Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

פרוטוקולים לחקירת הפצת Host-הרקמה, הילוכים-mode, ואת ההשפעה על כושר Host של Densovirus ב bollworm הכותנה

doi: 10.3791/55534 Published: April 12, 2017

Summary

כאן, אנו מציגים פרוטוקול לחקור את חלוקת מארח-רקמות, מצב שידור, וכן השפעה על כושר המארח של densovirus בתוך מינים פרפראים, את bollworm הכותנה. פרוטוקול זה יכול לשמש גם עבור לימוד האינטראקציה בין וירוסים דרך פה-המשודר אחרים ומארחי החרקים שלהם.

Abstract

וירוסי רומן רבים התגלו מארחי בעלי חיים באמצעות טכנולוגיות רצף של הדור הבא. בעבר, דיווחנו וירוס הדדי, densovirus תנשמית האביב (HaDV2), בעוד מינים פרפראים, את bollworm הכותנה, תנשמית האביב (הובנר). כאן, אנו מתארים את הפרוטוקולים המשמשים כיום כדי לחקור את ההשפעה של HaDV2 על המארח שלו. ראשית, אנו להקים מושבה bollworm כותנה HaDV2 ללא מזוג הרבייה יחיד. ואז, אנחנו בעל פה לחסן כמה צאצאי זחל ילודים עם HaDV2 המכיל נוזל מסונן לייצר שתי מושבות עם אותו הרקע גנטי: אחד HaDV2 נגוע, על אלה שלא נדבקו אחרים. פרוטוקול להשוות פרמטרי שולחן חיים (למשל, זחל, גלמים, ותקופות מבוגרי פוריות) בין יחידים HaDV2 נגועים ואת -uninfected גם מוצג, כמו גם הפרוטוקולים לקביעת חלוקת מארח-רקמות ויעילות העברת HaDV2. פרוטוקולים אלה ווULD גם להיות מתאים חוקר את ההשפעות של וירוסים משודרים אחרים בעל פה על מארחי החרקים שלהם, מארחים פרפראים בפרט.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בעשורים האחרונים, את הפיתוח של טכנולוגיית ריצוף כגון סידור הדור הבא (NGS) יש להקל על גילוי וירוסים רבים DNA ו- RNA רומן, במיוחד וירוסים פתוגניים, אבל גם מבודד רומן של וירוסים ידועים בעבר 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12. תסיסנית אורגניזם המודל, יותר מ 20 הגנום וירוס חלקיים חדשים זוהו באמצעות טכניקות metagenomic 13. רצפים ויראלי רבים, כולל וירוסים רומן, גם זוהו חרקים אחרים, כגון דבורים ודבש, מ 'osquitoes, psyllids דר אסיה, שפיריות, ומיני פרפראים מרובים 14, 15, 16, 17, 18, 19, 20, 21.

בעתיד, ניתן לצפות כי יותר וירוסים רומן יתגלו חרקים באמצעות טכנולוגיות מתקדמות אלה; ומכאן, הבנתנו את אינטראקצית וירוס-מארח עשויה להשתנות בהתאם 6, 9. לדוגמא, אינטראקציות מארח וירוס נחשבות יותר מסובך ממה שחשב בעבר, כי וירוסי רומן רבים מאופיינים כגורם שותפים הדדיים ולא 22 פתוגנים קפדנים. לדוגמא, DplDNV densovirus ההדדי ב plantaginea Dysaphis גורם מורף מכונף מגביר את ניידות, הקלת הפיזור של המארח כמו גם את הווירוס 23. יתר על כן, וירוסים הדדיים תוארו לגבי בריאות יונקת, הבצורת וסובלנות קרה של צמחים, וכן את ההשפעה של זיהומים חיידקיים 24. סנקה העמק וירוס-001 מוצג לתווך cytotoxicity סלקטיבית כלפי תאים סרטניים בסרטן נוירואנדוקריניים כולל 25. הפטיטיס A נגיף לדכא שכפול הפטיטיס C וירוס ועלול להוביל להחלמה מצהבת C 26. חביון ההרפס מקנה הגנה סימביוטית מזיהום חיידקי 27. גליקופרוטאין המעטפה של-W HERV שרטרווירוס האנושי אנדוגני גורם התנגדות הסלולר וירוס נמק הטחול 28. וירוס סובלנות תרמית Curvularia (CThTV) מתוך endophyte פטרייתיים מעורב האינטראקציה ההדדית בין פטרייה זו לבין דשא פאניקה טרופינ"צ "> 29. לפיכך, ידע של האינטראקציות בין הווירוסים מצאו חדש מארחיהם צריכות לייצר נקודות מבט חדשות על הביולוגיה והניהול שלהם. עם זאת, וירוסי רומן, ובמיוחד הווירוסים הסמויים מוצגים שום סימנים ברורים טיפוסיים של זיהום חריף, יש לעיתים רחוקות נחקרו, ואנחנו צריכים צינור ופרוטוקולים כדי לחקור את ההשפעות של וירוסים שנמצאו לאחרונה על מארחיהם.

בעבר, דיווחנו השכיחות חדש monosense densovirus Helicoverpa armigera densovirus (HaDV2) ב bollworm הכותנה, תנשמית האביב, והציגו ראיות של יחסים הדדיים בין HaDV2 ואת כותנת bollworm 30, 31. במאמר זה, נתאר את פרוטוקול המעבדה ללמוד בפירוט את האינטראקציה בין HaDV2 ומארח bollworm הכותנה שלה. הפרוטוקול המובא כאן יכול להיות גם רלוונטי מאוד לחוקרים לבחון את rאולה של וירוסים דרך הפה-המשודר אחרים, במיוחד מזיקים פרפראים.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. בנייה של המושבה bollworm כותנה HaDV2 נטולת

  1. זחלי bollworm כותנה אחוריים (armigera ח) על דיאטה מלאכותית 32 בחדר צמיחה מבוקר או תא אקלים מלאכותי ב 25 ± 1 ° C, עם 14 אור H / 10 h כהים ולחות יחסית 60%.
  2. לסיוע ההזדווגות-זוג אחד של עשים eclosed החדש באמצעות כלוב פלסטיק לכל זוג (10 ס"מ גובה, 5 ס"מ קוטר) מכוסה גזה כותנה כדי להבטיח אוורור טוב כדי לשמש מצע ההטלה. כדי להגדיל את הסיכוי להשגת מושבה חופשי-וירוס, לנצל לפחות 30 זוגות של הזדווגויות יחיד זוג. מבוגר עשים עדכוני עם פתרון ויטמין סוכר 10% ו 2% 32 ספוג על כדור צמר גפן מתחדשים מדי יום.
  3. כמבוגרי נקבה להטיל את ביציהם על גזת הכותנה כ 2 ימים שלאחר הזדווגות, לשנות את הגזה יומית. אוספים ושומרים ביצים המכיל גזה באותו חדר צמיחה (או צ'אם אקלים מלאכותיבער) כמו עשים בוגרים עד שהביצים בוקעות.
  4. מיד להעביר החדש הזחלים בקעו כדי צלחות 24-היטב חדשה, עם אדם אחד בכל טוב.
  5. חמישה ימים לאחר המועד הראשון הטלה, לאסוף את עשי ההורה ולאחסן אותם בחנקן נוזלי.
    הערה: איסוף העשים 5 ימים ממועד ההטלה הראשון מבטיחה כי ההורים בחיים בנקודת איסוף ולכן נמנעת מכל השפעות אפשריות של שימוש עשים מתים על דיוק מיצוי DNA.
  6. לבודד DNA גנומי דגימות אלה באמצעות ערכת חילוץ DNA על פי הוראות היצרן.
    1. להגביר שבר 574-BP של הגן יקטין עם R פריימרים יקטין F / תקטין (F יקטין: 5-CATCTACGAGGGTTACGC-3 ו- R יקטין: 5-CATCTGTTGGAAGGTGGA-3). דמיין את תגובת השרשרת של פולימראז (PCR) מוצרים באמצעות ג'ל אלקטרופורזה agarose פי פרוטוקולים סטנדרטיים; ההגברה המוצלחת של הגן יקטין מבטיחה כי ה- DNA הוא באיכות טובה.
    2. להעריך tהוא הנוכחות של HaDV2 של עשים ההורה באמצעות PCR עם פריימרים ספציפיים: DVVPF (GGATTGGCCTGGGAAATGAC) ו DVVPR (CGTTGTTTTTATATCCGAGG) 31.
  7. ברגע זוג נקי זוהה, צאצא אחורי מזה זוג לרבייה יחיד HaDV2-נגוע לפחות חמישה דורות ולתחזק זה כמו מושבת HaDV2 חינם (NONINF-הזן); המושבה הנגועה HaDV2 מוגדר-זן INF.
  8. כדי לאשר את מצב זיהום HaDV2 ב-זן NONINF (וכדי לשלול את ההשפעה של חיידקים ידועים או וירוסים על פיתוח המארחת), להעריך את מצב הזיהום עבור HaDV2, Wolbachia, וח 'armigera nucleopolyhedrovirus (HaNPV) בשמונה אנשים זחלי שנבחרו באקראי של-זן NONINF באמצעות PCR (עם פריימרים ספציפיים: DVVPF / DVVPR עבור HaDV2, NPVF / NPVR עבור HaNPV, ו 81F / 691R עבור Wolbachia 31, 33).
    הערה: זה ידוע כי וירוסים מסוימים יכולים להיות מאוחרNT ב המארח הנגוע, עם רמה לגילוי אפילו בעת שימוש בטכניקה מבוססת PCR. טכנולוגיות NGS יכול לשמש כדי לאשר כי אין רצפי ויראלי נמצאים דגימות הדנ"א הגנומי.

2. הכנת HaDV2 המכילים נוזלים נוזלים

הערה: הראינו כי הטיהור ניסתה של חלקיקי וירוס HaDV2 מעכב ההדבקה ואת פעילותם 31; לפיכך, הפרוטוקול הבא מבוצע כדי להשיג את פתרון HaDV2 זיהומיות ידי סינון האנשים שנדבקו HaDV2.

  1. אסוף עשים בוגרים בנפרד ומיד לאחסן אותם בחנקן נוזלי.
  2. לחלוטין לטחון את עשים בודדים שנאספו בחנקן נוזלי בעזרת מכתש ועלי מעוקר. העבר על 10 מיקרוגרם של פסולת אל צינור 1.5-מ"ל נקי. העברת הפסולת הנותרת צינור חדש ומייד לאחסן אותם ב -80 ° C.
  3. תמצית ה- DNA מן 10 מיקרוגרם של פסולת, folloאגף הפרוטוקולים שמספקים יצרן. לאחר DNA עש כבר מבודד, לבדוק HaDV2 באמצעות פרוטוקול, כפי שמתואר בשלב 1.6.
  4. על פי התוצאות שהושגו בשלב 2.3, לחלק את השברים הנותרים לשתי קבוצות: HaDV2-חיוביים HaDV2 שלילי, תלוי מצב הזיהום שלהם. להוסיף 1 מ"ל של בופר פוספט (PBS; 137 מ"מ NaCl, 2.7 מ"מ KCl, 8 מ"מ Na 2 4 HPO, ו 1.5 מ"מ KH 2 PO 4; pH 7.5) לכל פרט לפירוק פסולת הזחל הנותרים לחלוטין.
  5. צנטריפוגה homogenate (משלב 2.4) בשעה 6500 גרם × עבור 15 דקות ב 4 ° C. סנן את supernatant הנוזלי עם מסנן הממברנה 0.22 מיקרומטר. אסוף את הנוזלים המסוננים (200 μL לכל צינור) ומייד לאחסן אותם ב -80 ° C.
    הערה: מסנן הקרום 0.22 מיקרומטר יסנן ביותר של חלקיקים, חיידקים לא הרצויות, ופטריות. ראשית precool בצנטריפוגה כדי 4 מעלות צלזיוס. בצעו את כל הפרוטוקולים involving המבצע של נוזל מסונן על הקרח כדי למנוע את homogenate מלפנות חום קרישה.

3. בנייה של מושבת כותנת bollworm HaDV2 הנגועה

  1. יכולת שידור אופקית של HaDV2
    1. ליצור עקומת תקן HaDV2.
      1. הגבר את שברי המכילים צבעי יסוד (VPF: CTGGTGAGGCGATGGACATG; VPR: TGACAAGATCCAGCGTAGACATC) ואת החללית (VP-בדיקה: GCCACCACTAGAGGACCCACCAGATG), אשר משמשים עבור כימות של הנגיף HaDV2, עם פריימרים דה נובו (PF: GGACAATGCTGGTGAGGC; יחסי ציבור: AATCCTCTTTGTCCGTTATCTATG). השתמש בתכנית הבאה: 30 שניות על 94 מעלות צלזיוס, 30 שניות על 53 מעלות צלזיוס, ו 60 שניות על 72 מעלות צלזיוס למשך 40 מחזורים על מכונת PCR 31. להוסיף 1 μL של DNA גנומי המכיל את הגנום HaDV2 (שלב 2.3) על תגובת PCR 25-μL כמו DNA תבנית. לשבט את שברי מוגבר לתוך וקטור שיבוט פי פרוטוקולים של היצרן.
      2. חשב את עותק מספרפלסמידים עם המשוואה הבאה: עותקים / μL = (A N × C) / (n × M × 10 9), כאשר N A הוא מספר אבוגדרו (6.02 × 10 23 מולקולות / mol); C הוא ריכוז מסה של פלסמידים (ng / μL), אשר ניתן למדוד באמצעות microspectrophotometry; n הוא אורך פלסמיד רקומביננטי המכיל את המוצר PCR (5195 BP); ו- M הוא המשקל המולקולרי של זוג בסיס הממוצע של דנ"א דו-גדילי (660 גר '/ mol).
      3. הכן שישה דילולים סדרתי של פי 10 צינורות microcentrifuge 1.5 מ"ל, עם ריכוזים של 1.5 × 10 9, 1.5 × 10 8, 1.5 × 10 7, 1.5 × 10 6, 1.5 × 10 5, ו 1.5 × 10 מספר עותק 4 / μL.
      4. בצעו תגובת שרשרת של פולימראז כמותיים בזמן אמת (qPCR) באמצעות פריימרים ספציפיים (VPF / VPR) וכן בדיקה (VP-בדיקה) כדי ליצור מחזור threshold (CT) ערכים של פלסמידים שמתואר בשלב 3.1.1.3. בצע שלושה משכפל טכני עצמאי עבורם ממוצע לחישובים נוספים.
      5. שימוש בתוצאות לעיל, ליצור עקומת תקן התאמת ריכוזי HaDV2-טרנספורמציה log2 לערכי CT הממוצעים הנלווים.
    2. לכמת HaDV2 בנוזלי הנוזל המסונן.
      1. Pipet מדגם הבדיקה 100-μL של נוזל נוזל מסונן (שלב 2.6) המכיל HaDV2 להפקת DNA.
      2. השתמש בזמן אמת-qPCR כדי להשיג את ערכי CT עבור הנוזלים הנוזליים ולחשב את מספר העותק באמצעות עקומת הסטנדרט בשלב 3.1.1.
    3. לקבוע את יעילות הזיהום האוראלית עם נוזלים מסוננים נגועים HaDV2 של ריכוזים שונים.
      1. לדלל את נוזל נוזל המכיל HaDV2 הריכוזים הבאים: 10 8, 10 7, 10 6, 10 5, 10 4, ומספר עותק 0 / μL.
      2. מורחים את די מלאכותיתet שווה על צלחת 9 ס"מ קוטר פטרי לפני התמצקות. להתפשט באופן שווה HaDV2 המכיל נוזל מסונן (200 μL) עבור כל ריכוז על פני השטח של הדיאטה המלאכותית המוצקה. האם זה במנדף.
      3. העבר 100 זחלים טריים-בקעו לדיאטה המלאכותית המכילה HaDV2 בצלחת פטרי. בעדינות לדפוק את גזת הכותנה (כולל זחלים טריים-בקעו) להעביר את הזחלים מן הגזה על גיליון נייר לבן. מקציפים את הנייר בעדינות כך משי הזחלים ספין "בלון" מהנייר. שימוש במלקחיים מעוקרים לגעת המשי ולהעביר את זחלי צלחת פטרי.
      4. לאחר 48 שעות, להעביר את הזחלים על הדיאטה המלאכותית צלחות 24-היטב (אדם אחד בכל טוב).
      5. אחורי הזחלים מחוסנים עם HaDV2 בריכוזים מעל לשלב הבגרות.
      6. אסוף את העשים הבוגרים, לחלץ את ה- DNA, וכדי לזהות HaDV2 באמצעות PCR, כמתואר בשלב 1.5.
        הערה: כאן, לקבל שיעור זיהום 100% HaDV2 של שיתוףbollworms tton באמצעות 10 8 עותק מספר / μL ובכך להקים את המושבה HaDV2 נגועים (זן INF).
  2. יכולת שידור אנכית של HaDV2
    1. עשים בוגרים בחר מן NONINF ו INF-זנים כדי ליצור זוגות חד של ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + ו ♀ + / ♂ + (+: חיובי עבור זיהום HaDV2; -: שלילי HaDV2 זיהום).
    2. מעביר את הצאצאים מן הזוגות מעל ל 24 גם צלחות מוירוסים; האחורי הזחלים אל instar השלישי.
    3. חלץ את ה- DNA מן הזחלים instar השלישי שנאספו להשתמש כתבנית כדי לקבוע את הנוכחות של HaDV2, כפי שמתואר בשלב 1.5.

4. חלוקת רקמות של HaDV2

  1. כדי למנוע זיהום מפני וירוסים וחיידקים, לעקר מלקחיים ומספריים 75% אתנול שלוש פעמים ולאחר מכן לחמם אותם הלהבה של נר אלכוהול.
    הערה: sterilizatio מלקחייםn יש צורך כאשר זיהום.
  2. באמצעות איזון אנליטית, לשקול את הצינורות הריקים כי הם לשמש לאחסון ברקמות.
  3. מניח את עשי הזחלים בוגרים מן-זן INF על קרח למשך כ 5 דקות.
  4. לנתח את הרקמות הבאות תחת סטראו זחלים, נשים בוגרות, וזכרים בוגרים בצלחת נקיה פטרי המכילה מאגר PBS.
    1. עבור הזחלים, hemolymph pipet וינתחו במעי הקדמי, midgut, במעי האחורי, גוף שומן, ואת tubules malpighian (איור 1A). מיד להעביר בכל רקמות אל צינורות בחנקן נוזלי.
      1. תקן את הזחלים קפואים על cystosepiment באמצעות שתי סיכות חרקים (200 מיקרומטר קוטר, 20 מ"מ אורך), החדירו לתוך ממברנות בינמיגזריים ליד הראש ואת פלח הבטן האחרון (איור 1A).
      2. חותך את proleg בבטן האחורית של הזחלים כך hemolymph הזחלים זורם החוצה. פיפטה hemolymph זחל בתוך 10 ימים באמצעות micropipette כדי למנוע השחמה ונקרש של hemolymph.
        הערה: Phenylthiourea (50 מיקרוגרם / מ"ל) יכול להיות מעורב בכל יחס 01:20 כרך / כרך עם hemolymph למנוע melanization.
      3. בעזרת זוג מספריים, עושים חתך לציפורן החל הממברנה בינמיגזריים האחרון לראש. לנתח את כל הרקמות שנותרו תחת סטראו באמצעות שני מלקחיים; בתמונה לכל רקמות מוצגות באיור 1 א.
      4. מערבבים דגימות רקמה משלושה אנשים ביחד כמו לשכפל אחד.
      5. כדי למנוע הזיהום של הרקמות שנותרו עם hemolymph במהלך הניתוח, לשטוף את הרקמות הגזורות PBS חיץ שלוש פעמים. ואז, לבדוק את מצב HaDV2-הזיהום של PBS המשמש לשטיפה. אם החיץ לשטוף הסופי הוא HaDV2 ללא, הרקמה צריכה להיות נקיה מזיהום עם hemolymph.
    2. לנשים בוגרות, לנתח את הראש (מוח), שרירים, שומן גוף, בטן, tubules malpighian, שחלה (1B איור) תחת סטראו במאגר PBS. עבור זכרים בוגרים, לנתח את הראש (מוח), שרירים, שומן גוף, בטן, tubules malpighian, ובאשכים (1C איור) תחת סטראו במאגר PBS. מיד להעביר בכל רקמות אל צינורות בחנקן נוזלי.
      1. בעזרת מלקחיים ומספריים, להסיר את הכנפיים של העשים הבוגרים לשטוף את הגוף הנותר שלוש פעמים כדי לנקות את הכף.
      2. הפרד את הראש, החזה, והבטן באמצעות מספריים.
      3. הסר את endoskeleton של בית החזה לאסוף את השריר.
      4. בעזרת מלקחיים, להסיר את העור המת של הבטן לנתח ברקמות האחרות הבאות דמוית 1B ו 1C.
      5. מערבבים את דגימות רקמה משלושה אנשים ביחד כמו לשכפל אחד. שטוף את הרקמות הגזורות PBS חיץ שלוש פעמים.
  5. לשקול את הצינורות ואת הרקמות מעל כשהם הוקפאו ולהבטיח כי מ 'ישבנים של הרקמות השונות הם כמעט שווים.
    Mass (רקמות) = מסה (צינורות / דגימת רקמה) - מסה (צינור בלבד)
  6. חלץ את ה- DNA מן הרקמות הללו ולבצע qPCR, כפי שמתואר בשלב 3.1.2.
  7. חשב את מספר עותק לכל מ"ג של כל רקמות באמצעות עקומת תקן שנוצר בשלב 3.1.1. השתמש כייל הנגיף לכל המונית היחידה לתקן את ההטיה מדגם נגרם כל ההבדל בסך של רקמת משמש להפקת DNA.
  8. חישוב אחוזי HaDV2 ברקמה הספציפית כדלקמן: אחוז HaDV2 לכל רקמות = HaDV2 להעתיק מספר לכל מ"ג / רקמות נבדקות (סכום של מספר עותק לכל מ"ג של כל הרקמות).

5. בדיקת המבדקים והשפעת HaDV2 על פיתוח מארח

  1. מקום לפחות 100 גלמים או עשים בוגרים יצאו זה עתה נגזרו-זן NONINF בכלוב כותנה-גזת מכוסים, 5-L, רשת תיל. אחרי 2 ימים, נשים בוגרות הזדווגו יתחילו להטיל ביצים על גזה כותנה. אוספים ושומריםגזת הכותנה המכילה את הביצים; הביצים יבקעו בעוד כשלוש ימים.
  2. הרכבה של הזחלים הילודים עם HaDV2.
    1. מעביר את הזחלים הילודים של זן NONINF לדיאטה המלאכותית המכילה HaDV2 (מספר עותק 10 8 / μL) כדי להקים את-זן INF.
    2. באופן דומה, להעביר ילוד זחלים לדיאטה המלאכותית מכוסית HaDV2 ללא נוזל מסונן (שלב 2.4) כדי להקים את קבוצות ביקורת (NONINF-זן). יש לכלול לפחות 240 זחלים בכל (איור 2 א) טיפול.
      הערה: זחלים המשמשים לבניית NONINF- ו-זני INF נגזרת מאותו מחזור ההורה בוקע באותו הזמן, הבטיחה מאותו הרקע גנטי. ודא כי-זני INF NONINF- ונשמרים באותו תא האקלים (ב 25 ± 1 ° C, עם 14 אור H / 10 h כהים 60% לחות יחסית) עבור שיעור סינכרוני של פיתוח; השיעור יכול להשתנות בהתאם לתנאי חום ולחות. טפל דליץ 'אכול זחלים בעדינות.
  3. לאחר 48 שעות, להעביר את הזחלים בנפרד צלחות 24-היטב (אדם אחד בכל טוב) (איור 2B).
    1. מספר ברצף כל זחל בכל טוב ולהקליט את במת instar ומצב הישרדות יומיומית.
    2. אודות 5 ימים לאחר מכן, כאשר הדיאטה המלאכותית מידרדר, בו זמנית להעביר אנשים אלה לצלחת 24-היטב חדשה המכילה דיאטה מלאכותית טריה (האיור 2C).
    3. לשקול את הזחלים מיום 7 עד 11-אץ 'פוסט באמצעות איזון אנליטיים עד לדיוק של 0.0001 גרם. לאחר שקילה, בנפרד להחזיר את הזחלים על צלחת 24-היטב.
  4. עם השרה אל instar החמישי לאחר אכדיסיס הרביעי (בסביבות עשר ימים לאחר הבקיעה), להעביר את הזחלים צינורות זכוכית (גובה 10 ס"מ, 2 ס"מ קוטר) (איור 2 ד); הזחלים instar החמישי ניתן לזהות גם על ידי רוחב של הקפסולה הראש (כ 2.6 מ"מ).
    הערה: מעביר את הפרטיםאל צינור הזכוכית בעת ובעונה אחת בכל יום.
    1. קוד כל זחל עם מספר האסמכתא המקורי על שפופרת הזכוכית באמצעות צבע או סמנים. הקלט את מצב הזחל יומי; בתוך צינורות הזכוכית, הזחלים יהיו pupate לאחר כחמישה ימים-במת הגלמים נמשכת כ 11 ימים.
    2. רשמו את התאריך גלמים ו eclosion עבור כל אדם בצינור זכוכית. רשום את המסה של גלמים 3 ימים בת.
  5. לאחר eclosion, לשים נקבה אחת וזכר אחד לכלוב בודד עם 10% סוכרוז פתרון ויטמין 2% (איור 2E). לחדש את תמיסת סוכרוז מדי יום. רשמו את תאריך הפטירה לכל עש.
  6. כאשר הביצים מוטלות, לשנות את גזה כותנה יומי. ספור את מספר הביצים מיד. רוזן צאצאים שזה עתה בקע תוך שהם בוקעים.
  7. במהלך המבדקים, לבחור באקראי שמונה אנשים עבור כל טיפול כדי לאשר את מצב הזיהום של HaDV2. חלץ את RNA הכולל של דגימות אלה באמצעות ריאגנט טריפסין מסחריבעקבות הפרוטוקול של היצרן. לסנתז את cDNA ראשון גדיל בעקבות הפרוטוקול של היצרן ולהשתמש בו כתבנית כדי לבדוק אם הווירוסים עבדו בהצלחה.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Progenies מן ההורים שהיו HaDV2 חינם (איור 3 א) שגדלו כמו-זן NONINF. אנחנו בהצלחה מוגברת הגן יקטין באמצעות אותן תבניות DNA, מה שמרמז כי תבניות DNA היו באיכות טובה (האיור 3B). בנוסף, progenies שמונה שנבחרו באקראי היו גם ללא HaDV2 (איור 3 ג), HaNPV (איור 3D), ו Wolbachia (איור 3E). שוב, הגענו למסקנה כי דגימות DNA של progenies היו באיכות טובה, כי חלק הגן יקטין היה מוגבר בהצלחה לכל בדגימות שנבדקו (איור 3F).

עקומת סטנדרט המגדירה את היחסים בין היומן של איכות חומר ההתחלתי ואת ערכי CT צברו נוצרה, כמו באיור 4. קשר לינארי חזק (R (איור 4).

טרי בקעו זחלים היו מחוסנים עם עקומת סטנדרט נקודת נוזלי נוזלי HaDV2 באמצעות דילולי סדרה של פי 10 בין 10 4 ו 10 8 עותק מספר / μL. השגנו קשר לינארי בין תדירויות זיהום ועל ריכוזי הנוזלים הנוזלים HaDV2; 10 8 עותק מספר / μL הניב זיהום 100% עבור bollworm כותנה, אך בריכוזים אחרים לא (ראה גם שו ואח '. 31). התדרים זיהום HaDV2 של progenies מן ההורים עם סטטוסים זיהום HaDV2 שונים היו כדלקמן: 100% עבור ♀ + / ♂-, 78% עבור ♀- / ♂ +, ו 100% עבור ♀ + / ♂ + (ראה גם שו ואח '. 31).

ל- Correct להבדלים אינדיבידואליים כייל HaDV2, חישבנו את מספר עותק HaDV2 לכל מ"ג של כל רקמת ואחוז כייל HaDV2 הכולל עבור רקמות ספציפיות. התוצאות הראו כי HaDV2 הופץ בעיקר בגוף שומן (איור 5; ראו גם שו ואח '31.). השוואות של פרמטרים השולחן החיים, כולל תקופות הזחל, תקופות גלמים, אורך הבוגרים, וכן פוריות, הוצגו בטבלה 1 (ראה גם שו ואח '. 31). המוני זחל גלמים היו כפי שפורסם על ידי שו והאח '. 31. סטטוסי זיהום HaDV2 הוא זן NONINF ואת-זן INF נקבעו על ידי PCR (תוצאות שפרסמו שו ואח '. 31).

איור 1
איור 1. גזור רקמות (א) זחלים, (B)למבוגרים נקבה, ו (ג) מבוגר זכר. H, ראש (מוח); הוא, hemolymph; FB, שומן; הר, tubules Malpighian; G, בטן; FG, במעי הקדמי; MG, midgut; HG, במעי האחורי; מו, שרירים; O, שחלה; T, אשכים. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2
איור 2. נוהל המבדק לקבוע את ההשפעות של HaDV2 על bollworm כותנה. (א) הרכבה של הזחלים שבקעו זה עתה עם HaDV2. (ב) העברת אנשים HaDV2 הנגועים ואת HaDV2-חופשי צלחות 24-היטב לאחר 48 h. (ג) גדלים שונים של HaDV2 נגוע ויחידים -חינם. (ד) העברת זחלים החמישי-instar כדי צינורות זכוכית חדש (10 ס"מ גובה, 2 ס"מ קוטר). (E) המיקום של אחדנקבת עש זכר אחד לתוך באותו הכלוב לקבוע אריכות ימים מבוגרות, ייצור ביצים, ואת צוהר שיעור. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
מצב זיהום איור 3. עבור HaDV2, HaNPV, או Wolbachia ב HaDV2 הנגועים ואת מושבות HaDV2-חינם. HaDV2 מצב זיהום אצל ההורים הנשיים וגבריים (א). זיהום מעמד של HaDV2 (C), HaNPV (D), ואת Wolbachia (E) progenies שנבחרו באופן אקראי. כדי לבדוק את איכות DNA גנומי, יקטין גן המשק היה מוגבר גם עבור ההורים (ב ') progenies (F). ליין M מציג את סמן DL2000 (2000 BP, 1000 BP, 750 נ"ב, 500 נ"ב, 250 נ"ב, גידולד 100 נ"ב). ליין 1: הורה נקבי. ליין 2: הורה זכר. ליין 3 - 10: progenies. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 4
איור 4. ערכי סף מחזור HaDV2 הריכוזי 2-טרנספורמציה התאמת עקומת סטנדרט יומן (CT). אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 5
איור 5. הפצת Host-רקמה של HaDV2 זחלים (א), נקבה מבוגרת (B), ואת זכר בוגר (C) הכותנה Bollworms. אחוז (%) = היחס של HaDV2 ברקמות שונות (מחיר מ"ג), כמתואר iצעד n 4.7 הנתונים נותחו סטטיסטית באמצעות ניתוח שונה (ANOVA) ולבדוק של Tukey (זחלים: n = 7; זכרים בוגרים: n = 6; נשים בוגרות: n = 6). אמצעי ± SE. התוצאות פורסמו על ידי שו ואח '. 31. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

פרמטרים Life-היסטוריה HaDV2 + HaDV2- ערך t DF ערך P
תקופת זחל (ימים) זָכָר 16.51 (± 0.72) 16.93 (± 1.21) 4.147 379 <0.001
נְקֵבָה 16.51 (± 0.79) 16.80 (± 1.05) 2.732 312 .0067
תקופת גלמים (ימים) זָכָר 13.02 (± 0.68) 13.31 (± 0.69) 4.057 379 <0.001
נְקֵבָה 11.62 (± 0.67) 12.00 (± 0.63) 5.1 312 <0.001
אריכות ימים של מבוגרים (ימים) זָכָר 10.69 (± 1.98) 10.93 (± 2.46) 0.915 367 0.36
נְקֵבָה 9.07 (± 1.98) 8.51 (± 1.58) 2.992 367 0.003
מספר ביצים המיוצרות בכל נשי 482 (± 174) 403 (± 180) 2.172 93 0.032
מספר וציירה לכל נקבה 207 (± 108) 143 (± 99) 3.026 93 .0032

טבלה 1. פרמטרים Life-היסטוריה עבור HaDV2 + ו HaDV2-כותנה Bollworms. מבחן t משמש כדי לקבוע את רמת המובהקות. אמצעי ± SE מוצג. נתונים המוצגים בטבלה זו פורסמו על ידי שו ואח '. 31.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

בעשורים האחרונים, רוב המחקרים על אינטראקציות חרקים-וירוס התמקדו בריאות דבש דבורים 34, 35, 36, וקטורים של מחלות אנושיות 37, צמח וירוסי 38, וכמה וירוסים פתוגניים חרקים שיש פוטנציאל גדול כמו סוכנים בקרה ביולוגית 39. מעט תשומת לב הוקדש וירוסים סמויים חרקים, בעיקר מזיקים פרפראים. כאן, אנו מציגים פרוטוקול המחקר של האינטראקציות בין וירוס סמוי חרקי המארח שלו. השוואה בין פרמטרי שולחן חיים עבור אנשים מארחים הנגוע בנגיף ו-וירוס בחינם רצוי לכלול כל השפעה של הבדלי רקע גנטי מארח. כדי ללמוד את הפנוטיפ ויראלי, מחקרים קודמים רבים השוו את פרמטרי שולחן החיים או יחידים נגועים באופן טבעי או נגועים באותה המושבה או יחידים מחוסניםעל ידי microinjection, אבל המאמץ הזה הוא גוזל זמן 23, 40. החיסון האוראלי של bollworms כותנה עם HaDV2, המתוארת כאן, משמש כאמצעי פשוט ויעיל לנתח פנוטיפים ויראלי. הליך זה גם מבטיח את הרקע הגנטי זהה עבור HaDV2 הנגועים ואת HaDV2-נגוע המושבות.

בידוד וירוס ניתן להכין בדרכים רבות. טיהור חלקיקי נגיף באמצעות צנטריפוגה במהירות גבוהה מעכב הדבקה בנגיף, וכתוצאה מכך ההדבקה נמוכה; ומכאן, נוזל מסונן המכילים וירוסים שימש להדביק את bollworm זחלי כותנה 31. עובדת קרום 0.22 מיקרומטר לסנן את רוב פטרייתיים וחלקיקי חיידקי HaDV2 המכיל נוזל מסונן וכי הנוזל המסונן ללא HaDV2 שמש השליטה עלול שלא לכלול את ההשפעה של וירוסים אחרים על התוצאות שלנו. עם זאת, אנחנו לא יכולים לשלול את האפשרות כי תוצאות המבדק היה מסוגל לקשרסימפוני להיות מוטה על ידי וירוסים ידועים. לפיכך, חלקיקי HaDV2 עם הדבקה גבוהה באופן אידיאלי צריכים להיות מטוהר בעתיד כדי להשיג תוצאות חזקות.

ריכוז הנגיף בקורלציה חיובית עם הדבקה בנגיף; ומכאן, היינו מעוניינים בקביעת ריכוז HaDV2 כי יניב 100 זיהומי%. התוצאות שלנו הראו כי מספר 10 8 העתק / μL יכול לשמש עבור חיסון וירוס להשיג שיעור הזיהום הזה. אין ספק, הקורלציה בין כייל הנגיף וקצב זיהום צריכה להילמד עבור אינטראקציות וירוס-host אחרים למדו בעתיד. בנוסף, כייל הנגיף של כל אדם בתחום צריך גם להיחקר. לפיכך, נוכל אז לדמות את ההשפעה של וירוסים על אנשים בתחום.

הטיפול העדין של הזחלים העדינים במהלך הימים הראשונים לאחר שהם הבוקעים חשוב מאוד, כי הם בקלות האנושות פגום. יתר על כן, col HaDV2-נגועony צריך להישמר בנפרד בחממה כדי למנוע HaDV2 זיהום-שיעור הזיהום של HaDV2 כבר מצאו להיות מאוד גבוהה, הן בתחום ובמעבדה 31.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

החוקרים מצהירים כי אין להם אינטרסים כלכליים מתחרים.

Acknowledgments

עבודה זו נתמכה על ידי תכנית המחקר הלאומית מפתח הבסיסי של סין (מס 2013CB127602) וקרן המדע עבור Creative מחקר קבוצות של הקרן הלאומית למדע של סין (מס '31,321,004).

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
פרוטוקולים לחקירת הפצת Host-הרקמה, הילוכים-mode, ואת ההשפעה על כושר Host של Densovirus ב bollworm הכותנה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter