한 최근의 발견과 생리학에 노화 세포의 중요성의 검증을 감안할 때, 시간이 특정 세포에 대한 연구 익은이다. 예를 들어, 치료 적 연구는 세포 노화를 제거하거나 노화 모두 healthspan 및 수명 연구에 도움이 될 수있는 지연 전략을 채용.

최근, 우리 연구소는 메트포르민, 일반적으로 제 2 형 당뇨병을 치료하는 데 사용 약물, 세포 노화 (38)를 감소를 발견했다. 메트포르민은 현재 노화 방지 요법으로 제안 및 안티 - 암 속성 (39), (40)이되고,이 약 또는 다른 노화 개입, 세포 노화를 조절함으로써 건강 결과에 영향을 미치는 여부를 조사하기 위해 미래에 흥미로운 일이 될 것이다.

우리가 여기서 논의 프로토콜은 널리 일반적이고있다ccepted 기술은 노화 표현형을 평가합니다. 시험 관내에서 세포 성장을 위해, 상기 세포를 (도 12 참조) 노화 것을 보장하기 위해 편평한 형태로 스핀들 형으로부터 셀 변경을 모니터링하는 것이 중요하다. 세포는 SA-β-gal을 또는 여기에 설명 된 다른 마커 양성 아닌 경우 (복제 성 노화) 또는 DNA 손상 - ​​유도 노화 후 증가시의 PDL 높은 세포에서 노화를 평가한다. 또한, 이러한 프로토콜은 서로 다른 세포 유형에 맞게 최적화해야 할 수 있습니다. SASP 단백질 수준을 평가하기 위해,이는 ELISA 또는 단백질 어레이에서 높은 배경 수준의 원인이됩니다, 셀 매체로부터 혈청을 제거하는 것이 중요합니다. 실험을 설계 할 때 동시에 여러 마커를 평가하기에 적합하지 않을 수 있습니다 따라서,이 점을 명심.

여기에 기술 된 바와 같이 SA-β-gal을위한 염색, 그것은 세포의 고정을 필요로한다는 사실에 의해 제한된다.또한, 세포의 합류는 SA-β-gal을 활성에 영향을 미치는 것으로 밝혀졌다. 프로토콜 41, 42, 43를 사용하여 유세포 생균이 마커의 정량을 허용 β-gal을 작동하는 형광 기질을 사용하여 SA-β-갈 활성을 평가하기 위해 개발되어왔다. SA-β-gal을 활성은 또한 화학 발광 법 (44)을 사용하여 세포 용 해물에서 측정 할 수있다. 또한, γ-H2AX는 유동 세포 계측법 또는 세포 용 해물 (45)의 면역을 포함하는 다양한 다른 방법을 사용하여 측정 할 수있다.

SAHF 형성이 세포주 의존적임을 주목해야한다 대체로과 연관된 종양 유전자 - 유도 노화 20, 30, 46. 따라서, SAHF 모든 노화의 모델에 존재하지 않을 수 있습니다. 의 유틸리티마우스 모델에서 노화 마커 SAHF SAHF 또한 일반적으로 마우스의 노화 세포를 30, 46, 47에서 관찰되지 않는다는 사실에 의해 제한 될 수있다. 여기서, H3K9Me2에 대한 항체가 사용되었지만 SAHF 다른 분자 마커 macroH2A 높은 이동성 그룹 A (HMGA) 단백질, 및 트라이 메틸화 라이신 9 히스톤 H3 (H3K9Me3)와 결합 HP1 단백질을 포함하여 사용될 수있다. 또한, 염색질 면역 침전 분석은 히스톤 마크 또는 E2F 표적 유전자에 결합 단백질 염색질의 관계를 평가하기 위해 사용될 수있다.

하나는 마커에 대한 이질성 이러한 마커 노화 세포에서만 발현되지 않는다는 사실을 포함하여, 노화의 특성에 대한 다양한 제한이 있다는 것을 알고 있어야합니다. 다수의 (일반적으로 1 - 2 3) 마커는 설명을 생략 마커를 포함하여 노화를 평가하기 위해 사용한다. 예를 들면, DNA-흉터 텔로미어손상 및 / 또는 DNA 손상 신호는 정량화 될 수있다. 또한, 노화 및, 특히, SASP 표현형 같이, 최근 노화 11, 12, 13 유도 특정 스트레스 나 손상 영향을받는 것으로 밝혀졌다, 각 실험 패러다임에서 여러 마커를 평가하는 것이 중요하다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자가 공개하는 게 없다.

Acknowledgments

이 연구는 국립 보건원 (National Institutes of Health)의 교내 연구 프로그램, 노화에 국립 연구소에 의해 지원되었다. 저자는 또한 비판적 원고를 읽기위한 노화 및 Kotb Abdelmohsen에 대해 많은 도움이 토론 미리암 고로스페 및 Kotb Abdelmohsen을 감사드립니다. 우리는 또한 비판적 원고를 읽기 위해, 특히 더글러스 Dluzen 우리의 실험실 구성원 감사합니다.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
기술은 유도 및 정량화 세포 노화하기
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter