Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Teknikker for å indusere og kvantifisere Cellular Senescence

doi: 10.3791/55533 Published: May 1, 2017

Summary

Cellular senescens, den irreversible tilstand av cellesyklus-stans, kan induseres ved hjelp av forskjellige cellespenninger. Her beskriver vi protokollene for å indusere celle alderdom og metoder for å vurdere markører for begynnende alderdom.

Abstract

Som svar på cellulært stress eller skade, kan prolifererende celler induserer et bestemt program som starter en tilstand av langvarig celle-syklus arrest, kalt mobilnettet senescence. Akkumulering av aldrende celler som oppstår med organisme aldring og gjennom kontinuerlig dyrking in vitro. Aldrende celler påvirke mange biologiske prosesser, inkludert embryonisk utvikling, vevsreparasjon og regenerering, som svulsthemmer, og aldring. Kjennetegnene ved senescent celler omfatter, men er ikke begrenset til, øket begynnende alderdom-assosiert β-galaktosidase-aktivitet (SA-β-gal); p16 INK4A, p53 og p21 nivåer; høyere nivåer av DNA-skade, inkludert γ-H2AX; dannelsen av Senescence-assosiert Heterokromatin Foci (SAHF); og anskaffelse av en Senescence-assosiert Sekretorisk Fenotype (SASP), et fenomen karakterisert ved sekresjon av et antall av pro-inflammatoriske cytokiner og signaliseringsmolekyler. Her beskriver vi protokollene for både replicative ogDNA-skade indusert cellealdring i dyrkede celler. I tillegg har vi fremheve teknikker for å overvåke senescent fenotypen ved hjelp av flere aldrings-assosierte markører, inkludert SA-β-gal, γ-H2AX og SAHF flekker, og for å kvantifisere protein og mRNA-nivåer av cellesyklus regulatorer og SASP faktorer. Disse metodene kan brukes til vurdering av cellealdring i ulike modeller og vev.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Over et halvt århundre siden, Hayflick og kolleger beskrev hvordan untransformed celler sprer i kultur, men for bare en begrenset periode 1. Langsiktig dyrking av humane fibroblaster forårsaket cellene for å stoppe voksende; men de var metabolsk aktiv, og dette ble kalt mobilnettet senescence. Senescens kan være fordelaktig for å hemme tumorgenese, men det kan også være skadelig, da det er antatt å bidra til tap av evne til reproduksjon som oppstår med aldring 2, 3. Senescent-celler er vist å akkumuleres i vev som mennesker alder 4 og har vært implisert i et utall biologiske prosesser, inkludert embryonisk utvikling, leging av sår, vevsreparasjon, og aldersrelatert inflammasjon 2.

Kontinuerlig passering av celler i kultur induserer replikative senescens, som har vært knyttettil telomerer avgang og genomisk ustabilitet. Forskjellige cellespenninger, inkludert DNA-skade og onkogener, kan også føre til begynnende alderdom 3. Senescens forårsaket av andre enn telomere slitasjefaktorene er ofte kalt stress-fremkalt eller viser for tidlig senescens og avhenger generelt av p16 INK4A / Rb sti 5. Selv om formerende, ikke-transformerte celler vanligvis vises spindel i formen, kan aldrende celler bli identifisert som å ha visse egenskaper, herunder en flat, stort morfologi og øket begynnende alderdom-assosiert β-galaktosidase-aktivitet (SA-β-gal) (figurene 1 og 2). Aldrende celler også samle opp DNA-skade-markører, inkludert γ-H2AX (figur 3) til 6, og eventuelt begynnende alderdom-assosiert heterochromatin foci (SAHF) (figur 4) 7. Aldrende celler har høyere nivåer av cellesyklusregulerende midler, inkludert p- 16 (p16 INK4A) og / eller p21 og p53 (figur 5) 8, 9. Dessuten har nyere data vist at aldrende celler kan ha ikke-autonome effekter ved å skille et antall av pro-inflammatoriske cytokiner og kjemokiner som kalles den begynnende alderdom-assosiert sekretorisk fenotype (SASP) 10. Selv om dette fenomen SASP kan variere fra celletype til celletype, generelt, er det vist ved en økning i Interleukin-6 (IL-6), IL-8, granulocytt-makrofag-kolonistimulerende faktor (GM-CSF), vekst- regulert onkogen α (GRO-α), og GRO-β, blant andre (figur 6). Den spesielle stress eller skade som induserer senescens kan også påvirke sekretorisk fenotype 11, 12, 13. SASP kan påvises ved å måle nivåene av utskilte proteiner ved anvendelse av ELISA-er eller cytokin / protein-arrayers = "ekstern referanse"> 10, 14. Selv om post-transkripsjonelle mekanismer kan regulere SASP proteinnivåene 11, 15, 16, 17, endringer i mRNA-nivåer kan også bli detektert i mange tilfeller. Disse endringene er generelt mer sensitiv og lettere å kvantifisere protein enn nivåmålinger. Andre senescent markører kan også bli vurdert, inkludert vedvarende DNA-skade foci, som kalles DNA-segmenter med kromatin endringer armerings senescens (DNA-SCARS) 18, og forskjellige andre markører 3, 19, 20.

Her beskriver vi vanlige teknikkene for indusering av cellealdring på celler i kultur, og også for å måle flere markører av senescens, inkludert SA-β-Gal, γ-H2AX, SAHF, og protein og mRNA fra senescence-assosierte molekyler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Inducing replikativ Senescence

  1. Tine lav-passasje humane diploide fibroblaster (f.eks, WI-38 og IMR-90) eller andre cellelinjer.
    MERK: Her er humane diploide fibroblaster ble anvendt, men disse protokollene kan bli anvendt for å vurdere cellealdring på andre celletyper, slik som endotel, epitel, eller stamceller. Dyrkingsbetingelsene kan bli optimalisert for forskjellige celletyper som brukes på grunn av forskjellige vekstrater eller vekstbetingelser.
    MERK: Cellene må være prolifererende og har en spindel morfologi (se figur 1 for en skjematisk, og figur 2 for eksempler). Ideelt sett bør cellene ha en populasjons-fordoblingsgrad (PDL) på <30 ved starten av eksperimentene for å unngå å ha mulige replikative aldrende celler.
    1. Beregn PDL av cellene ved anvendelse av følgende ligning PDL = log (N f / N 0) / log2, hvor N f er den endelige cellenummer og <em> N 0 er den opprinnelige antall utsådde celler 21.
  2. Kultur WI-38-celler i Dulbeccos modifiserte Eagle Medium (DMEM) supplert med 10% føtalt bovint serum (FBS), 1% ikke-essensielle aminosyrer og 1% penicillin / streptomycin.
  3. Grow IMR-90-celler i DMEM supplert med 10% FBS og 1% penicillin / streptomycin.
  4. Dyrke alle celler ved 37 ° C og 5% CO 2. Kontinuerlig dyrke cellene og splitte hver 2 - 4 d når cellene når -70 - 80% konfluens. Overvåk celle samløpet ved hjelp av et lysmikroskop. Unngå celler med høyere konfluens, da dette kan påvirke cellevekst på grunn av kontakt-inhibering.
  5. Overvåke cellene under et lysmikroskop for Morfologisk utseende av aldrende celler (se figurene 1 og 2) og for når det ikke er noen forandring i PDL fra en subkultur til den neste.

2. DNA-skade-indusert Senescence

    (f.eks, WI-38, IMR-90, eller en annen celletype) ved en sparsom tetthet (dvs. ~ 300.000 celler / 6 cm skål) i en passende skål for den type analyse (dvs. en 6 cm skål for protein / RNA markører eller en 6-brønners skål for SA-β-gal-farging). Bruk tidlig passasje celler som er ung og prolifererende (<30 PDL) og plate dem slik at cellene er omtrent 50 - 60% konfluente neste dag.
  1. Fjern vekstmediet ved hjelp av en glasspipette forbundet med en vakuum og vaske cellene ved tilsetning av 1 x fosfatbufret saltvann (PBS). Gjenta dette trinnet for totalt to vasker. Legg et tynt lag av PBS (~ 750 ul for en 6 cm skål) for både en "mock" behandles, og for en ioniserende stråling (IR) behandlet tilstand.
  2. Bruke en gammastråle å eksponere cellene til en enkelt dose av 10 grå (Gy) IR; Dette er en typisk eksponering for de fleste cellelinjer. I en hette, fjerne PBS og erstatte den med vekstmedium. Alternativt kan behandle cellene med bleomycin ved 20 ug / ml i 2 timer.
  3. Endre medium på cellene hver 48 -7 2 ​​timer og dele celler hvis nødvendig.
  4. Overvåke cellene under et lysmikroskop for morfologiske endringer (se figur 1 for en skjematisk, og figur 2 for representative celle bilder) og assay for senescent markører 7-10 d etter IR-behandling.
    MERK: Denne protokollen beskriver senescens indusert ved hjelp av IR. Senescens kan også være forårsaket av andre påkjenninger, blant annet bleomycin (se ovenfor for betingelser), H 2 O 2 22, 23, kjemoterapeutiske medikamenter 24, sigarettrøyk 25, transformerende vekstfaktor (TGF) -β1 26, 27, og andre metoder 21 , 28, 29.

3. Farging Cells for Senescence-assosiert β-galaktosidase

  1. Før farging undersøke cellene under et lysmikroskop for å overvåke morfologiske endringer.
    MERK: aldrende celler er typisk forstørret og flate, i motsetning til prolifererende celler, som har en spindel morfologi (se figur 1 for en skjematisk, og figur 2 for representative resultater). Prolifererende celler, kan bli anvendt som en negativ kontroll, og celler behandlet med IR- eller en annen DNA-ødeleggende middel (se pkt 2) kan bli anvendt som positive kontroller.
  2. Kvantifisere SA-β-gal-aktivitet ved anvendelse av reagenser fra et kommersielt sett (se Materialer tabellen). Tine alle reagenser og bringe dem til romtemperatur ved oppvarming dem opp til 37 ° C.
    1. Beregne mengden av farvestoff oppløsning og fikserløsning nødvendig.
      MERK: Typisk er et 1 ml volum som er tilstrekkelig for en brønn i en 6-brønners plate. Forskjellige platestørrelser kan benyttes, men en 6-brønns plate størrelse er WELl egnet for å utføre en analyse i tre paralleller for hver tilstand. Denne tetthet gir vanligvis et tilstrekkelig antall celler pr felt for å telle uten anvendelse av et overskudd antall celler.
    2. Fortynn fargeløsning 01:10 med destillert vann.
    3. Fortynn fikserløsningen 1:10 med destillert vann.
    4. Utgjør en 20 x stamløsning av X-gal (5-brom-4-klor-3-indolyl-β-D-galaktopyranosid) i N, N-dimetylformamid (DMF, for eksempel, 20 mg X-gal i 1 mL DMF). For å maksimere bruk av settet, måle ut X-gal til den mengde som er nødvendig for hver analyse, og deretter legge til den beregnede mengde av DMF for å oppløse. Alternativt kan lagre stamløsning ved -20 ° C i en lys-beskyttet rør i en måned. Bruk bare polypropylen (opake) rør for å fortynne og lagring av X-gal-løsninger.
    5. Forbered β-gal-farging oppløsning: 930 ul av 1 x fargeløsning, 10 ul av flekker supplement A, 10 ul av flekker supplement B, og 50 ul av 20 mg / ml X-gal i DMF. Lag en mester mix avhengig av hvor mange brønner må være farget.
  3. Fjern forsiktig mediet fra cellene ved hjelp av en overføring pipette eller tilsvarende.
  4. Forsiktig vaske cellene en gang med rom-temperatur 1x PBS.
  5. Tilsett 1 ml av 1x fikseringsløsning til hver brønn og inkuber i 10 - 15 min ved RT.
  6. Fjern fiksativ løsning med en overføring pipette.
    MERK: Fikseringsoppløsning (1x) inneholder 2% formaldehyd og 0,2% glutaraldehyd og må kastes som et farlig avfall i henhold til anbefalingene fra laboratoriesikkerhets kontoret.
  7. Forsiktig vaske cellene to ganger med 1 x PBS.
  8. Fjern PBS helt og tilsett 1x β-gal-farging løsning til brønnene (1 ml / brønn av en 6-brønn plate). Dekke platen helt med aluminiumsfolie og inkuberes i 24 - 48 timer i et 37 ° C inkubator (fortrinnsvis i fravær av CO2, da dette kan senke pH i bufferen og påvirke farging).
    1. Kontroller cellene ved 24 timer for farging, og hvis flekken er for lys, inkuber i ytterligere 24 timer.
  9. Etter inkubasjonstiden, fjerner β-gal løsning og erstatte den med 1 x PBS.
    MERK: Dette trinnet fjerner noe av bakgrunnsfargen når avbildning og forhindrer også farlig søl av X-gal-løsning.
    MERK: Kast β-gal løsning riktig, i henhold til anbefalingene fra laboratoriet sikkerheten kontoret.
  10. Undersøke celler på et lysmikroskop med en tilknyttet kameraet med et 10x objektiv eller høyere; SA-β-gal-positive celler blir blå. Erverve ønsket antall bilder for forsøket. Ved å telle hvor mange prosent av SA-β-gal-positive celler, skaffe det passende antall bilder (> 5) for kvantifisering per brønn. Sikre at bildene er ikke-overlappende fra forskjellige synsfelter i hver brønn.
  11. Tell antall SA-β-gal-positive (blå) celler versus antallet av totale cellerå beregne prosent av SA-β-gal-positive celler. Telle> 100 celler pr tilstand.
    MERK: Representant Bildene kan også brukes til tall. Merk at cellen flytning er kritisk hvis telle celler, som for mange celler gjør det vanskelig å skille hver celle og for få kan ikke gi et tilstrekkelig antall celler for kvantifisering og statistikk. Bilder for tall for publisering er i den beste oppløsningen hvis lagret som TIFF-filer, selv om JPEG-filer er også egnet. Fargebilder bør være 300 dpi.

4. farving av cellene for γ-H2AX

  1. Plate cellene fra avsnitt 1 eller 2 på dekkglass i en 24-brønners plate.
  2. Den neste dag, vaske cellene med 1 x PBS. Skyll nøye, som senescent celler ikke holder seg godt til Dekk og kan lett fjernes under vask. Alternativt kan direkte fiksere cellene uten vasking.
  3. Fjern PBS og fikser cellene med nyfremstilt 3,7% formaldehyd i PBS i10 min ved RT.
  4. Fjern løsning og permeabilisere cellene med 0,2% Triton X-100 i PBS i 10 min.
  5. Fjern løsning og blokken i 5% FBS i PBS i 2 timer ved romtemperatur.
  6. Inkuber med anti-fosfo-γ H2AX (Ser139) og FITC konjugat i 5% FBS / PBS i 2 timer ved 37 ° C eller O / N ved 4 ° C. Beskytt mot lys.
  7. Vask 3 - 6 ganger med PBS ved 37 ° C i totalt 30 - 60 min.
  8. Flekken med DAPI (fortynnet 1: 15.000 i PBS) i 10 min ved RT.
  9. Vask 3x med PBS.
  10. vaskes raskt med vann for å fjerne saltene og monter dekkglass på et objektglass ved anvendelse av 3 - 5 ul av anti-bleking reagens. Alternativt kan bruke en monteringsløsning som inneholdt DAPI.
  11. La det tørke O / N og visualisere de fargede cellene på en fluoriserende eller konfokalt mikroskop ved hjelp av et 63X objektiv eller høyere.
  12. Kvantifisere γ-H2AX foci ved anvendelse av en av to metoder som beskrives nedenfor. Score for enten protokollen ved øyet ved bruk av en fluorescerende mikroskop. Ideelt ossea konfokal mikroskop. Ta Z-profiler og kondensere til ett enkelt plan for å visualisere all detekterbar foci (representative bilder for γ-H2AX farging i prolifererende og aldrende celler er vist i figur 3). Tell fokus ved øyet med bildebehandlingsprogrammer; Generelt, ~ 100 - 200 kjerner er tilstrekkelig for telling.
    1. For å kvantifisere prosentandel av celler som har γ-H2AX-positive brennpunkter, telle hver celle som har minst et fokus synlig og dividere med den totale antallet DAPI-fargede kjerner.
    2. For å kvantifisere antallet γ-H2AX brennpunkter, telle γ-H2AX foki pr celle.
      MERK: Nivåene av γ-H2AX kan variere avhengig av den spesielle stressfaktor eller skade den som induseres begynnende alderdom.

5. farge cellene for SAHF Markers

MERK: Humane senescent cellene vil ofte ha atom regioner av kondensert DNA / kromatin. I aldrende celler, disse heterochromatic regionerer antatt å hemme ekspresjonen av proliferasjon-fremmende gener, slik som E2F-familiemedlemmer. SAHF kan visualiseres ved omorganisering av DAPI; ved tilstedeværelse av heterochromatin-assosiert histongenene merker, inkludert di- og tri-metylering av Lys9 på Histon H3 (H3K9Me2 og H3K9Me3); og av kromatin-omorganisering av proteiner, omfattende HP1 heterochromatin protein 1 (HP1), HIRA (histon repressor A), og ASF1a (anti-stanse funksjon-1a) til kromatin 30. Vi har valgt å bruke et onkogen-indusert cellealdring modell (OIS) som SAHF er mer fremtredende i OIS modeller 30. IDH4 celler som prolifererer i nærvær av deksametason på grunn av tilstedeværelsen av SV40 stort T-antigen, men blir senescent etter fjerning av deksametason fra mediet 31. SAHF kan detekteres av DAPI-farging og ved farging med antistoffer mot spesifikke markører angitt ovenfor. Her beskriver vi DAPI og H3K9Me2 flekker for visualization av SAHF i celler 28.

  1. Grow IDH4 celler i DMEM supplert med 10% FBS, 1% penicillin / streptomycin, og 1 ug / ml deksametason. For å indusere cellealdring, fjerne deksametason og endre mediet, slik at det inneholder trekull-strippet FBS; etter å ha vokst for ~ 10 dager i dette nye mediet, IDH4 celler blir senescent 31.
  2. Plate IDH4 celler eller celler fra seksjonene 1 eller 2, som er beskrevet ovenfor, på dekkglass i en 24-brønners plate.
  3. Den neste dag, vaske cellene med 1 x PBS. Skyll nøye, som senescent celler ikke holder seg godt til Dekk og kan enkelt fjernes ved vask. Alternativt kan direkte feste celler uten vasking.
  4. Fjern PBS og fikser cellene med nyfremstilt 3,7% formaldehyd i PBS i 10 min ved RT.
  5. Vask cellene 3 ganger med 1 x PBS.
  6. Fjern løsning og permeabilisere cellene med 0,2% Triton X-100 i PBS i 5 min.
  7. Vask cellene med 1xPBS. Fjern PBS og blokkere glassene ved tilsetning av blokkeringsbuffer inneholdende 3% BSA (w / v) i PBS i 5 min ved RT. filtrere alltid løsninger inneholdende BSA før bruk for å fjerne partikulært materiale.
  8. Fjern blokkeringsbufferen og inkuberes cellene med primære antistoffer mot SAHF markører som for eksempel anti-H3KMe2 antistoff (figur 4, se Materialer tabellen for detaljer). Fortynn antistoffene i blokkeringsbuffer og inkubert i 1 - 2 timer ved romtemperatur.
  9. Fjern det primære antistoff-oppløsning og vaske objektglassene 3 ganger med 1% (v / v) Triton X-100 i PBS.
  10. Fortynn de sekundære antistoffer i blokkeringsbuffer (Materialer tabell) og inkuberes i 1 time ved romtemperatur. Beskytt mot lys.
  11. Vask cellene to ganger med 1 x PBS. Flekken med DAPI (fortynnet 1: 15.000 i PBS; se Materialer tabell) i 10 min ved RT.
  12. Vask Dekk 3x med 1x PBS.
    1. vaskes raskt med vann for å fjerne saltene ennd lagring av hver dekkglass på et objektglass ved anvendelse av 3 - 5 ul av anti-bleking reagens. Alternativt kan bruke en monteringsløsning som inneholdt DAPI.
    2. La tørke O / N og visualisere de fargede cellene på en fluoriserende eller konfokalt mikroskop ved hjelp av et 63X objektiv eller høyere (se Representative Resultater i figur 4). Kvantifisere SAHF som beskrevet i punkt 4.
      MERK: isotypekontroll primære antistoffer eller intet primært antistoff (dvs. sekundær alene) skal brukes som en negativ kontroll for immunofluorescensfarging.

6. Analyse Senescence-assosierte proteiner ved Immunoblotting

MERK: senescent fenotypen er kjennetegnet ved oppregulering av cellesyklusregulerende midler, inkludert p16 INK4A, p21 og p53. Denne protokollen vil beskrive kvantifisering av nivåene av disse proteiner i cellelysatene. Disse teknikkene kan brukes til å vurdere senescens indusert ved hjelp av en rekkemetoder 21, 28, 29.

  1. Indusere cellulær senescens som beskrevet i avsnitt 1 og 2, eller ved anvendelse av en annen metode 21, 28, 29. For å analysere cellealdrings markører, plate cellene i 6 cm skåler, og analyse av både protein og RNA samtidig (se avsnitt 7 for RNA-isolering instruksjoner).
  2. Fjern cellekulturmediet. Sett cellene på et brett av is.
    1. Vask cellene 2 ganger med kald 1 x PBS. Vippe skålen for å sikre at all PBS aspireres slik som å være så nøyaktig i forhold til volumene som anvendes for fremgangsmåten.
    2. Etter avsuging siste vask i PBS, tilsett 200 ul kald PBS 1x (for en 6 cm skål) til skålen. Skrap celler ved anvendelse av en celleskrape.
    3. Pipetter celle / PBS-blanding i en RNase-frie rør for RNA-isolering. Ta ca 150 &# 181; l av denne blanding, og det pipette inn i en ny slange. Denne delmengde vil bli brukt for proteinanalyse, så være sikker på å pipettere den samme mengde av hvert rør.
  3. Lyser cellene ved å tilsette 75-100 ul av modifisert 2x Laemmli prøvebuffer (60 mM Tris-HCl pH 6,8, 12,5% glycerol, 2% SDS, 5% β-merkaptoetanol (BME), og bromfenolblått; kan fremstilles som en stor batch, delt opp i porsjoner og lagret ved -20 ° C inntil bruk) eller en tilsvarende prøvebuffer.
    1. Alternativt, lysere cellene i 75 til 100 ul lysebuffer og sentrifugert ved 15000 xg i 10 min ved 4 ° C for å fjerne celleavfall. Fjern supernatanten og pipetten inn i et rent rør. En Bradford-proteinanalyse eller en tilsvarende proteinanalyse kan brukes på lysatene for å sikre lik belastning av protein.
      MERK: Protein analyser kan ikke utføres på prøver lysert i prøvebuffer.
    2. Ta ut ~ 25 mL av lysat og legge den til 15 mL av 2x prøvebuffer. Pipetter opp og gjørewn i prøvebuffer for å lysere cellene.
      MERK: Volum av lysis buffer eller bufferkretsen kan justeres avhengig av cellesammenflytning. Hvis prøven er "klissete" på grunn av atomlyser, legge til flere prøvebuffer eller PBS for å fortynne. Prøvene kan oppbevares ved -20 ° C inntil bruk.
  4. Koke prøvene i 5 min ved 95 ° C på en varmeblokk (eller tilsvarende utstyr) og last ~ 40 pl av lysert prøve i prøvebuffer på en 18% Tris-Glycin geler.
    MERK: En gradient gel (4-15%), eller en 14% Tris-Glycin geler er også tilstrekkelig for å påvise lavmolekylære proteiner. Forskjellige typer av akrylamidgeler kan også anvendes, men å sikre at slike geler og system er brukbar for detektering av lavmolekylære proteiner.
    1. Kjørt under anvendelse av 1 x rennende buffer på en konstant 100 V i 20 minutter (gjennom stacking gel) og ~ 60 minutter ved 180 V. Overvåk gelen slik at fargefronten bare renner av eller er på bunnen av gelen, slik at lavmolekylære vekt proteiner ikke run ut av gelen.
  5. Overfør akrylamidgel til en PVDF-membran (pre-fuktet med 100% metanol for å aktivere). Ved å gjøre en våt overføring, er bare en time er nødvendig for overføring (i motsetning til normal ~ 1,75 timer). Justeres tilsvarende for det aktuelle overføringssystemet; ved hjelp av pre-fargede molekylvektmarkører kan hjelpe til med å vurdere overføringseffektivitet.
  6. Vask membranen i vann. Bruk en Ponceau flekken for å overvåke for lik belastning av prøver. Vask Ponceau av med vann.
    1. Blokkere membranen i 5% fettfri tørrmelk i TBST (50 mM Tris-HCl pH 7,5, 150 mM NaCl og 0,1% Tween-20) i 1 time ved RT eller O / N ved 4 ° C under omrøring.
  7. Vask blot en gang med TBST og inkubert med primært antistoff fortynnet i 5% melk TBST (se Materialer Tabell for fortynninger og antistoff-anbefalinger) i 1 time ved romtemperatur.
  8. Utføre to raske vaskinger med TBST og vask deretter to ganger på en ryster i totalt ~ 30 min (~ 15 min hver varh).
  9. Inkuber med et sekundært antistoff i 40 minutter ved RT. Gjenta trinn 6.10.
  10. Inkuber med rykende Western blot substratet og utvikler filmen eller lese det på en kjemiluminescens-leser.
  11. Probe immunoblot med P16 INK4A antistoffer først (figur 5). Stripp membranen ved inkubering i 15 minutter med vann, 15 min med 0,2 N NaOH, og 15 minutter med vann. Fortsett med trinn 6.9 ved anvendelse av anti-p21-antistoffer.
  12. Stripp membranen ved anvendelse av 62,5 mM Tris-HCl pH 6,8 og 2% SDS med 300 pl av ferskt tilsatt BME per 50 ml strippeoppløsning.
  13. Inkuber ved 50 ° C i 30 minutter og vask grundig med TBS og deretter TBST. Sonde med anti-aktin eller GAPDH anti-antistoffer for protein-lasting kontroller (Figur 5 viser representative resultater).
    MERK: p53 nivåer kan også vurderes på samme membraner. Imidlertid, ettersom p53 er en høyere molekylvekt, er det bedre løst på en lavere prosentandel gel (f.eks

7. Analyse av mRNA-nivåer av Senescence Markers

MERK: Ved å isolere RNA, sørge for at arbeidsflatene blir rengjort med RNase løsninger for fjerning eller en tilsvarende, og at materialet er alle RNase-fritt.

  1. Ved å bruke celle / PBS-blandingen fra trinn 4.2, tilsett 1 ml av RNA-ekstraksjon løsning og virvle i 30 sek (det skal være noen synlige klumper eller cellulært avfall).
  2. Tilsett 200 ul kloroform og rystes kraftig i 15 sekunder.
  3. Sentrifuge ved maksimal hastighet (> 15.000 xg) i 15 minutter ved 4 ° C.
  4. Fjern ~ 400 ul av topp RNA vandige lag og pipettere det inn i et nytt mikrofuge-rør.
  5. Tilsett 400 ul av isopropanol (1: 1 med det totale volum av vandige laget pipetteres i det foregående trinn) og 4 pl precipitant til RNA lag.
  6. Sentrifuger i 15-30 minutter ved maksimal hastighet (> 15.000 xg) og 4 ° C for nedsentrifugering av RNA.
  7. Fjern supernatanten og tilsett 1 ml av 75% iskald etanol.
  8. Sentrifuger i 1 minutt ved maksimal hastighet (> 15.000 xg) og 4 ° C.
  9. Fjern supernatanten og sentrifuger i 1 minutt ved maksimal hastighet (> 15.000 xg) og 4 ° C.
  10. Pipetter ut så mye væske som mulig og lufttørket i 2 min.
  11. * Resuspender i 10 pl 10x DNase-buffer, 85 pl H2O, og 5 ul av en DNase.
  12. Inkuber ved 37 ° C i 30 min.
  13. Tilsett 200 ul NT2-buffer (50 mM Tris-HCl pH 7,4, 150 mM NaCl, 1 mM MgCl2, og 0,05% Nonidet P-40) og tilsett 300 ul av det nedre lag av syre fenol-CHCl 2.
  14. Vortex i 1 minutt og sentrifuge ved romtemperatur i 5 minutter ved maksimal hastighet (> 15.000 xg).
  15. Samle 250 ul av den øvre RNA lag (2 x 125 mL), tilsett 25ul av 3 M natriumacetat pH 5,2, 625 pl 100% iskald etanol, og 5 ul av fellingsmiddel. Bland godt og utfelle O / N ved -20 ° C.
  16. Den neste dag, bland og sentrifugering ved maksimal hastighet (> 15.000 xg) og 4 ° C i 30 minutter og supernatanten kastes.
  17. Gjenta trinn 06.08 til 06.11.
  18. Re-suspendere pelleten i 12 ul av nuklease-fri vann og oppbevares ved -80 ° C inntil bruk.
    MERK: Andre RNA isoleringsprosedyrer og sett kan bli anvendt i tillegg.
  19. Utføre revers transkripsjon med tilfeldige heksamerer og SSII revers transkriptase i henhold til produsentens protokoll.
    MERK: Gitt den lave mengden av RNA isolert fra aldrende celler, er det best å bruke alt av RNA (12 ul) for revers transkripsjon syntese. Alternativt kan RNA bli kvantifisert ved anvendelse av et spektrofotometer, og like mengder av RNA kan bli brukt for revers transkripsjon.
  20. Analyser mRNA-nivåer ved hjelp av sanntids-kvantitativ qPCR (RT-qPCR) amplificasjon og SYBR-grønn PCR masterblanding med genspesifikke primere.
    1. Som i en typisk RT-qPCR reaksjon Fortynn 1:30 cDNA (i RNase / DNase-fri vann) og tilsett 3 mL til sanntids-96-brønns plate for bedre nøyaktighet pipettering. Fremstill en reaksjon konsentrat-blanding av genspesifikke forover og revers primere (2,5 uM konsentrasjon, tilsett 5 mL / reaksjon), SYBR-grønn PCR-blanding (6,25 pl / reaksjon, bruker mindre enn produsentens anbefaling), og 5,75 pl RNase / DNase-fri vann til et endelig reaksjonsvolum på 20 ul (17 ul av primere / SYBR-grønn / vann og 3 mL av cDNA).
    2. Utføre RT-qPCR amplifikasjon under anvendelse av en sanntids-PCR maskinen; Følg produsentens protokoll.
      MERK: En liste over validert menneskelig forover og bakover i sanntid primere kan finnes i tabell 1. Disse genene inkluderer SASP proteiner og andre aldrings-assosierte markører og / eller gener. Representative resultater fra IR-indusert cellealdring er vist i

8. Kvantifisering SASP proteinnivåer

  1. Indusere cellealdring ved hjelp av seksjonene 1 eller 2, eller ved en annen metode. Plate cellene på enten 6 eller 10 cm plater, slik som beskrevet ovenfor (~ 250.000 celler / 6 cm skål eller ~ 650 000/10 cm skål).
  2. Enten med celler 10 d etter IR behandling eller med replikative aldrende celler (og egnede kontrollceller), vaske cellene tre ganger med 1 x PBS og legge til serumfritt medium med antibiotika i et lite volum (2,5 ml i 6 cm eller 5 mL til 10 cm).
  3. Inkuber over natten ved 37 ° C og 5% CO2 i en vevskulturinkubator. Den neste dag, samle mediet og sette det i et konisk rør på is.
  4. Vask cellene 2 ganger med PBS og deretter tilsett 1 ml trypsin (for en 6 cm skål). Tell cellene ved bruk av et hemocytometer for senere å justere konsentrasjonene i henhold til celleantall.
  5. Sentrifuger medium i 5 minutter ved 300 x g.
  6. filter det medium ved anvendelse av en 0,45 um sprøytefilter.
  7. Aliquot mediet og fryse ved -80 ° C inntil anvendelse eller analyse direkte ved hjelp av ELISA eller tilsvarende analyser.
  8. Beregn det antall celler / ml konsentrasjon ved å ta den totale celleantall / volum av medium oppsamlet.
  9. Utføre en egnet enzym-bundet immunosorbent assay (ELISA) i henhold til produsentens instruksjoner. Se tabell Materialer for anbefalte ELISA-sett for bestemmelse av IL-6, IL-8, GROa, og andre cytokiner / chemokiner (Figur 6B).
  10. For å sikre at de forhold som måles ligger innenfor det lineære området av ELISA-kit, gjør fortynninger av senescent cellemediet i forhold til prolifererende cellemediet. Konto til disse fortynninger og volumet ved beregning av mengden av IL-6. For å skaffe seg mengden av IL-6 utskilt per celle per dag, beregne IL-6 verdi som oppnås fra settet (i pg) pr fortynnet cellekonsentrasjon pr ml (from trinn 7.8).
    MERK: Andre metoder, så som cytokin-matriser, kan brukes til å detektere SASP protein-nivå, og kan være egnet for screening av et stort antall av SASP faktorer. Protein nivåene av SASP faktorer kan variere avhengig av tiden etter senescence induksjon, celletypen eller typen av aldringsprosessen indusert.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Figurene 2 - 6 viser representative resultater fra SA-β-gal-farging; farging for γ-H2AX og SAHF; Vurderingen av protein nivåer av p16 INK4A, p21 og p53; og mRNA og proteinnivåene av senescent-assosierte molekyler. Økt SA-β-gal-farving forekommer med replikativ og DNA-skade indusert cellealdring. Også observere de morfologiske endringene som skjer med begynnende alderdom. Celler blir forstørret og flat i forhold til spindelen utseende prolifererende fibroblaster. For denne eksperimentelle paradigmet, ble cellene farget og RNA / protein ble isolert 7 dager etter IR-eksponering. Mer robuste resultater kan oppstå ved å vente lengre tid etter eksponering IR (dvs. 10 d). Forhold som må bestemmes for hver tilstand og eksperimentelle oppsett. Disse resultatene er representative, og disse markører kan også påvises ved begynnende alderdom blir indusert ved hjelp av andre metoder.

figur 6, er gennavn oppført og tilsvarer CXCL1 (GROa), CXCL2 (GROp), og CSF2 (GM-CSF). Oppregulering av mRNA-nivåer av noen, men ikke alle, av SASP faktorene ble observert etter IR-indusert cellealdring i WI-38-celler. Andre aldrings-assosiert mRNA-er, inkludert CDKN1A (koder for p21) og CDKN2A (koder for p16 INK4A), ble oppregulert. Andre mRNA-er (EDN1 og ANKRD1) er også inkludert, og har tidligere blitt vist å være høyere hos aldrende celler 15. Primere er oppført i tabell 1.

Figur 1
Figur 1: prolifererende og senescent fibroblaster. En skjematisk representasjon av prolifererende (til venstre) og senescent (høyre) fibroblaster. Eksempler på aldrings induktorer er vist i den derellow boksen. Senescens er assosiert med høyere nivåer av de angitte markører. SA-β-gal, begynnende alderdom-assosiert β-galaktosidase-aktivitet; SASP, begynnende alderdom-assosiert sekretorisk fenotype; SAHF, begynnende alderdom-assosiert heterochromatin foci; DDR, DNA-skade respons. Klikk her for å se en større versjon av dette tallet

Figur 2
Figur 2. Morfologiske egenskaper og øket SA-β-gal aktivitet av aldrende celler. WI-38-celler, celledelende, enten "små" (PDL 27), replikative senescent (PDL 40), eller de som utsettes for ioniserende stråling (IR), ble farget for SA-β-gal aktivitet. IMR-90-celler, enten prolifererende "små" (PDL 30), replikative senescent (PDL 52), eller de som utsettes for ioniserende stråling (IR), var stastilt seg for SA-β-gal aktivitet. Seksjoner 1 - 2 beskriver induserende replikativ og DNA-skade indusert cellealdring, og avsnitt 3 forklarer farging for SA-β-gal. Celler ble farget 7 d etter IR. Con, kontroll. Skala bar = 50 um. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. Økt γ-H2AX Foci i aldrende celler. WI-38-celler, enten prolifererende "små" (PDL 30) eller replikative senescent (PDL 53), ble fiksert og farget med anti-y-H2AX antistoffer og DAPI. Legg merke til økningen i antall γ-H2AX foci i senescent celler. Bilder ble innhentet på en konfokal mikroskop. Z-snitt ble tatt, og den maksimale intensitet projeksjon ble anvendt for å oppnå et enkelt plan bilde for å visualisere alle søyledetektorenbord foci. Skala bar = 20 mikrometer. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. fluorescensfarging av SAHF i aldrende celler. (A) prolifererende WI-38-celler (PDL-27) var ubehandlet eller utsettes for ioniserende stråling (IR). Etter 10 dager ble cellene farget med DAPI å visualisere SAHF (merk tett / punktformet DAPI farging i IR-behandlede celler) (B) IDH4 ble dyrket i nærvær av deksametason (prolifererende) eller på trekull-strippet FBS for å indusere cellealdring ( senescent). Etter 10 d, ble cellene farget med antistoffer mot H3K9Me2 og DAPI. Bilder ble innhentet på en konfokal mikroskop. Z-snitt ble tatt, og den maksimale intensitet projeksjon ble brukt for å oppnå en enkelt-planbilde. Prolifererende celler i (A) og (B) har diffus DAPI flekker, mens aldrende celler har punktvis DAPI farging. I (B), kontrollcellene har diffuse, meget lett farging for H3K9Me2, mens H3K9Me2 farging er mer robust og colocalizes med DAPI-beiset foci i aldrende celler. Skala bar = 20 mikrometer. Klikk her for å se en større versjon av dette tallet.

Figur 5
Figur 5. Kvantifisering av Senescence-assosierte proteiner. Protein ble isolert fra enten prolifererende "små" (PDL 30) IMR-90-celler (-) eller IMR-90-celler som ble utsatt for 10 Gy av ioniserende stråling (IR). Mediet ble skiftet hver 48 timer, og cellene ble lysert 7 d etter IR. Prøvene ble analysert ved SDS-PAGE, immunblottet med anti-p16 INK4A Antibodør, og re-probet med anti-p21 og deretter anti-p53-antistoffer. GAPDH ble brukt som en proteinmengde kontroll. Klikk her for å se en større versjon av dette tallet.

Figur 6
Figur 6. Kvantifisering av Senescence-assosierte mRNAer og SASP proteiner. (A) RNA ble isolert fra enten prolifererende "små" (PDL 27 eller 34) WI-38-celler (-) eller WI-38-celler som var utsatt for 10 Gy av ioniserende stråling (IR). Mediet ble skiftet hver 48 timer og RNA isolasjon ble utført 7 dager etter IR. RT-qPCR ble benyttet for å kvantifisere nivåene av de angitte aldrings-assosierte mRNA-er ved hjelp av genspesifikke primere er oppført i tabell 1. 18S nivåer ble brukt for normalisering. Histogrammene representerer gjennomsnittet normalisert to ubehandlet ± SEM fra 5 uavhengige forsøk. (B) WI-38-celler (PDL) 26 ble utsatt for 10 Gy av IR; 10 d senere ble mediet endret til serumfritt medium (se avsnitt 7). Etter 24 timer ble kondisjonert medium oppsamlet og IL-6, IL-8, GROa og nivåer ble kvantifisert ved hjelp av ELISA-analyser. Histogrammet representerer gjennomsnittet ± SEM fra 3 eksperimenter. * P <0,05 og *** p <0,001 ved Student t-test. Klikk her for å se en større versjon av dette tallet.

menneskelige Primere Framover Omvendt
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (P21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL-8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabell 1: RT-qPCR primere for Senescence-assosierte mRNA'er. Forover og revers primere for RT-qPCR anvendelse av SYBR-grønn-teknologi er angitt.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Her har vi beskrevet fremgangsmåter for replikativ og DNA-skade indusert cellealdring med humane diploide fibroblaster. I tillegg er teknikker for kvantifisering av protein og mRNA-nivåer av forskjellige aldrings-assosierte proteiner inkludert, i tillegg til farging for SA-β-gal og for DNA-skade markør γ-H2AX. Disse protokollene kan bli mye brukt til å vurdere senescent fenotyper både in vitro og in vivo, selv om mange begrensninger eksisterer for å karakterisere senescens in vivo 20. Andre celler kan uttrykke aldrende markører, selv om de ikke er aldrende celler. For eksempel kan celler som osteoklaster og makrofager har høyere nivåer av β-gal aktivitet 32, 33. I tillegg har mange kreftceller oppregulert p16 INK4A 34. Celler kan også samle opp DNA-skade (f.eks γ-H2AX foci) og ikke være senescent. SASP faktorer kan også bli oppregulert etterforskjellige normale fysiologiske eller patologiske tilstander som kan eller ikke kan omfatte aldrende celler. Derfor bør flere aldrings markører benyttes, særlig ved vurdering av senescens in vivo.

Selv aldrende celler ble funnet økt i normal aldring vev mer enn 20 år siden fire, er det først nå at vi er fullt ut verdsette mangfold av roller som senescent celler spiller i både normalt vev homeostase og patologiske tilstander. Den senere tids anvendelse av musemodeller for å eliminere p16 INK4A-positive celler senescent har tillatt forskere til mer klart og presist setter rollen til aldrende celler i vev og organer 35, 36, 37. Disse modellene har avdekket at aldrende celler bidrar til et mangfold av aldersrelaterte sykdommer, tumorigenesis, og mus levetid 35 </ sup>, 36, 37. Gitt disse siste funn og validering av viktigheten av aldrende celler i fysiologi, er tiden moden for mer forskning på disse spesifikke celler. For eksempel, studier som anvender strategier for å fjerne terapeutisk aldrende celler eller for å forsinke begynnende alderdom kan være fordelaktig for både healthspan og levetidsstudier.

Nylig har vårt laboratorium funnet at metformin, et medikament som vanligvis brukes for å behandle type 2 diabetes mellitus, synker celle senescens 38. Som metformin for tiden blir foreslått som en anti-aldring terapi og har anti-cancer-egenskaper 39 og 40, vil det være interessant i fremtiden for å utforske hvorvidt dette stoffet, eller andre aldrende inngrep, påvirke helseeffekter ved modulering av cellulær senescens.

Protokollene vi diskuterer her er vanlige og vidt enccepted teknikker for å bedømme senescent fenotype. For celler dyrket in vitro, er det viktig å overvåke celle endringer fra en spindel lignende til en avflatet morfologi for å sikre at cellene er senescent (Se figur 1 og 2). Dersom cellene ikke er positive for SA-β-gal eller andre markører som er beskrevet her, vurdere begynnende alderdom ved høyere cellesidebeskrivelsesspråk (for replikativ senescens) eller ved en øket tid etter DNA-skade indusert cellealdring. I tillegg kan disse protokollene må være optimalisert for forskjellige celletyper. For vurdering av SASP proteinnivåer, er det viktig å fjerne serumet fra cellemediet, da dette vil føre til høye bakgrunnsnivåer i ELISA eller protein matriser. Derfor, ha dette i bakhodet når du utformer eksperimenter, som det ikke kan være ideell for samtidig å vurdere flere markører.

Farging for SA-β-gal, som beskrevet her, er begrenset av det faktum at den krever fiksering av cellene.I tillegg er celle konfluens blitt vist å påvirke SA-β-gal aktivitet. Protokoller er blitt utviklet for å vurdere SA-β-Gal-aktivitet ved anvendelse av et fluorogent substrat for β-gal-aktivitet, noe som gjør det mulig for kvantifisering av denne markør i levende celler ved hjelp av strømningscytometri 41, 42, 43. SA-β-gal-aktivitet kan også måles i cellelysater under anvendelse av en kjemiluminescerende metode 44. I tillegg kan γ-H2AX også bli målt ved å bruke forskjellige andre fremgangsmåter, inklusive flowcytometri eller immunoblotting av cellelysater 45.

Det bør bemerkes at SAHF formasjonen er cellelinje avhengig og er for det meste forbundet med onkogen-indusert cellealdring 20, 30, 46. Derfor SAHF kan ikke være til stede i alle aldrings modeller. Nytten avSAHF som en senescent markør i musemodeller kan også være begrenset av det faktum at SAHF generelt ikke observert i mus aldrende celler 30, 46, 47. Her ble antistoffer mot H3K9Me2 anvendt, men andre molekylære markører for SAHF kan anvendes, inkluderende macroH2A, høy mobilitet gruppe A (hmga) proteiner, og tri-metylert lysin 9 histon H3 (H3K9Me3) og bundne proteiner HP1. I tillegg kan kromatin immunoutfellings-analysene brukes til å vurdere histongenene merker eller foreningen av kromatin bindende proteiner til E2F målgener.

Man bør være klar over at det er ulike begrensninger for karakter senescence, inkludert heterogenitet for markører og det faktum at disse markørene ikke er uttrykt utelukkende i senescent celler. Flere (generelt 2 - 3) markører bør benyttes for å vurdere cellealdring, herunder markører ikke beskrives her. For eksempel, DNA-arr, telomereskade, og / eller DNA-skade signalering kan også kvantifiseres. Videre, som begynnende alderdom og, i særdeleshet, den SASP fenotype, er nylig blitt vist å være påvirket av den spesielle stressfaktor eller skade som induserer cellealdring 11, 12, 13, er det viktig å vurdere flere markører i hver forsøks paradigme.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noe å avsløre.

Acknowledgments

Denne studien ble støttet av egenutført Research Program av National Institutes of Health, National Institute on Aging. Forfatterne ønsker å takke Myriam Gorospe og Kotb Abdelmohsen for mange nyttige diskusjoner om alderdom og Kotb Abdelmohsen for også kritisk lesing av manuskriptet. Vi takker også våre laboratorie medlemmer, spesielt Douglas Dluzen for kritisk lesing av manuskriptet.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Teknikker for å indusere og kvantifisere Cellular Senescence
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter