Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biology

Tekniker för att inducera och kvantifiera cellulärt åldrande

doi: 10.3791/55533 Published: May 1, 2017

Summary

Cellulärt åldrande, den irreversibla tillstånd av cellcykelstopp, kan induceras genom olika cellulära påkänningar. Här beskriver vi protokoll för att framkalla cellulärt åldrande och metoder för att bedöma markörer för åldrande.

Abstract

Som svar på cellulär stress eller skada, kan prolifererande celler inducerar ett specifikt program som initierar ett tillstånd av långsiktig cellcykelstopp, benämnd cellulärt åldrande. Ackumulering av åldrande celler inträffar med organism åldrande och genom ständig odling in vitro. Åldrande celler påverkar många biologiska processer, inklusive embryoutveckling, vävnad reparation och förnyelse, tumörundertryckning, och åldrande. Kännetecken åldrande celler innefattar, men är inte begränsade till, ökad senescens-associerade β-galaktosidasaktivitet (SA-β-gal); p16 INK4a, p53, och p21-nivåer; högre nivåer av DNA-skada, inklusive γ-H2AX; bildandet av Åldrande-associerad heterochromatin Foci (SAHF); och förvärvet av en Åldrande associerat Sekretorisk Fenotyp (SASP), ett fenomen som kännetecknas av utsöndring av ett antal pro-inflammatoriska cytokiner och signalmolekyler. Här beskriver vi protokoll för både replika ochDNA-skada-inducerad senescens i odlade celler. Dessutom belyser vi tekniker för att övervaka senescent fenotypen med användning av flera hudåldrande-associerade markörer, inklusive SA-β-gal, γ-H2AX och SAHF färgning, och för att kvantifiera protein och mRNA-nivåer av cellcykelregulatorer och SASP faktorer. Dessa metoder kan tillämpas vid bedömningen av åldrande i olika modeller och vävnader.

Introduction

Mer än ett halvt sekel sedan, Hayflick och kollegor beskrev hur otransformerade celler förökar sig i kultur, men för bara en begränsad tid en. Långsiktig odling av humana fibroblaster orsakade cellerna att stoppa prolifererande; men de var metaboliskt aktiva, och detta kallades cellulärt åldrande. Senescens kan vara fördelaktigt för att hämma tumörgenes, men det kan också vara skadligt, eftersom det är tänkt att bidra till förlust av regenerativ kapacitet som uppstår med åldrandet 2, 3. Åldrande celler har visat sig ackumuleras i vävnader som människor ålder 4 och har varit inblandade i ett antal biologiska processer, inklusive embryoutveckling, sårläkning, vävnadsreparation, och åldersrelaterad inflammation 2.

Kontinuerlig passage av celler i kultur inducerar replikativ senescens, vilket har kopplatsatt telomer attrition och genomisk instabilitet. Olika cellspänningar, inklusive DNA-skador och onkogener, kan också orsaka senescens 3. Senescens orsakas av andra än telomer attrition faktorer kallas ofta stressinducerad eller för tidig senescens och i allmänhet beror på p16 INK4a / Rb-vägen 5. Fastän prolifererande, otransformerade celler visas normalt spindel i form, kan åldrande celler identifieras såsom att ha vissa egenskaper, innefattande en platt, stor morfologi och ökade senescens-associerade β-galaktosidasaktivitet (SA-β-gal) (figurerna 1 och 2). Åldrande celler ackumuleras även DNA skada markörer, inklusive γ-H2AX (figur 3) 6, och, potentiellt, senescens-associerade heterokromatin foci (SAHF) (Figur 4) 7. Åldrande celler har högre nivåer av cellcykelregulatorer, inklusive p 16 (p16 INK4a) och / eller p21 och p53 (fig 5) 8, 9. Dessutom har nya data visat att åldrande celler kan ha icke-autonoma effekter genom att utsöndra ett antal pro-inflammatoriska cytokiner och kemokiner som kallas senescens-associerade sekretorisk fenotyp (SASP) 10. Även om denna SASP fenomen kan variera från celltyp till celltyp, i allmänhet är det visas genom en ökning av interleukin-6 (IL-6), IL-8, granulocyt-makrofag kolonistimulerande faktor (GM-CSF), tillväxt- reglerad onkogen α (GRO-α) och GRO-β, bland andra (Figur 6). Den speciella stress eller skada som inducerar senescens kan också påverka den sekretoriska fenotypen 11, 12, 13. SASP kan detekteras genom att mäta nivåerna av utsöndrade proteiner med användning av ELISA eller cytokin / proteinchips = "xref"> 10, 14. Även om post-transkriptionella mekanismer kan reglera SASP proteinnivåer 11, 15, 16, 17, förändringar i mRNA-nivåer kan också detekteras i många fall. Dessa förändringar är i allmänhet känsligare och lättare att kvantifiera än mätningar proteinnivå. Andra åldrande markörer kan också bedömas, inklusive ihållande DNA-skada nukleärt foci, som kallas DNA-segment med kromatin förändringar armerings senescens (DNA-SCARS) 18, och diverse andra markörer 3, 19, 20.

Här beskriver vi vanliga tekniker för att inducera senescens i celler i odling och även för mätning av flera markörer för åldrande, inklusive SA-β-Gal, γ-H2AX, SAHF, och proteinet och mRNA av åldrasiou-associerade molekyler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Induktion replikativt åldrande

  1. Tö låg-passage humana diploida fibroblaster (t ex WI-38 och IMR-90) eller andra cellinjer.
    OBS: Här var humana diploida fibroblaster används, men dessa protokoll kan användas för att bedöma åldrande i andra celltyper, såsom endotelceller, epitelceller eller mesenkymala stamceller. Odlingsbetingelser kan optimeras för olika celltyper som används på grund av olika tillväxttakt eller odlingsbetingelser.
    OBS: Celler bör vara prolifererande och har en spindel morfologi (se figur 1 för en schematisk och figur 2 för exempel). Helst bör cellerna har en populationsfördubblingstid Level (PDL) av <30 vid början av experiment för att undvika att ha eventuella replikativa åldrande celler.
    1. Beräkna PDL av cellerna med användning av följande ekvation PDL = log (N f / N 0) / log2, där N f är den slutliga antalet celler och <em> N 0 är det initiala antalet sådda celler 21.
  2. Kultur WI-38-celler i Dulbeccos modifierade Eagle-medium (DMEM) kompletterat med 10% fetalt bovint serum (FBS), 1% icke-essentiella aminosyror, och en% penicillin / streptomycin.
  3. Växa IMR-90-celler i DMEM kompletterat med 10% FBS och 1% penicillin / streptomycin.
  4. Växa alla celler vid 37 ° C och 5% CO 2. Kontinuerligt odla cellerna och dela var 2 - 4 d när cellerna når ~ 70-80% konfluens. Övervakning av cellsammanflytning med användning av ett ljusmikroskop. Undvika celler med högre konfluens, eftersom detta kan påverka celltillväxt på grund av kontakt-inhibering.
  5. Övervaka cellerna under ett ljusmikroskop med avseende på morfologiska utseendet hos åldrande celler (se figurerna 1 och 2), och för, när det inte finns någon förändring i PDL från en subkultur till nästa.

2. DNA-skador inducerad Åldrande

    (t.ex., WI-38, IMR-90, eller en annan celltyp) vid en gles densitet (dvs ~ 300.000 celler / 6 cm skål) i ett lämpligt skålen för den typ av analys (dvs en 6 cm platta för protein / RNA-markörer eller en 6-hålsplatta för SA-β-gal-färgning). Använda tidig-passage-celler som är unga och prolifererande (<30 PDL) och plattan dem så att cellerna är ca 50 - 60% sammanflytande på nästa dag.
  1. Avlägsna tillväxtmediet med användning av en glaspipett ansluten till ett vakuum och tvätta cellerna genom tillsats av 1 x fosfatbuffrad saltlösning (PBS). Upprepa detta steg för totalt två tvättar. Lägga ett tunt lager av PBS (~ 750 mikroliter för en 6 cm platta) för både en "mock" behandlade och för en joniserande strålning (IR) behandlade tillståndet.
  2. Använda en gammabestrålare för att exponera cellerna för en enda dos av 10 Gray (Gy) av IR; Detta är en typisk exponering för de flesta cellinjer. I en huva, ta bort PBS och ersätta det med odlingsmedium. Alternativt behandla cellerna med bleomycin vid 20 | ig / ml för 2 h.
  3. Ändra mediet på cellerna var 48 -7 2 ​​timmar och dela cellerna vid behov.
  4. Övervaka cellerna under ett ljusmikroskop för morfologiska förändringar (se figur 1 för en schematisk och figur 2 för representativa cellbilder) och analys med avseende på åldrande markörer 7-10 d efter IR-behandling.
    OBS: Detta protokoll beskriver åldrande induceras av IR. Senescens kan också induceras av andra påkänningar, inbegripet bleomycin (se ovan för villkor), H 2 O 2 22, 23, kemoterapeutiska läkemedel 24, cigarettrök 25, transformerande tillväxtfaktor (TGF) -β1 26, 27, och andra metoder 21 , 28, 29.

3. Färgning Cells för Åldrande-associerad β-galaktosidas

  1. Före färgning, undersöka cellerna under ett ljusmikroskop för att övervaka de morfologiska förändringar.
    NOT: åldrande celler är typiskt förstorad och platt, till skillnad från prolifererande celler, som har en spindel morfologi (Se figur 1 för en schematisk och figur 2 för representativa resultat). Prolifererande celler kan användas som en negativ kontroll, och celler behandlade med IR eller ett annat DNA-skadande medel (se avsnitt 2) kan användas som positiva kontroller.
  2. Kvantifiera SA-β-gal-aktivitet med användning av reagens från ett kommersiellt kit (se Material tabell). Tina alla reagens och föra dem till rumstemperatur genom att värma upp dem till 37 ° C.
    1. Beräkna mängden färglösningen och fixeringslösning nödvändig.
      OBS: Typiskt är tillräckligt för en väl en 1 ml volym i en 6-brunnsplatta. Olika plattstorlekar kan användas, men en 6-brunnsplatta storleken är well lämpade för att utföra en analys i triplikat för varje tillstånd. Denna densitet ger vanligtvis ett tillräckligt antal celler per fält för att räkna, utan att använda ett överskott antal celler.
    2. Späd färgningslösningen 1:10 med destillerat vatten.
    3. Späda ut fixeringslösning 1:10 med destillerat vatten.
    4. Göra upp en 20x förrådslösning av X-gal (5-brom-4-klor-3-indolyl-β-D-galaktopyranosid) i N, N-dimetylformamid (DMF; t ex 20 mg X-gal i en ml DMF). Att maximera användningen av kitet, mäta ut X-gal till den mängd som behövs för varje analys och sedan lägga den beräknade mängden DMF för att lösas upp. Alternativt lagra förrådslösningen vid -20 ° C i ett ljusskyddat rör under en månad. Endast använda polypropen (opaka) rör för utspädning och lagring av X-gal-lösningar.
    5. Förbereda β-gal-färgningslösning: 930 mikroliter av 1x färgningslösning, 10 ul färgnings tillägg A, 10 mikroliter av färgning supplement B, och 50 mikroliter av 20 mg / ml xgal i DMF. Gör en huvudblandning beroende på hur många brunnar måste färgas.
  3. Försiktigt bort mediet från cellerna med användning av en pipett eller motsvarande.
  4. tvätta försiktigt cellerna en gång med rumstemperatur 1x PBS.
  5. Lägg 1 mL 1x fixeringslösning till varje brunn och inkubera under 10 - 15 min vid RT.
  6. Ta bort fixeringslösning med en överföringspipett.
    OBS: fixeringslösning (1 x) innehåller 2% formaldehyd och 0,2% glutaraldehyd och bör tas om hand som farligt avfall i enlighet med rekommendationerna från laboratoriesäkerhet kontoret.
  7. tvätta försiktigt cellerna två gånger med 1 x PBS.
  8. Avlägsna PBS helt och lägga 1x β-gal-färgningslösning till brunnarna (1 ml / brunn av en 6-brunnars platta). Täck plattan fullständigt med aluminiumfolie och inkubera under 24 - 48 timmar i en 37 ° C inkubator (företrädesvis i frånvaro av CO 2, eftersom detta kan sänka pH i bufferten och påverka färgning).
    1. Kontrollera cellerna vid 24 timmar för färgning, och om fläcken är för ljus, inkubera i ytterligare 24 timmar.
  9. Efter inkubationstiden, ta bort β-gal-lösningen och ersätta den med 1 x PBS.
    OBS: Detta steg tar bort en del av bakgrundsfärg när imaging och förhindrar farlig spill av X-gal-lösning.
    OBS: Kasta β-gal lösning på rätt sätt, i enlighet med rekommendationerna från laboratoriesäkerhetskontoret.
  10. Undersöka cellerna på ett ljusmikroskop med en bifogad kamera med användning av en 10x eller högre objektiv; SA-β-gal-positiva celler blir blå. Förvärva önskat antal bilder för experimentet. Om att räkna den procentuella andelen av SA-β-gal-positiva celler, förvärva motsvarande antal bilder (5>) för kvantifiering per brunn. Se till att bilderna är icke-överlappande från olika synfält inom varje brunn.
  11. Räkna antalet SA-β-gal-positiv (blå) celler kontra antalet totala celleratt beräkna den procent av SA-β-gal-positiva celler. Räkna> 100 celler per betingelse.
    OBS: Representant bilder kan också användas för siffror. Observera att cell confluency är avgörande om räkna celler, som alltför många celler gör det svårt att skilja varje cell och alltför få får inte ge ett tillräckligt antal celler för kvantifiering och statistik. Bilder för siffror för publicering finns på den bästa upplösningen om sparas som TIFF-filer, även om .jpeg-filer är också lämpliga. Färgbilder ska vara 300 dpi.

4. Färgnings Celler för γ-H2AX

  1. Plattan cellerna från avsnitt 1 eller 2 på glastäckglas i en 24-brunnsplatta.
  2. Nästa dag, tvätta cellerna med 1 x PBS. Skölj noga, eftersom åldrande celler inte fäster bra på täck och kan lätt tas bort under tvättar. Alternativt direkt fixera cellerna utan tvättning.
  3. Avlägsna PBS och fixera cellerna med nyframställd 3,7% formaldehyd i PBS under10 min vid RT.
  4. Avlägsna lösningen och permeabilisera cellerna med 0,2% Triton X-100 i PBS under 10 min.
  5. Avlägsna lösningen och blocket i 5% FBS i PBS under 2 h vid RT.
  6. Inkubera med anti-fosfo γ-H2AX (Ser139) och FITC-konjugat i 5% FBS / PBS under 2 h vid 37 ° C eller O / N vid 4 ° C. Skyddas från ljus.
  7. Tvätta 3 - 6x med PBS vid 37 ° C under totalt 30 - 60 min.
  8. Fläcken med DAPI (utspätt 1: 15.000 i PBS) under 10 min vid RT.
  9. Tvätta 3x med PBS.
  10. Snabbt tvätta med vatten för att avlägsna salterna och montera täckglas på en glasplatta med användning av 3 - 5 | il av antifade reagens. Alternativt använda en monteringslösning innehållande DAPI.
  11. Låt den torka O / N och visualisera de färgade cellerna på en fluorescerande eller konfokalt mikroskop med användning av en 63x eller högre objektiv.
  12. Kvantifiera γ-H2AX foci genom användning av endera av två metoder som beskrivs nedan. Göra mål för antingen protokoll med ögat med användning av ett fluorescensmikroskop. Helst ossea konfokalmikroskop. Ta Z-profiler och kondenseras till ett enda plan för att visualisera alla detekterbara foci (representativa bilder för γ-H2AX färgning i prolifererande och åldrande celler visas i figur 3). Räkna fokus med ögat med hjälp av bildbehandlingsprogram; i allmänhet, ~ 100 - 200 kärnor är tillräckliga för räkning.
    1. Att kvantifiera procentandelen av celler som har γ-H2AX-positiva foci, räkna varje cell som har åtminstone ett fokus synliga och dividera med det totala antalet DAPI-färgade kärnor.
    2. Att kvantifiera antalet av γ-H2AX foci, räkna γ-H2AX foci per cell.
      OBS: Halterna av γ-H2AX kan variera beroende på den specifika stress eller skada som induceras åldrande.

5. Färgning Celler för SAHF Markörer

OBS: Mänskliga åldrande celler har ofta nukleära regioner kondenserad DNA / kromatin. I åldrande celler, dessa heterochromatic regionertros hämma uttrycket av proliferationsbefrämjande gener, såsom E2F-familjemedlemmar. SAHF kan visualiseras genom en omorganisation av DAPI; genom närvaron av heterokromatin-associerad histon märken, inklusive di- och tri-metylering av Lys9 på histon H3 (H3K9Me2 och H3K9Me3); och genom kromatin-omorganisera proteiner, inklusive HP1 heterokromatin protein 1 (HP1), HIRA (histon repressor A), och ASF1a (anti-ljuddämpningsfunktion-1a) för att kromatin 30. Vi har valt att använda en onkogen-inducerad senescens modellen (OIS), som SAHF är mer framträdande i OIS modeller 30. IDH4-celler prolifererar i närvaro av dexametason på grund av närvaron av SV40 stor T-antigen men blir senescent efter avlägsnandet av dexametason från mediet 31. SAHF kan detekteras genom DAPI-färgning och genom färgning med antikroppar mot de specifika markörer som anges ovan. Här beskriver vi DAPI och H3K9Me2 färgning för visualizatjon av SAHF i celler 28.

  1. Växa IDH4-celler i DMEM kompletterat med 10% FBS, 1% penicillin / streptomycin, och 1 ug / ml dexametason. Att inducera senescens, avlägsna dexametason och ändra mediet så att det innehåller kol-strippad FBS; efter att ha ökat för ~ 10 dagar i detta nya medium, IDH4 celler blir senescent 31.
  2. Platt IDH4-celler eller celler från avsnitt 1 eller 2, som beskrivits ovan, på täckglas av glas i en 24-brunnsplatta.
  3. Nästa dag, tvätta cellerna med 1 x PBS. Skölj noga, eftersom åldrande celler inte fäster bra på täck och kan lätt tas bort under tvättar. Alternativt direkt fixera cellerna utan tvättning.
  4. Avlägsna PBS och fixera cellerna med nyframställd 3,7% formaldehyd i PBS under 10 min vid RT.
  5. Tvätta cellerna 3 gånger med 1 x PBS.
  6. Avlägsna lösningen och permeabilisera cellerna med 0,2% Triton X-100 i PBS under 5 min.
  7. Tvätta cellerna med 1xPBS. Avlägsna PBS och blockera täckglasen genom tillsats av blockeringsbuffert innehållande 3% BSA (vikt / volym) i PBS under 5 min vid RT. filtrera alltid lösningar innehållande BSA före användning för att avlägsna partiklar.
  8. Ta bort den blockerande bufferten och inkubera cellerna med primära antikroppar mot SAHF markörer såsom anti-H3KMe2 antikroppar (Figur 4, se Material tabell för detaljer). Späd antikropparna i blockeringsbuffert och inkubera i 1 - 2 h vid RT.
  9. Ta bort den primära antikroppslösningen och tvätta täckglasen 3 gånger med 1% (vol / vol) Triton X-100 i PBS.
  10. Späd de sekundära antikropparna i blockeringsbuffert (Material tabell) och inkubera i 1 h vid RT. Skyddas från ljus.
  11. Tvätta cellerna två gånger med 1 x PBS. Fläcken med DAPI (utspätt 1: 15.000 i PBS; se Material tabell) under 10 min vid RT.
  12. Tvätta täck 3x med 1x PBS.
    1. Snabbt tvätta med vatten för att avlägsna salterna ennd montera varje täckglas på en glasplatta med användning av 3 - 5 | il av antifade reagens. Alternativt använda en monteringslösning innehållande DAPI.
    2. Låt torka O / N och visualisera de färgade cellerna på en fluorescerande eller konfokalt mikroskop med användning av en 63x eller högre mål (se de Representativa resultat i figur 4). Kvantifiera SAHF enligt beskrivningen i avsnitt 4.
      OBS: Isotypkontrollreagenser primära antikroppar eller ingen primär antikropp (dvs sekundär enbart) bör användas som en negativ kontroll för immunofluorescensfärgning.

6. Analysera Åldrande-associerade proteiner genom immunoblotting

OBS: Den senescent fenotypen kännetecknas av uppreglering av cellcykelregulatorer, inklusive p16 INK4a, p21, och p53. Detta protokoll kommer att beskriva kvantifiering av nivåerna av dessa proteiner i cellysat. Dessa tekniker kan användas för att bedöma senescens inducerad med hjälp av olikametoder 21, 28, 29.

  1. Inducera cellulär senescens såsom beskrivits i avsnitt 1 och 2 eller någon annan metod 21, 28, 29. Att analysera cellulärt åldrande markörer, utstrykning av celler i 6 cm skålar och analysera både proteinet och RNA samtidigt (se avsnitt 7 för RNA isolering instruktioner).
  2. Ta cellodlingsmediet. Sätt cellerna på en bricka av is.
    1. Tvätta cellerna 2 gånger med kall 1 x PBS. Luta skålen för att säkerställa att alla PBS sugs så att vara så exakt i fråga om volymer som används för förfarandet.
    2. Efter avsugning den sista tvättningen av PBS, tillsätt 200 | il av kall 1 x PBS (för en 6 cm platta) till skålen. Skrapa cellerna med användning av en cellskrapa.
    3. Pipett cellen / PBS blandningen i en RNas-fri rör för RNA-isolering. Ta ca 150 &# 181; L av denna blandning och pipett in den i ett nytt rör. Denna alikvot kommer att användas för proteinanalys, så se till att pipetter samma belopp från varje rör.
  3. Lyserar cellerna genom tillsats av 75 till 100 | il av modifierat 2x Laemmlis provbuffert (60 mM Tris-HCl pH 6,8, 12,5% glycerol, 2% SDS, 5% β-merkaptoetanol (BME), och bromfenolblått; kan göras upp som en stor sats, alikvoterades och lagrades vid -20 ° C fram till användning) eller en provbuffert ekvivalent.
    1. Alternativt, lysera cellerna i 75 - 100 mikroliter av lysbuffert och centrifugera vid 15 tusen xg under 10 min vid 4 ° C för att avlägsna cellrester. Avlägsna supernatanten och pipetten i ett rent rör. En Bradford-proteinanalys eller en proteinanalys ekvivalent kan användas på lysat för att säkerställa lika laddning av protein.
      OBS: Protein analyser kan inte utföras på prov lyserade i provbuffert.
    2. Ta ut ~ 25 mikroliter av lysat och lägga till den i 15 mikroliter av 2x provbuffert. Pipett upp och görawn i provbufferten för att lysera cellerna.
      OBS: Volymer av lysbuffert eller provbuffert kan justeras beroende på cellsammanflytning. Om provet är "sliskig" på grund av kärnlyse, tillsätt mer provbuffert eller PBS för att späda ut. Prover kan förvaras vid -20 ° C fram till användning.
  4. Koka proven i 5 min vid 95 ° C på ett värmeblock (eller motsvarande utrustning) och belastning ~ 40 mikroliter av lyserade provet i provbuffert på en 18% Tris-glycin-gel.
    OBS: En gradient gel (4-15%) eller en 14% Tris-glycin-gel är även tillräcklig för att detektera lågmolekylära proteiner. Olika typer av akrylamidgeler kan också användas, men se till att de geler och systemet är tillräckliga för detektering av lågmolekylära proteiner.
    1. Kördes med användning 1x rinnande bufferten med en konstant 100 V under 20 min (genom stapling gel) och ~ 60 min vid 180 V. Övervaka gelén så färgfronten löper precis utanför eller är på botten av gelén, så att den lågmolekylära viktsproteiner inte run bort av gelén.
  5. Överföra akrylamidgelen till ett PVDF-membran (förblötta med 100% metanol för att aktivera). Om du gör en våt överföring är endast en timme som behövs för överföring (kontra normala ~ 1,75 h). Justera därefter för lämplig överföringssystemet; med användning av pre-färgade molekylviktsmarkörer kan stöd i bedömningen överföringseffektiviteten.
  6. Tvätta membranet i vatten. Använd en Ponceau fläck att övervaka lika laddning av prover. Tvätta Ponceau med vatten.
    1. Blockera membranet i 5% fettfri torrmjölk i TBST (50 mM Tris-HCl pH 7,5, 150 mM NaCl och 0,1% Tween-20) under 1 h vid RT eller O / N vid 4 ° C under omröring.
  7. Tvätt blot en gång med TBST och inkubera med primär antikropp utspädd i 5% mjölk TBST (se Material Tabell för spädningar och rekommendationer antikropps) under 1 h vid RT.
  8. Utföra två snabba tvättningar med TBST och tvätta sedan två gånger på en skakanordning under totalt ~ 30 min (~ 15 min vardera varh).
  9. Inkubera med en sekundär antikropp under 40 min vid RT. Upprepa steg 6,10.
  10. Inkubera med nybakade Western blot substrat och utveckla filmen eller läsa den på en kemiluminiscens läsare.
  11. Sond immunoblot med p16 INK4a antikroppar första (Figur 5). Strippa membranet genom inkubation under 15 min med vatten, 15 min med 0,2 N NaOH, och 15 min med vatten. Fortsätt med steg 6.9 med hjälp av anti-p21-antikroppar.
  12. Strippa membranet med användning av 62,5 mM Tris-HCl pH 6,8 och 2% SDS med 300 mikroliter av färskt tillsatt BME per 50 ml strippningslösningen.
  13. Inkubera vid 50 ° C under 30 minuter och tvätta extensivt med TBS och därefter TBST. Sond med anti-aktin eller anti-GAPDH-antikroppar för proteinmatade kontroller (Figur 5 visar representativa resultat).
    OBS: p53 nivåer kan också bedömas på samma membran. Emellertid, eftersom p53 är en högre molekylvikt, är det bättre upplöstes på en lägre-procentandel gel (t.ex.

7. Analysera mRNA-nivåer av Åldrande Markörer

OBS! När isolera RNA, se till att arbetsytorna rengörs med RNas borttagning lösningar eller motsvarande och att materialen är alla RNas-fri.

  1. Användning av cellen / PBS-blandningen från steg 4,2, tillsätt 1 ml av RNA extraktionslösning och vortexa i 30 s (det bör finnas några synliga klumpar eller cellrester).
  2. Tillsätt 200 mikroliter av kloroform och skaka kraftigt i 15 s.
  3. Centrifugera vid max hastighet (> 15 tusen xg) under 15 min vid 4 ° C.
  4. Avlägsna ~ 400 mikroliter av det övre RNA vattenskiktet och pipettera den i ett nytt mikrofugrör.
  5. Tillsätt 400 | il isopropanol (1: 1 med den totala volymen av vattenfasen pipetter i föregående steg) och 4 | il av precipitant till RNA skiktet.
  6. Centrifug under 15-30 min vid maximal hastighet (> 15 tusen xg) och 4 ° C för att pelletera RNA.
  7. Avlägsna supernatanten och tillsätt 1 ml 75% iskall etanol.
  8. Centrifugera i en minut vid maximal hastighet (> 15 tusen xg) och 4 ° C.
  9. Avlägsna supernatanten och centrifugera i 1 minut vid maximal hastighet (> 15 tusen xg) och 4 ° C.
  10. Pipettera ut så mycket vätska som möjligt och lufttorka i 2 min.
  11. Re-suspendera i 10 mikroliter av 10 x DNas-buffert, 85 | il H2O, och 5 | il av DNas 1.
  12. Inkubera vid 37 ° C under 30 min.
  13. Lägga 200 mikroliter NT2-buffert (50 mM Tris-HCl pH 7,4, 150 mM NaCl, 1 mM MgCl2 och 0,05% Nonidet P-40) och tillsätt 300 | il av det undre skiktet av syra fenol-CHCls 2.
  14. Vortex under 1 min och centrifugera vid rumstemperatur i 5 min vid maximal hastighet (> 15 tusen xg).
  15. Samla upp 250 mikroliter av det övre RNA-skiktet (2 x 125 ul), tillsätt 25mikroliter av 3 M natriumacetat pH 5,2, 625 | il av 100% iskall etanol, och 5 mikroliter av fällningsmedel. Blanda väl och utfälla O / N vid -20 ° C.
  16. Nästa dag, blanda och centrifugera vid maximal hastighet (> 15 tusen xg) och 4 ° C under 30 min och kassera supernatanten.
  17. Upprepa steg från 6,8 till 6,11.
  18. Återsuspendera pelleten i 12 mikroliter av nukleasfritt vatten och förvara vid -80 ° C fram till användning.
    OBS: Andra RNA isoleringsprocedurer och kit kan användas.
  19. Utföra omvänd transkription med slumpmässiga hexamerer och SSII omvänt transkriptas enligt tillverkarens protokoll.
    OBS: Med tanke på den låga mängden RNA isolerat från åldrande celler, är det bäst att använda alla av RNA (12 mikroliter) för den omvända transkriptionen syntes. Alternativt kan RNA kvantifieras med användning av en spektrofotometer, och lika stora mängder av RNA kan användas för omvänd transkription.
  20. Analysera mRNA-nivåer med användning kvantitativ realtids-qPCR (RT-qPCR) amplification och SYBR-grön PCR Master Mix med genspecifika primers.
    1. Som i en typisk RT-qPCR reaktion, späd cDNA 1:30 (i RNas / DNas-fritt vatten) och tillsätt 3 | il till realtids 96-brunnsplatta för bättre pipettering noggrannhet. Förbereda en reaktionshuvudblandning av genspecifika framåt och bakåt primers (2,5 | iM koncentration, tillsätt 5 pl / reaktion), SYBR-grön PCR-blandning (6,25 | il / reaktion; använder mindre än tillverkarens rekommendation), och 5,75 | al av RNas / DNas-fritt vatten för en slutlig reaktionsvolym av 20 | il (17 | il av primrar / SYBR-grön / vatten och 3 mikroliter av cDNA).
    2. Utföra RT-qPCR amplifiering med användning av ett realtids-PCR maskin; Följ tillverkarens protokoll.
      OBS: En lista över godkänd människa framåt och bakåt i realtid primers kan hittas i tabell 1. Dessa gener innefattar SASP proteiner och andra hudåldrande-associerade markörer och / eller gener. Representativa resultat från IR-inducerad senescens visas i

8. Kvantifiera SASP proteinnivåer

  1. Inducera senescens användning avsnitt 1 eller 2 eller någon annan metod. Utstrykning av celler på antingen 6 eller 10 cm plattor, såsom beskrivs ovan (~ 250.000 celler / 6 cm platta eller ~ 650 tusen / 10 cm platta).
  2. Antingen med celler 10 d post-IR-behandling eller med replikativa åldrande celler (och lämpliga kontrollceller), tvätta cellerna tre gånger med 1 x PBS och tillsätt serumfritt medium med antibiotika i en liten volym (2,5 ml för 6 cm eller 5 ml för 10 cm).
  3. Inkubera över natten vid 37 ° C och 5% CO2 i en vävnadsodlingsinkubator. Nästa dag, samla mediet och placera den i ett koniskt rör på is.
  4. Tvätta cellerna 2 gånger med PBS och sedan tillsätt 1 ml av trypsin (för en 6 cm skål). Räkna cellerna med användning av en hemocytometer för att senare justera koncentrationerna enligt cellantal.
  5. Centrifugera mediet för 5 min vid 300 x g.
  6. filtER de mediet med användning av ett 0,45-pm sprutfilter.
  7. Alikvotera mediet och frys vid -80 ° C fram till användning eller analys direkt med användning av ELISA eller ekvivalenta analyser.
  8. Beräkna antalet celler / ml koncentration genom att det totala cellantalet / volym medium uppsamlades.
  9. Utföra en lämplig enzymkopplad immunosorbentanalys (ELISA) enligt tillverkarens instruktioner. Se Material Tabell för rekommenderade ELISA-kit för analys för IL-6, IL-8, GROa, och andra cytokiner / kemokiner (figur 6B).
  10. Att se till att de faktorer som mäts är inom det linjära området av ELISA-kit, göra spädningar av senescentcellmedium jämfört med den prolifererande cellmediet. Konto för dessa utspädningar och volymen vid beräkning av mängden av IL-6. Att förvärva den mängd av IL-6 utsöndras per cell per dag, beräkna IL-6 värde som erhålls ur satsen (i pg) per utspädd cellkoncentration per ml (frabout steg 7,8).
    OBS: Andra metoder, såsom cytokin arrayer, kan användas för att detektera SASP proteinnivåer och kan vara lämpliga för screening av ett stort antal SASP faktorer. Proteinnivåer av SASP faktorer kan variera beroende på den tid efter senescens induktion, celltypen, eller den typ av senescens induceras.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figurer till 2 - 6 visar representativa resultat från SA-β-gal-färgning; färgning för γ-H2AX och SAHF; bedömning av proteinnivåer av p16 INK4a, p21, och p53; och mRNA och proteinnivåer av åldrande-associerade molekyler. Ökade SA-β-gal-färgning sker med replikativ och DNA-skada-inducerad senescens. Också observera morfologiska förändringar som sker med åldrande. Celler blir förstorad och platta jämfört med spindel utseende prolifererande fibroblaster. För denna experimentella paradigm färgades cellerna och RNA / protein isolerades 7 d efter IR-exponering. Mer robusta resultat kan uppstå genom att vänta längre efter IR-exponeringen (dvs. 10 d). Villkor måste bestämmas för varje tillstånd och experimentuppställning. Dessa resultat är representativa och dessa markörer kan också detekteras när senescens induceras med användning av andra metoder.

figur 6, är gensenamnen listade och motsvarar CXCL1 (GROa), CXCL2 (GROp), och CSF2 (GM-CSF). Uppregleringen av mRNA-nivåer av vissa, men inte alla, av de SASP faktorer observerades efter IR-inducerad senescens i WI-38-celler. Andra hudåldrande-associerade mRNA, inklusive CDKN1A (kodar p21) och CDKN2A (kodar p16 INK4a), var uppreglerade. Andra mRNA (EDN1 och ANKRD1) har också inkluderats och har tidigare visat sig vara högre i åldrande celler 15. Primers är listade i tabell 1.

Figur 1
Figur 1: Prolifererande och senescenta Fibroblaster. En schematisk representation av prolifererande (vänster) och fibroblaster åldrande (höger). Exempel på hudåldrande inducerare visas i yellow låda. Senescens är associerat med högre nivåer av de indikerade markörer. SA-β-gal, senescens-associerade β-galaktosidasaktivitet; SASP, senescens-associerade sekretorisk fenotyp; SAHF, senescens-associerade heterokromatin foci; DDR, DNA-skador svar. Klicka här för att se en större version av denna siffra

figur 2
Figur 2. Morfologiska egenskaper och ökad SA-β-gal Aktivitet av åldrande celler. WI-38-celler, antingen prolifererande "unga" (PDL 27), replikativ senescent (PDL 40), eller de som utsätts för joniserande strålning (IR), färgades för SA-β-gal-aktivitet. IMR-90-celler, antingen prolifererande "unga" (PDL 30), replikativ senescent (PDL 52), eller de som utsätts för joniserande strålning (IR), var staINED för SA-β-gal-aktivitet. Sektionerna 1 - 2 beskriver inducering replikativ och DNA-skada-inducerad senescens, och avsnitt 3 förklarar färgning för SA-β-gal. Celler färgades 7 d efter IR. Con, kontroll. Scale bar = 50 | im. Klicka här för att se en större version av denna siffra.

figur 3
Figur 3. Ökad γ-H2AX Foci i åldrande celler. WI-38-celler, antingen prolifererande "unga" (PDL 30) eller replikativ senescent (PDL 53), fixerades och färgades med anti-y-H2AX antikroppar och DAPI. Notera ökningen av antalet γ-H2AX härdar i åldrande celler. Bilder erhölls på en konfokalmikroskop. Z-profiler togs, och den maximala intensitetsprojektion användes för att erhålla ett enda plan bild för att visualisera alla DETECbords foci. Scale bar = 20 | im. Klicka här för att se en större version av denna siffra.

figur 4
Figur 4. Fluorescerande Färgning av SAHF i åldrande celler. (A) prolifererande WI-38-celler (PDL 27) var obehandlade eller utsätts för joniserande strålning (IR). Efter 10 dagar, färgades cellerna med DAPI för att synlig SAHF (observera täta / punktuell DAPI-färgning i IR-behandlade celler) (B) IDH4 odlades i närvaro av dexametason (prolifererande) eller i kol-strippad FBS för att inducera senescens ( åldrande). Efter 10 d, färgades cellerna med antikroppar mot H3K9Me2 och DAPI. Bilder erhölls på en konfokalmikroskop. Z-profiler togs, och den maximala intensitet projektion användes för att erhålla en enkel-planbild. Prolifererande celler i (A) och (B) har diffus DAPI-färgning, medan åldrande celler har punktat DAPI-färgning. I (B), kontrollceller har diffust, mycket lätt färgning för H3K9Me2, medan H3K9Me2 färgningen är mer robust och colocalizes med DAPI-färgade foci i åldrande celler. Scale bar = 20 | im. Klicka här för att se en större version av denna siffra.

figur 5
Figur 5. Kvantifiering av Åldrande-associerade proteiner. Protein isolerades från antingen prolifererande "unga" (PDL 30) IMR-90-celler (-) eller IMR-90-celler som exponerats för 10 Gy av joniserande strålning (IR). Mediet byttes varje 48 h och cellerna lyserades 7 d efter IR. Prover analyserades med SDS-PAGE, immunblottades med anti-p16 INK4a Antibodör, och återsondades med anti-p21 och därefter anti-p53-antikroppar. GAPDH användes som en proteinladdningskontroll. Klicka här för att se en större version av denna siffra.

figur 6
Figur 6. Kvantifiering av Åldrande-associerade mRNA och SASP Proteins. (A) RNA isolerades från antingen prolifererande "unga" (PDL 27 eller 34) WI-38-celler (-) eller WI-38-celler som exponerats för 10 Gy av joniserande strålning (IR). Mediet byttes var 48 h och RNA-isolering utfördes 7 d efter IR. RT-qPCR användes för att kvantifiera nivåerna av de indikerade hudåldrande-associerade mRNA med användning av de genspecifika primrar som anges i tabell 1. 18S nivåer användes för normalisering. Histogrammen representerar medelvärdet normaliserade to obehandlad ± SEM från 5 oberoende experiment. (B) WI-38-celler (PDL 26) exponerades för 10 Gy av IR; 10 d senare, byttes mediet till serumfritt medium (se avsnitt 7). Efter 24 h, uppsamlades konditionerat medium och IL-6, IL-8, och GROa-nivåer kvantifierades med användning av ELISA-analyser. Histogrammet representerar medelvärdet ± SEM från 3 experiment. * P <0,05 och *** P <0,001 genom t-test. Klicka här för att se en större version av denna siffra.

mänskliga Primers Fram Omvänd
18S CCCTATCAACTTTCGATGGTAGTCG CCAATGGATCCTCGTTAAAGGATTT
ANKRD1 AGT AGA GGA ACT GGT CACTGG TGG GCT AGA AGT GTCTTC AGA T
CDKN1A (p21) GAC ACCACT GGA GGG TGA CT CAGGTC CAC ATG GTC TTC CT
CDKN2A (p16) CCAACGCACCGAATAGTTACG GCGCTGCCCATCATCATG
CSF2 (GM-CSF) GGCCCCTTGACCATGATG TCTGGGTTGCACAGGAAGTTT
CXCL1 GAAAGCTTGCCTCAATCCTG CACCAGTGAGCTTCCTCCTC
CXCL2 AACTGCGCTGCCAGTGCT CCCATTCTTGAGTGTGGCTA
EDN1 CAG CAGTCT TAG GCG CTG AG ACTCTT TAT CCA TCA GGG ACG AG
IL6 CCGGGAACGAAAGAGAAGCT GCGCTTGTGGAGAAGGAGTT
IL7 CTCCAGTTGCGGTCATCATG GAGGAAGTCCAAAGATATACCTAAAAGAA
IL8 CTTTCCACCCCAAATTTATCAAAG CAGACAGAGCTCTCTTCCATCAGA

Tabell 1: RT-qPCR Primrar för Åldrande-associerade mRNA. Framåt och bakåt primers för RT-qPCR använda SYBR-grön teknik anges.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Här, har vi beskrivit metoder för replikativ och DNA-skada inducerad senescens som använder humana diploida fibroblaster. Dessutom är tekniker för att kvantifiera protein och mRNA-nivåer av olika hudåldrande associerade proteiner inkluderas, liksom färgning för SA-β-gal och för DNA-skador markör γ-H2AX. Dessa protokoll kan ofta används för att bedöma senescenta fenotyper både in vitro och in vivo, även om många varningar existerar för karakterisering senescens in vivo 20. Andra celler kan uttrycka åldrande markörer, även om de inte är åldrande celler. Till exempel, celler såsom osteoklaster och makrofager har högre nivåer av β-gal-aktivitet 32, 33. Dessutom har många cancerceller uppregleras P16 INK4a 34. Celler kan också ackumulera DNA-skada (t ex γ-H2AX foci) och inte vara senescent. SASP faktorer kan också uppregleras avolika normala fysiologiska eller patologiska tillstånd som kan eller inte kan involvera åldrande celler. Därför bör multipla hudåldrande markörer utnyttjas, särskilt vid bedömningen senescens in vivo.

Även åldrande celler befanns ökas normalt åldrande vävnader mer än 20 år sedan 4, är det först nu som vi är fullt uppskattar de många roller som åldrande celler spelar i både normal vävnad homeostas och sjukdomstillstånd. Den senaste anställning av musmodeller för att eliminera p16 INK4a -positiva åldrande celler har tillåtit forskare att mer klart och exakt uppskatta den roll åldrande celler i vävnader och organ 35, 36, 37. Dessa modeller har upptäckt att åldrande celler bidrar till en mångfald av åldersrelaterade patologier, tumörgenes, och mus livslängd 35 </ sup>, 36, 37. Med tanke på dessa nya upptäckter och validering av vikten av åldrande celler i fysiologi, är tiden mogen för mer forskning om dessa specifika celler. Till exempel, studier med användning av strategier för att terapeutiskt avlägsna åldrande celler eller för att fördröja åldrandet kan vara till nytta för både healthspan och livslängdsstudier.

Nyligen vårt laboratorium visade att metformin, ett läkemedel som vanligen används för att behandla typ 2-diabetes mellitus, minskar cellulärt åldrande 38. Eftersom metformin för närvarande föreslås som en anti-aging terapi och har anti-cancer egenskaper 39, 40, kommer det att bli intressant att i framtiden undersöka om detta läkemedel eller andra åldrande interventioner påverkar hälsoresultat genom att modulera cellulärt åldrande.

Protokollen vi diskuterar här är vanliga och allmänt enccepted tekniker för att bedöma senescent fenotypen. För celler odlade in vitro, är det kritiskt att övervaka cellförändringar från en spindel-liknande till en tillplattad morfologi i syfte att säkerställa att cellerna är senescent (Se figur 1 och 2). Om cellerna inte är positiva för SA-β-gal eller andra markörer beskrivna här, bedöma senescens vid högre PDL cell (för replikativ senescens) eller vid en ökad tid efter DNA-skada-inducerad senescens. Dessutom kan dessa protokoll måste optimeras för olika celltyper. För bedömning av SASP-proteinnivåer, är det kritiskt att avlägsna serum från cellmediet, eftersom detta kommer att orsaka höga bakgrundsnivåer i ELISA eller proteinchip. Därför hålla detta i åtanke när man utformar experiment, eftersom det inte kan vara perfekt för att samtidigt bedöma flera markörer.

Färgning för SA-β-gal, som beskrivs här, begränsas av det faktum att den kräver fixering av cellerna.Dessutom har cellkonfluens visats påverka SA-β-gal-aktivitet. Protokoll har utvecklats för att bedöma SA-β-Gal-aktivitet med användning av ett fluorogent substrat för β-gal-aktivitet, vilket möjliggör för kvantifiering av denna markör i levande celler med användning av flödescytometri 41, 42, 43. SA-β-gal-aktivitet kan även mätas i cellysat med användning av en kemiluminescerande metod 44. Dessutom kan γ-H2AX också mätas med användning av diverse andra metoder, inklusive flödescytometri eller immunoblotting av cellysat 45.

Det bör noteras att SAHF formation är cellinjen beroende och är oftast förknippad med onkogen-inducerad senescens 20, 30, 46. Därför kan SAHF inte förekomma i alla hudåldrande modeller. Användbarheten avSAHF som ett senescent markör i musmodeller kan också begränsas av det faktum att SAHF allmänhet inte observeras i mus åldrande celler 30, 46, 47. Här, var antikroppar mot H3K9Me2 användas, men andra molekylära markörer av SAHF kan användas, innefattande macroH2A, hög rörlighet grupp A (HMGA) proteiner, och tri-metylerade lysin 9 histon H3 (H3K9Me3) och bundna HP1 proteiner. Dessutom kan kromatin immunfällningsanalyser användas för att bedöma histon märken eller associationen av kromatin bindande proteiner till E2F målgener.

Man bör vara medveten om att det finns olika begränsningar för att karakterisera åldrande, inklusive heterogenitet för markörer och det faktum att dessa markörer inte uttrycks uteslutande i åldrande celler. Multipel (i allmänhet, 2 - 3) markörer bör användas för att bedöma senescens, inklusive markörer som inte beskrivs här. Till exempel, DNA-ärr, telomerskada, och / eller DNA-skada signalering kan också kvantifieras. Vidare, såsom åldrande och, i synnerhet, den SASP fenotypen, har nyligen visats att påverkas av den specifika stressfaktor eller skada som inducerar senescens 11, 12, 13, är det viktigt att bedöma flera markörer i varje experimentella paradigm.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgments

Denna studie stöddes av Intramural forskningsprogram National Institutes of Health, National Institute on Aging. Författarna vill tacka Myriam Gorospe och Kotb Abdelmohsen för många hjälp diskussioner om åldrande och Kotb Abdelmohsen för också kritiskt läsa manuskriptet. Vi tackar också våra laboratorie medlemmar, särskilt Douglas Dluzen för kritiskt läsa manuskriptet.

Materials

Name Company Catalog Number Comments
16% Tris-glycine gels Invitrogen XP00160BOX
Acid-Phenol ChCl3 Ambion AM9720
Alexa-Fluor 568 goat anti-mouse antibody Invitrogen A11031 1:300 dilution
Cell lifters Corning Inc. 3008 Cell scraper
ECL anti-mouse HRP linked antibody Amersham NA931V
ECL Plus Western Blotting Substrate Pierce 32132 ECL
DAPI Molecular Probes MP01306 stock 5 mg/mL in dH2O
GAPDH antibody Santa Cruz sc-32233 1:1,000 - 5,000 dilution
GlycoBlue Ambion AM9515
Histone H3 dimethyl K9 monoclonal antibody Abcam 1220 1:500 dilution
Human IL-6 Quantikine ELISA assay R&D systems D6050
Human IL-8 Quantikine ELISA assay R&D systems D8000C
Human GROa Quantikine ELISA assay R&D systems DRG00
N-N-dimethylformamide  Sigma D4551 DMF
p16 monoclonal antibody BD Biosciences 51-1325gr 1:500 dilution
p21 monoclonal antibody Millipore 05-345 1:750 dilution
p53 monoclonal antibody Santa Cruz sc-126 1:500 dilution clone DO-1
phospho-H2AX (Ser139) FITC conjugate antibody Cell Signaling 9719 1:2,000 dilution
POWER SYBR-green PCR master mix  Applied Biosystems 4367659
Pre-stained molecular weight markers Biorad 161-0374
ProLong Gold Antifade  Invitrogen P36930
PVDF membrane  Thermo Scientific 88518
Senescence β-Galactosidase Staining Kit Cell Signaling 9860
TRIzol Ambion/Life Tech 10296028

DOWNLOAD MATERIALS LIST

References

  1. Hayflick, L. The Limited in Vitro Lifetime of Human Diploid Cell Strains. Exp Cell Res. 37, 614-636 (1965).
  2. van Deursen, J. M. The role of senescent cells in ageing. Nature. 509, (7501), 439-446 (2014).
  3. Campisi, J., d'Adda di Fagagna, F. Cellular senescence: when bad things happen to good cells. Nat Rev Mol Cell Biol. 8, (9), 729-740 (2007).
  4. Dimri, G., et al. A biomarker that identifies senescent human cells in culture and in aging skin in vivo. Proc Natl Acad Sci U S A. 92, 9363-9367 (1995).
  5. Kuilman, T., Michaloglou, C., Mooi, W. J., Peeper, D. S. The essence of senescence. Genes Dev. 24, (22), 2463-2479 (2010).
  6. Pospelova, T. V., et al. Pseudo-DNA damage response in senescent cells. Cell Cycle. 8, (24), 4112-4118 (2009).
  7. Narita, M., et al. Rb-mediated heterochromatin formation and silencing of E2F target genes during cellular senescence. Cell. 113, (6), 703-716 (2003).
  8. Ben-Porath, I., Weinberg, R. A. The signals and pathways activating cellular senescence. Int J Biochem Cell Biol. 37, (5), 961-976 (2005).
  9. Campisi, J. Senescent cells, tumor suppression, and organismal aging: good citizens, bad neighbors. Cell. 120, (4), 513-522 (2005).
  10. Coppe, J. P., et al. Senescence-associated secretory phenotypes reveal cell-nonautonomous functions of oncogenic RAS and the p53 tumor suppressor. PLoS Biol. 6, (12), 2853-2868 (2008).
  11. Tominaga-Yamanaka, K., et al. NF90 coordinately represses the senescence-associated secretory phenotype. Aging (Albany NY). 4, (10), 695-708 (2012).
  12. Wiley, C. D., et al. Mitochondrial Dysfunction Induces Senescence with a Distinct Secretory Phenotype. Cell Metab. 23, (2), 303-314 (2016).
  13. Hoare, M., et al. NOTCH1 mediates a switch between two distinct secretomes during senescence. Nat Cell Biol. 18, (9), 979-992 (2016).
  14. Rodier, F. Detection of the senescence-associated secretory phenotype (SASP). Methods Mol Biol. 965, 165-173 (2013).
  15. Srikantan, S., Marasa, B. S., Becker, K. G., Gorospe, M., Abdelmohsen, K. Paradoxical microRNAs: individual gene repressors, global translation enhancers. Cell Cycle. 10, (5), 751-759 (2011).
  16. Abdelmohsen, K., Gorospe, M. Noncoding RNA control of cellular senescence. Wiley Interdisciplinary Reviews: RNA. (2015).
  17. Bhaumik, D., et al. MicroRNAs miR-146a/b negatively modulate the senescence-associated inflammatory mediators IL-6 and IL-8. Aging. 1, (4), 402-411 (2009).
  18. Rodier, F., et al. DNA-SCARS: distinct nuclear structures that sustain damage-induced senescence growth arrest and inflammatory cytokine secretion. J Cell Sci. 124, (PT 1), 68-81 (2011).
  19. Bernardes de Jesus, B., Blasco, M. A. Assessing cell and organ senescence biomarkers. Circ Res. 111, (1), 97-109 (2012).
  20. Sharpless, N. E., Sherr, C. J. Forging a signature of in vivo senescence. Nat Rev Cancer. 15, (7), 397-408 (2015).
  21. Rubio, M. A., Kim, S. -H., Campisi, J. Reversible Manipulation of Telomerase Expression and Telomere Length: implications for the ionizing radiation response and replicative senescence of human cells. J Biol Chem. 277, (32), 28609-28617 (2002).
  22. Chen, Q. M., Prowse, K. R., Tu, V. C., Purdom, S., Linskens, M. H. K. Uncoupling the Senescent Phenotype from Telomere Shortening in Hydrogen Peroxide-Treated Fibroblasts. Experimental Cell Research. 265, (2), 294-303 (2001).
  23. Dumont, P., et al. Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic Biol Med. 28, (3), 361-373 (2000).
  24. Roninson, I. B. Tumor Cell Senescence in Cancer Treatment. Cancer Research. 63, (11), 2705-2715 (2003).
  25. Nyunoya, T., et al. Cigarette Smoke Induces Cellular Senescence. J Respir Cell Mol Biol. 35, (6), 681-688 (2006).
  26. Bai, H., Gao, Y., Hoyle, D. L., Cheng, T., Wang, Z. Z. Suppression of Transforming Growth Factor-β Signaling Delays Cellular Senescence and Preserves the Function of Endothelial Cells Derived From Human Pluripotent Stem Cells. Stem Cells Transl Med. (2016).
  27. Senturk, S., et al. Transforming growth factor-beta induces senescence in hepatocellular carcinoma cells and inhibits tumor growth. Hepatology. 52, (3), 966-974 (2010).
  28. Aird, K. M., Zhang, R. Detection of senescence-associated heterochromatin foci (SAHF). Methods Mol Biol. 965, 185-196 (2013).
  29. Pospelova, T. V., Chitikova, Z. V., Pospelov, V. A. An integrated approach for monitoring cell senescence. Methods Mol Biol. 965, 383-408 (2013).
  30. Di Micco, R., et al. Interplay between oncogene-induced DNA damage response and heterochromatin in senescence and cancer. Nat Cell Biol. 13, (3), 292-302 (2011).
  31. Wright, W. E., Pereira-Smith, O. M., Shay, J. W. Reversible cellular senescence: implications for immortalization of normal human diploid fibroblasts. Mol Cell Biol. 9, (7), 3088-3092 (1989).
  32. Bursuker, I., Rhodes, J. M., Goldman, R. Beta-galactosidase--an indicator of the maturational stage of mouse and human mononuclear phagocytes. J Cell Physiol. 112, (3), 385-390 (1982).
  33. Kopp, H. G., Hooper, A. T., Shmelkov, S. V., Rafii, S. Beta-galactosidase staining on bone marrow. The osteoclast pitfall. Histol Histopathol. 22, (9), 971-976 (2007).
  34. Witkiewicz, A. K., Knudsen, K. E., Dicker, A. P., Knudsen, E. S. The meaning of p16(ink4a) expression in tumors: functional significance, clinical associations and future developments. Cell Cycle. 10, (15), 2497-2503 (2011).
  35. Baker, D. J., et al. Naturally occurring p16(Ink4a)-positive cells shorten healthy lifespan. Nature. 530, (7589), 184-189 (2016).
  36. Baker, D. J., et al. Clearance of p16Ink4a-positive senescent cells delays ageing-associated disorders. Nature. 479, (7372), 232-236 (2011).
  37. Demaria, M., et al. An Essential Role for Senescent Cells in Optimal Wound Healing through Secretion of PDGF-AA. Dev Cell. 31, (6), 722-733 (2014).
  38. Noren Hooten, N., et al. Metformin-mediated increase in DICER1 regulates microRNA expression and cellular senescence. Aging Cell. 15, (3), 572-581 (2016).
  39. Barzilai, N., Crandall, J. P., Kritchevsky, S. B., Espeland, M. A. Metformin as a Tool to Target Aging. Cell Metab. 23, (6), 1060-1065 (2016).
  40. Foretz, M., Guigas, B., Bertrand, L., Pollak, M., Viollet, B. Metformin: from mechanisms of action to therapies. Cell Metab. 20, (6), 953-966 (2014).
  41. Cahu, J., Sola, B. A sensitive method to quantify senescent cancer cells. J Vis Exp. (78), (2013).
  42. Debacq-Chainiaux, F., Erusalimsky, J. D., Campisi, J., Toussaint, O. Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo. Nat Protoc. 4, (12), 1798-1806 (2009).
  43. Noppe, G., et al. Rapid flow cytometric method for measuring senescence associated beta-galactosidase activity in human fibroblasts. Cytometry A. 75, (11), 910-916 (2009).
  44. Bassaneze, V., Miyakawa, A. A., Krieger, J. E. Chemiluminescent detection of senescence-associated beta galactosidase. Methods Mol Biol. 965, 157-163 (2013).
  45. Redon, C. E., et al. gamma-H2AX detection in peripheral blood lymphocytes, splenocytes, bone marrow, xenografts, and skin. Methods Mol Biol. 682, 249-270 (2011).
  46. Kosar, M., et al. Senescence-associated heterochromatin foci are dispensable for cellular senescence, occur in a cell type- and insult-dependent manner and follow expression of p16(ink4a). Cell Cycle. 10, (3), 457-468 (2011).
  47. Kennedy, A. L., et al. Senescent mouse cells fail to overtly regulate the HIRA histone chaperone and do not form robust Senescence Associated Heterochromatin Foci. Cell Div. 5, 16 (2010).
Tekniker för att inducera och kvantifiera cellulärt åldrande
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).More

Noren Hooten, N., Evans, M. K. Techniques to Induce and Quantify Cellular Senescence. J. Vis. Exp. (123), e55533, doi:10.3791/55533 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter