Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Immunology and Infection

कपास bollworm में होस्ट-ऊतक वितरण, पारेषण मोड, और एक Densovirus की होस्ट स्वास्थ्य पर प्रभाव की जांच के लिए प्रोटोकॉल

doi: 10.3791/55534 Published: April 12, 2017

Summary

यहाँ, हम मेजबान ऊतक वितरण, पारेषण मोड, और प्रभाव एक densovirus के मेजबान फिटनेस पर एक lepidopteran प्रजाति के भीतर, कपास bollworm की जांच के लिए एक प्रोटोकॉल प्रस्तुत करते हैं। यह प्रोटोकॉल भी अन्य मौखिक रूप से प्रेषित वायरस और उनके कीट मेजबान के बीच बातचीत के अध्ययन के लिए इस्तेमाल किया जा सकता।

Abstract

कई उपन्यास वायरस अगली पीढ़ी के अनुक्रमण प्रौद्योगिकी का उपयोग कर पशु मेजबान में पाया गया है। इससे पहले, हम एक lepidopteran प्रजातियों में, पारस्परिक वायरस, Helicoverpa armigera densovirus (HaDV2) ने बताया, कपास bollworm, Helicoverpa armigera (Hübner)। यहाँ, हम प्रोटोकॉल है कि वर्तमान में अपने मेजबान पर HaDV2 के प्रभाव का अध्ययन करने के लिए उपयोग किया जाता है का वर्णन। सबसे पहले, हम एक भी प्रजनन जोड़ी से एक HaDV2 मुक्त कपास bollworm उपनिवेश की स्थापना। एक HaDV2 संक्रमित, अन्य असंक्रमित: तो फिर, हम मौखिक रूप से फ़िल्टर किए गए तरल HaDV2 युक्त एक ही आनुवंशिक पृष्ठभूमि के साथ दो कालोनियों का निर्माण करने के साथ कुछ नवजात शिशु लार्वा वंश टीका। एक प्रोटोकॉल HaDV2 संक्रमित और -uninfected व्यक्तियों भी प्रस्तुत किया जाता है के बीच जीवन तालिका मानकों (जैसे, लार्वा, पोटा संबंधी, और वयस्क अवधि और उपजाऊपन) की तुलना करने, के रूप में मेजबान ऊतक वितरण और HaDV2 का संचरण क्षमता का निर्धारण करने के लिए प्रोटोकॉल है। इन प्रोटोकॉल would भी अपने कीट होस्ट करता है, विशेष रूप से lepidopteran होस्ट पर अन्य मौखिक रूप से प्रेषित वायरस के प्रभाव की जांच के लिए उपयुक्त हो।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

पिछले कुछ दशकों में, इस तरह अगली पीढ़ी के अनुक्रमण के रूप में अनुक्रमण प्रौद्योगिकी के विकास (NGS) कई उपन्यास डीएनए और आरएनए वायरस, विशेष रूप nonpathogenic वायरस, लेकिन यह भी पहले से ज्ञात वायरस 1, 2, 3 के उपन्यास आइसोलेट्स की खोज में मदद की है, 4, 5, 6, 7, 8, 9, 10, 11, 12। मॉडल जीव ड्रोसोफिला मेलानोगास्टर में, 20 से अधिक नई आंशिक वायरस जीनोम metagenomic तकनीक 13 का उपयोग कर पाया गया है। उपन्यास वायरस सहित कई वायरल दृश्यों,, भी इस तरह के मधु मक्खियों, मीटर के रूप में अन्य कीड़े, में पहचान की गई हैosquitoes, एशियाई खट्टे psyllids, dragonflies, और कई lepidopteran प्रजातियों 14, 15, 16, 17, 18, 19, 20, 21।

भविष्य में, यह उम्मीद की जा सकती है कि और अधिक उपन्यास वायरस इन उन्नत प्रौद्योगिकी का उपयोग कर कीड़ों में खोज की जाएगी; इसलिए, वायरस मेजबान बातचीत के बारे में हमारी समझ के हिसाब से 6 से 9 बदल सकता है,। उदाहरण के लिए, वायरस मेजबान बातचीत, पहले सोचे तुलना में अधिक जटिल माना जाता है, क्योंकि कई उपन्यास वायरस के बजाय पारस्परिक भागीदारों सख्त रोगजनकों 22 के रूप में परिभाषित किया जा रहा है। उदाहरण के लिए, Dysaphis plantaginea में पारस्परिक densovirus DplDNV पंखों वाला रूप प्रेरित करता है और गतिशीलता बढ़ जाती है, वायरस 23 के साथ ही मेजबान के प्रसार की सुविधा। इसके अलावा, पारस्परिक वायरस स्तनधारी स्वास्थ्य, सूखा और पौधों की ठंड सहिष्णुता, और बैक्टीरिया के संक्रमण 24 के प्रभाव के संबंध में वर्णित किया गया है। सेनेका घाटी वायरस-001 ट्यूमर कोशिकाओं की ओर चयनात्मक cytotoxicity मध्यस्थता करने neuroendocrine कैंसर के साथ सुविधाओं 25 दिखाया गया है। हेपेटाइटिस ए वायरस के संक्रमण हेपेटाइटिस सी वायरस प्रतिकृति को दबाने और हेपेटाइटिस सी 26 से वसूली हो सकती है। दाद विलंबता जीवाणु संक्रमण 27 से सहजीवी सुरक्षा प्रदान करता है। मानव अंतर्जात रेट्रोवायरस HERV-W के लिफाफा ग्लाइकोप्रोटीन तिल्ली परिगलन वायरस 28 के लिए सेलुलर प्रतिरोध प्रेरित करता है। Curvularia थर्मल सहिष्णुता वायरस (CThTV) एक कवक endophyte से इस कवक और एक उष्णकटिबंधीय आतंक घास के बीच पारस्परिक बातचीत में शामिल हैरेफरी "> 29। इसलिए, नव पाया वायरस और उनके मेजबानों के बीच संबंधों का ज्ञान उनके जीव विज्ञान और प्रबंधन पर नए दृष्टिकोण उत्पन्न करनी चाहिए। हालांकि, उपन्यास वायरस, विशेष रूप गुप्त वायरस तीव्र संक्रमण के विशिष्ट कोई स्पष्ट संकेत प्रदर्शित करने, शायद ही कभी किया है जांच की गई है, और हम एक पाइप लाइन और प्रोटोकॉल की जरूरत है उनके मेजबानों पर नव पाया वायरस के प्रभावों की जांच के लिए।

इससे पहले, हम कपास bollworm, Helicoverpa armigera में प्रसार के लिए एक नया monosense densovirus Helicoverpa armigera densovirus (HaDV2) ने बताया, और HaDV2 और कपास bollworm 30, 31 के बीच पारस्परिक सम्बन्ध का सबूत प्रस्तुत किया है। इस पत्र में, हम विस्तार से HaDV2 और उसके कपास bollworm मेजबान के बीच बातचीत का अध्ययन करने के प्रयोगशाला प्रोटोकॉल का वर्णन करेंगे। यहाँ प्रस्तुत प्रोटोकॉल भी आर की जांच शोधकर्ताओं के लिए बेहद प्रासंगिक हो सकता हैअन्य मौखिक रूप से प्रेषित वायरस के OLE, विशेष रूप से lepidopteran कीटों में।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. HaDV2 मुक्त कपास bollworm कॉलोनी का निर्माण

  1. रियर कपास bollworm लार्वा (एच armigera) एक नियंत्रित विकास के कमरे या एक कृत्रिम जलवायु चैम्बर में एक कृत्रिम आहार 32 पर 25 ± 1 डिग्री सेल्सियस पर 14 घंटे प्रकाश / 10 ज अंधेरे और 60% सापेक्ष आर्द्रता के साथ।
  2. प्रति जोड़ी एक प्लास्टिक पिंजरे (10 सेमी ऊंचाई, 5 सेमी व्यास) कपास जाली के साथ कवर का उपयोग कर अच्छा वेंटिलेशन सुनिश्चित करने के लिए और एक oviposition सब्सट्रेट के रूप में सेवा करने के लिए द्वारा नव eclosed पतंगों की एकल जोड़ी संभोग सहायता। एक वायरस मुक्त कॉलोनी प्राप्त करने की संभावना में वृद्धि करने के लिए, एकल जोड़ी संभोग की कम से कम 30 जोड़े का उपयोग करें। एक 10% चीनी और 2% विटामिन समाधान 32 के साथ फ़ीड वयस्क पतंगों एक कपास की गेंद पर लथपथ और दैनिक मंगाया।
  3. महिला वयस्कों के बाद संभोग लगभग 2 दिनों कपास जाली पर अपने अंडे के रूप में, जाली दैनिक बदल जाते हैं। इकट्ठा करने और एक ही विकास कमरे में जाली युक्त अंडे (या कृत्रिम जलवायु चाम बनाए रखने केबेर) अंडे पक्षियों के बच्चे जब तक वयस्क पतंगों के रूप में।
  4. इसके तत्काल बाद एक व्यक्ति के साथ, नए 24-अच्छी तरह से प्लेटों के लिए नवजात लार्वा हस्तांतरण प्रति अच्छी तरह से।
  5. पांच दिन पहले अंडा बिछाने की तारीख के बाद, माता पिता पतंगों को इकट्ठा करने और उन्हें तरल नाइट्रोजन में संग्रहीत करते हैं।
    नोट: 5 दिनों पहले अंडा बिछाने की तारीख के बाद पतंगों एकत्रित सुनिश्चित करता है कि माता-पिता संग्रह के बिंदु पर जीवित हैं और इसलिए डीएनए निष्कर्षण सटीकता पर मृत पतंगों का उपयोग कर के किसी भी संभावित प्रभावों से बचा जाता है।
  6. इन निर्माता के निर्देशों के अनुसार एक डीएनए निष्कर्षण किट का उपयोग नमूनों से जीनोमिक डीएनए अलग।
    1. प्राइमरों actin एफ / actin आर के साथ actin जीन की एक 574 बी.पी. टुकड़ा बढ़ाना (actin एफ: 5-CATCTACGAGGGTTACGC -3 और actin आर: 5-CATCTGTTGGAAGGTGGA -3)। पोलीमरेज़ चेन प्रतिक्रिया (पीसीआर) मानक प्रोटोकॉल के अनुसार agarose जेल वैद्युतकणसंचलन का उपयोग करके उत्पादों कल्पना; actin जीन की सफल प्रवर्धन सुनिश्चित करता है कि डीएनए अच्छी गुणवत्ता का है।
    2. टी का आकलन करेंवह विशिष्ट प्राइमरों के साथ पीसीआर का उपयोग कर माता पिता पतंगों में HaDV2 की उपस्थिति: DVVPF (GGATTGGCCTGGGAAATGAC) और DVVPR (CGTTGTTTTTATATCCGAGG) 31।
  7. एक बार एक साफ जोड़ी पहचान की गई है कम से कम पांच पीढ़ियों के लिए है कि एकल HaDV2-uninfected प्रजनन जोड़ी से, पीछे वंश और HaDV2 मुक्त कॉलोनी (NONINF तनाव) के रूप में इस को बनाए रखने; HaDV2 संक्रमित कॉलोनी INF तनाव के रूप में परिभाषित किया गया है।
  8. NONINF तनाव में HaDV2 संक्रमण की स्थिति की पुष्टि करने के लिए (और ज्ञात बैक्टीरिया या मेजबान विकास पर वायरस के प्रभाव को बाहर करने के लिए), संक्रमण आठ बेतरतीब ढंग से चुना लार्वा व्यक्तियों में HaDV2, Wolbachia, और एच armigera nucleopolyhedrovirus (HaNPV) के लिए स्थिति का मूल्यांकन (: HaDV2, HaNPV के लिए NPVF / NPVR के लिए DVVPF / DVVPR, और Wolbachia 31 के लिए 81F / 691R, 33 विशिष्ट प्राइमरों के साथ) NONINF तनाव पीसीआर का उपयोग करने का।
    नोट: यह ज्ञात है कि कुछ वायरस देर हो सकता हैNT संक्रमित मेजबान, एक स्तर भी undetectable है जब एक पीसीआर आधारित तकनीक का उपयोग कर के साथ में। NGS प्रौद्योगिकियों पुष्टि करने के लिए है कि कोई वायरल दृश्यों जीनोमिक डीएनए के नमूने में मौजूद हैं इस्तेमाल किया जा सकता।

2. HaDV2 युक्त तरल तरल पदार्थ की तैयारी

ध्यान दें: हम पता चला है कि HaDV2 वायरस कणों की शुद्धि का प्रयास उनके संक्रामकता और गतिविधि 31 को रोकता है; इसलिए, निम्नलिखित प्रोटोकॉल HaDV2-संक्रमित व्यक्तियों छान कर संक्रामक HaDV2 समाधान प्राप्त करने के लिए किया जाता है।

  1. व्यक्तिगत रूप से वयस्क पतंगों को एकत्र करें और तुरंत उन्हें तरल नाइट्रोजन में संग्रहीत करते हैं।
  2. पूरी तरह से एक निष्फल मोर्टार और मूसल का उपयोग कर तरल नाइट्रोजन में एकत्र व्यक्तिगत पतंगों पीस लें। एक साफ 1.5 एमएल ट्यूब के बारे में 10 माइक्रोग्राम प्रति मलबे के स्थानांतरण। एक नया ट्यूब को शेष मलबे स्थानांतरण और तुरंत उन्हें -80 डिग्री सेल्सियस पर दुकान।
  3. मलबे के 10 माइक्रोग्राम से डीएनए निकाल, folloविंग निर्माता द्वारा प्रदान प्रोटोकॉल। एक बार जब कीट डीएनए अलग-थलग कर दिया गया है, कदम 1.6 में वर्णित है, प्रोटोकॉल का उपयोग HaDV2 लिए जाँच करें।
  4. , HaDV2 पॉजिटिव और HaDV2 नकारात्मक उनके संक्रमण की स्थिति पर निर्भर करता है: कदम 2.3 में प्राप्त परिणामों के अनुसार, दो समूहों में शेष मलबे विभाजित करते हैं। फॉस्फेट बफर खारा के 1 एमएल जोड़ें (पीबीएस, 137 मिमी NaCl, 2.7 मिमी KCl, 8 मिमी ना 2 HPO 4, और 1.5 मिमी के.एच. 2 पीओ 4; पीएच 7.5) प्रत्येक व्यक्ति के लिए पूरी तरह से शेष लार्वा मलबे भंग करने के लिए।
  5. अपकेंद्रित्र homogenate 4 डिग्री सेल्सियस पर 15 मिनट के लिए 6500 × छ (कदम 2.4 से)। एक 0.22-सुक्ष्ममापी झिल्ली फिल्टर के साथ तरल सतह पर तैरनेवाला फ़िल्टर। फ़िल्टर किए गए तरल पदार्थ (ट्यूब प्रति 200 μL) को एकत्र करें और तुरंत उन्हें -80 डिग्री सेल्सियस पर दुकान।
    ध्यान दें: 0.22-सुक्ष्ममापी झिल्ली फिल्टर अवांछनीय कण, जीवाणु और कवक के सबसे को फ़िल्टर कर देगा। सबसे पहले 4 डिग्री सेल्सियस के लिए अपकेंद्रित्र precool। सभी प्रोटोकॉल प्रदर्शन करना involviबर्फ पर तरल फ़िल्टर कर दी जाती आपरेशन एनजी भूरे रंग बदल और coagulating से homogenate को रोकने के लिए।

3. HaDV2 संक्रमित कपास bollworm कॉलोनी का निर्माण

  1. HaDV2 की क्षैतिज संचरण क्षमता
    1. एक HaDV2 मानक वक्र उत्पन्न करें।
      1. और जांच (VP-जांच: GCCACCACTAGAGGACCCACCAGATG) है, जो HaDV2 वायरस की मात्रा के लिए उपयोग किया जाता है, नए सिरे से प्राइमरों के साथ:;: (TGACAAGATCCAGCGTAGACATC VPR CTGGTGAGGCGATGGACATG VPF) प्राइमरों युक्त टुकड़े बढ़ाना (पीएफ: GGACAATGCTGGTGAGGC; पीआर: AATCCTCTTTGTCCGTTATCTATG)। एक पीसीआर मशीन 31 पर 40 चक्र के लिए 72 डिग्री सेल्सियस पर 94 डिग्री सेल्सियस पर 30 है, 53 डिग्री सेल्सियस पर 30, और 60 रों: निम्नलिखित प्रोग्राम का उपयोग करें। जीनोमिक डीएनए HaDV2 जीनोम युक्त (कदम 2.3) के 1 μL टेम्पलेट डीएनए के रूप में 25 μL पीसीआर प्रतिक्रिया में जोड़े। निर्माता के प्रोटोकॉल के अनुसार एक क्लोनिंग वेक्टर में परिलक्षित टुकड़े क्लोन।
      2. की प्रतिलिपि संख्या की गणना करेंनिम्न समीकरण के साथ प्लास्मिड: प्रतियां / μL = (एन सी × ए) / (एन × एम × 10 9), जहां n एक एवोगेड्रो की संख्या (6.02 × 10 23 अणु / मोल) है; सी प्लास्मिड (एनजी / μL) है, जो microspectrophotometry मापा जा सकता है की बड़े पैमाने पर एकाग्रता है, n पुनः संयोजक पीसीआर उत्पाद (5195 बीपी) से युक्त प्लाज्मिड की लंबाई है; और एम दोहरे धागे डीएनए (660 ग्राम / मोल) के एक औसत आधार जोड़ी के आणविक भार है।
      3. छह 10 गुना धारावाहिक dilutions 1.5 एमएल microcentrifuge ट्यूबों में, 1.5 × 10 9 की सांद्रता के साथ, 1.5 × 10 8, 1.5 × 10 7, 1.5 × 10 6, 1.5 × 10 5, और 1.5 × 10 4 प्रतिलिपि संख्या तैयार करें / μL।
      4. वास्तविक समय मात्रात्मक पोलीमरेज़ चेन प्रतिक्रिया (qPCR) विशिष्ट प्राइमरों (VPF / VPR) और एक जांच (VP-जांच) का उपयोग चक्र thre उत्पन्न करने के लिए प्रदर्शन करनाshold (सीटी) कदम 3.1.1.3 में वर्णित प्लास्मिड के मूल्यों। तीन स्वतंत्र तकनीकी replicates प्रदर्शन करना और आगे की गणना के लिए उनका औसत।
      5. ऊपर दिए गए परिणामों का उपयोग करना, एक मानक वक्र संबंधित औसतन सीटी मूल्यों के log2-बदल HaDV2 सांद्रता सम्बंधित उत्पन्न करते हैं।
    2. फ़िल्टर किए गए तरल तरल पदार्थ में HaDV2 यों।
      1. Pipet फ़िल्टर किए गए तरल द्रव (कदम 2.6) डीएनए निष्कर्षण के लिए HaDV2 युक्त एक 100 μL परीक्षण नमूना।
      2. तरल तरल पदार्थ के लिए सीटी मान प्राप्त और गणना प्रतिलिपि संख्या कदम 3.1.1 में मानक वक्र का उपयोग करने के लिए वास्तविक समय-qPCR का उपयोग करें।
    3. विभिन्न सांद्रता के तरल पदार्थ फ़िल्टर्ड HaDV2 संक्रमित के साथ मौखिक संक्रमण क्षमता का निर्धारण।
      1. निम्नलिखित सांद्रता के HaDV2 युक्त तरल द्रव पतला: 10 8, 10 7, 10 6, 10 में 5, 10 4, और 0 प्रतिलिपि संख्या / μL।
      2. कृत्रिम di फैलाएट समान रूप से solidification से पहले एक 9 सेमी व्यास पेट्री डिश पर। समान रूप से ठोस कृत्रिम आहार की सतह पर प्रत्येक एकाग्रता के लिए HaDV2 युक्त फ़िल्टर किए गए तरल (200 μL) में फैल गया। एक धूआं हुड में ऐसा करें।
      3. एक पेट्री डिश में HaDV2 युक्त कृत्रिम आहार के लिए 100 ताजा रची लार्वा स्थानांतरित करें। धीरे सफेद कागज के एक पत्रक के लिए जाली से लार्वा हस्तांतरण करने के लिए (ताजा रची लार्वा सहित) कपास जाली दस्तक। धीरे कागज मारो ताकि लार्वा स्पिन रेशम और कागज़ से बाहर "गुब्बारा"। निष्फल संदंश का प्रयोग रेशम को छूने और एक पेट्री डिश के लिए लार्वा स्थानांतरित करने के लिए।
      4. 48 घंटे के बाद, 24-अच्छी तरह से प्लेटों के लिए कृत्रिम आहार (अच्छी तरह से प्रति एक व्यक्ति) पर लार्वा हस्तांतरण।
      5. रियर लार्वा वयस्क चरण के लिए ऊपर सांद्रता में HaDV2 के साथ टीका।
      6. वयस्क पतंगों एकत्र करें, डीएनए निकाल, और कदम 1.5 में वर्णित के रूप HaDV2, पीसीआर का उपयोग कर पता लगा।
        ध्यान दें: यहाँ, सह की एक 100% HaDV2 संक्रमण दर प्राप्तtton 10 8 प्रतिलिपि संख्या / μL का उपयोग कर और इस तरह HaDV2 संक्रमित कॉलोनी (INF तनाव) की स्थापना bollworms।
  2. HaDV2 के सीधे संचरण क्षमता
    1. के लिए नकारात्मक: -; HaDV2 संक्रमण के लिए सकारात्मक: NONINF और INF-उपभेदों से चुनें वयस्क पतंगों की ♀- / ♂-, ♀ + / ♂-, ♀- / ♂ + और ♀ + / ♂ + (+ एकल जोड़े उत्पन्न करने के लिए HaDV2 संक्रमण)।
    2. वायरस मुक्त 24-अच्छी तरह से प्लेटों के लिए ऊपर जोड़े से वंश स्थानांतरण; पीछे तीसरे इनस्टार के लार्वा।
    3. टेम्पलेट के रूप में उपयोग करने के लिए कदम 1.5 में वर्णित है, HaDV2 की उपस्थिति का निर्धारण करने के लिए एकत्र तीसरे इनस्टार लार्वा से डीएनए निकालें।

4. HaDV2 के ऊतक वितरण

  1. वायरस और बैक्टीरिया से संक्रमण को रोकने के लिए 75% इथेनॉल में संदंश और कैंची नसबंदी तीन बार और फिर उन्हें एक शराब दीपक की लौ में गर्म करें।
    नोट: चिमटा sterilizatioजब संदूषण होता n आवश्यक है।
  2. एक विश्लेषणात्मक संतुलन का उपयोग करना, खाली ट्यूब कि ऊतकों स्टोर करने के लिए इस्तेमाल किया जाएगा वजन।
  3. बर्फ पर INF-तनाव से लार्वा और वयस्क पतंगों लगभग 5 मिनट के लिए रखें।
  4. पीबीएस बफर युक्त एक साफ पेट्री डिश में लार्वा, वयस्क मादा, और वयस्क पुरुषों में stereomicroscope के तहत निम्नलिखित ऊतकों काटना।
    1. लार्वा, pipet hemolymph और अग्रांत्र, आद्यमध्यांत्र, पश्चांत्र, वसा शरीर काटना, और Malpighian tubules (चित्रा 1 ए) के लिए। इसके तत्काल बाद तरल नाइट्रोजन में ट्यूबों के लिए प्रत्येक ऊतक हस्तांतरण।
      1. Cystosepiment पर जमे हुए लार्वा दो कीट पिन (व्यास में 200 सुक्ष्ममापी, लंबाई में 20 मिमी), सिर के पास intersegmental झिल्ली और पिछले पेट खंड (चित्रा 1 ए) में डालने का उपयोग कर ठीक करें।
      2. लार्वा के पीछे पेट में proleg कट इतना है कि लार्वा hemolymph बाहर बहती है। 10 एस के भीतर लार्वा hemolymph एक microp का उपयोग कर पिपेटipette भूरापन और hemolymph के coagulating को रोकने के लिए।
        नोट: phenylthiourea (50 माइक्रोग्राम / एमएल) melanization को रोकने के लिए hemolymph के साथ 1:20 वॉल / वॉल अनुपात में मिलाया जा सकता है।
      3. कैंची की एक जोड़ी का उपयोग करना, सिर के पिछले intersegmental झिल्ली से लेकर छल्ली में एक चीरा बनाते हैं। एक stereomicroscope दो संदंश का उपयोग कर के तहत सभी शेष ऊतकों काटना; प्रत्येक ऊतक के लिए चित्र चित्रा 1 ए में दिखाया गया है।
      4. एक साथ तीन व्यक्तियों से ऊतक के नमूने मिक्स एक दोहराने के रूप में।
      5. विच्छेदन के दौरान hemolymph के साथ शेष ऊतकों के प्रदूषण को रोकने के लिए, धो पीबीएस में विच्छेदित ऊतकों तीन बार बफ़र। फिर, कपड़े धोने के लिए इस्तेमाल किया पीबीएस के HaDV2-संक्रमण की स्थिति का परीक्षण करें। यदि अंतिम धोने बफर HaDV2 से मुक्त है, ऊतक hemolymph के साथ संक्रमण से साफ होना चाहिए।
    2. वयस्क महिलाओं के लिए, सिर (मस्तिष्क), मांसपेशियों, वसा शरीर, पेट, Malpighian tubules, और अंडाशय (काटनाचित्रा 1 बी) पीबीएस बफर में stereomicroscope के तहत। वयस्क पुरुषों के लिए, पीबीएस बफर में stereomicroscope के तहत सिर (मस्तिष्क), मांसपेशियों, वसा शरीर, पेट, Malpighian tubules, और वृषण (चित्रा 1C) काटना। इसके तत्काल बाद तरल नाइट्रोजन में ट्यूबों के लिए प्रत्येक ऊतक हस्तांतरण।
      1. संदंश और कैंची का प्रयोग, वयस्क पतंगों के पंखों को हटा दें और शेष शरीर तराजू स्पष्ट करने के लिए तीन बार धोएं।
      2. अलग सिर, छाती और पेट कैंची का उपयोग कर।
      3. छाती के अन्तःपंजर निकालें और मांसपेशियों को इकट्ठा।
      4. संदंश का प्रयोग, पेट की छल्ली हटाने और आंकड़े 1 बी और 1C निम्नलिखित अन्य ऊतकों काटना।
      5. एक साथ तीन व्यक्तियों से ऊतक के नमूने मिक्स एक दोहराने के रूप में। धो पीबीएस में विच्छेदित ऊतकों तीन बार बफ़र।
  5. ट्यूब और इसके बाद के संस्करण के ऊतकों का वजन जब वे जमे हुए किया गया है और यह सुनिश्चित करें कि मीटरविभिन्न ऊतकों की गधे लगभग बराबर हैं।
    मास (ऊतकों) = द्रव्यमान (ट्यूबों / ऊतक का नमूना) - बड़े पैमाने पर (केवल ट्यूब)
  6. इन ऊतकों से डीएनए निकाल और qPCR, कदम 3.1.2 में वर्णित के रूप में प्रदर्शन।
  7. कदम 3.1.1 में उत्पन्न मानक वक्र का उपयोग कर प्रत्येक ऊतक के मिलीग्राम प्रति प्रतिलिपि संख्या की गणना। नमूना डीएनए निष्कर्षण के लिए इस्तेमाल किया ऊतक की राशि में कोई अंतर से अछूती के लिए सही करने के लिए इकाई द्रव्यमान प्रति वायरस अनुमापांक का प्रयोग करें।
  8. इस प्रकार विशिष्ट ऊतकों में HaDV2 के प्रतिशत की गणना: प्रत्येक ऊतक के लिए HaDV2 का प्रतिशत = HaDV2 परीक्षण किया ऊतक / (सभी ऊतकों की मिलीग्राम प्रति प्रतिलिपि संख्या का योग) की मिलीग्राम प्रति नंबर की प्रतिलिपि बनाएँ।

5. bioassays परीक्षण होस्ट विकास पर HaDV2 का प्रभाव

  1. जगह कम से कम 100 प्यूपा या नव उभरा वयस्क पतंगों एक कपास-जाली से ढके, 5 एल, तार जाल पिंजरे में NONINF तनाव से ली गई। 2 दिनों के बाद, mated वयस्क मादा कपास जाली पर अंडे देना शुरू कर देंगे। इकट्ठा करने और बनाए रखने केकपास अंडे युक्त जाली; अंडे के बारे में तीन दिन में बच्चे निकलते होंगे।
  2. HaDV2 साथ नवजात शिशु लार्वा के टीका।
    1. कृत्रिम आहार HaDV2 (10 8 प्रतिलिपि संख्या / μL) युक्त INF तनाव की स्थापना के लिए करने के लिए NONINF तनाव का नवजात शिशु लार्वा स्थानांतरित करें।
    2. इसी तरह, कृत्रिम आहार तरल फ़िल्टर किया HaDV2 मुक्त (कदम 2.4) नियंत्रण समूहों (NONINF तनाव) स्थापित करने के लिए के साथ कवर करने के लिए नवजात शिशु लार्वा हस्तांतरण। प्रत्येक उपचार (चित्रा 2 ए) में कम से कम 240 लार्वा को शामिल करें।
      नोट: लार्वा कि NONINF- और INF-उपभेदों के निर्माण के लिए उपयोग किया जाता है एक ही समय में एक ही मूल पलटन और पक्षियों के बच्चे से प्राप्त कर रहे, एक ही आनुवंशिक पृष्ठभूमि को सुनिश्चित करना। सुनिश्चित करें कि NONINF- और INF-उपभेदों के विकास का एक तुल्यकालिक दर के लिए (14 ज प्रकाश / 10 ज अंधेरे और 60% सापेक्ष आर्द्रता के साथ 25 ± 1 डिग्री सेल्सियस पर,) एक ही जलवायु चैम्बर में रखा जाता है करो; दर तापमान और आर्द्रता के आधार पर भिन्न हो सकते हैं। डेलिक संभाललार्वा धीरे खा लिया।
  3. 48 घंटे के बाद, 24-अच्छी तरह से प्लेट (अच्छी तरह से प्रति एक व्यक्ति) (चित्रा 2 बी) के लिए व्यक्तिगत रूप से लार्वा हस्तांतरण।
    1. क्रमिक रूप से संख्या प्रत्येक कुएं में प्रत्येक लार्वा और दैनिक इनस्टार मंच और अस्तित्व स्थिति रिकॉर्ड है।
    2. के बारे में 5 दिन बाद, जब कृत्रिम आहार गिरावट, एक साथ इन व्यक्तियों के लिए एक नया 24-अच्छी तरह से थाली ताजा कृत्रिम आहार (चित्रा 2C) से युक्त करने के लिए हस्तांतरण।
    3. 0.0001 ग्राम की शुद्धता के लिए एक विश्लेषणात्मक संतुलन का उपयोग कर 11 के बाद पक्षियों के बच्चे के लिए 7 दिन से लार्वा का वजन। वजन के बाद, व्यक्तिगत रूप से 24-अच्छी तरह से थाली में लार्वा वापस जाएँ।
  4. चौथे निर्मोचन के बाद पांचवें इनस्टार को molting पर (लगभग दस दिनों अंडे सेने के बाद), कांच ट्यूब (10 सेमी ऊंचाई, 2 सेमी व्यास) (चित्रा 2 डी) के लार्वा हस्तांतरण; पांचवें इनस्टार लार्वा भी सिर कैप्सूल (लगभग 2.6 मिमी) की चौड़ाई से पहचाना जा सकता है।
    ध्यान दें: व्यक्तियों स्थानांतरणएक ही समय में शीशे की नली प्रत्येक दिन के लिए।
    1. कोड पेंट या मार्कर का उपयोग कांच की नली पर अपने मूल संदर्भ संख्या के साथ प्रत्येक लार्वा। लार्वा स्थिति दैनिक रिकॉर्ड; कांच नलियों में, लगभग पाँच दिनों-प्यूपा चरण लगभग 11 दिनों तक रहता है के बाद लार्वा पोटा बना जाना होगा।
    2. कांच की नली में प्रत्येक व्यक्ति के लिए प्यूपा और eclosion तारीख रिकॉर्ड। 3-दिन पुरानी प्यूपा की बड़े पैमाने पर रिकॉर्ड।
  5. Eclosion के बाद, 10% सुक्रोज और 2% विटामिन समाधान (चित्रा 2 ई) के साथ एक एकल पिंजरे में एक महिला और एक पुरुष डाल दिया। हर दिन सुक्रोज समाधान की भरपाई। प्रत्येक कीट के लिए मृत्यु की तारीख रिकॉर्ड।
  6. जब अंडे रखी हैं, कपास जाली दैनिक बदल जाते हैं। अंडे की संख्या तुरंत गणना। नव रची वंश गणना करते हुए अंडों से निकलने वाले।
  7. bioassays के दौरान, बेतरतीब ढंग से आठ व्यक्तियों प्रत्येक उपचार HaDV2 के संक्रमण की स्थिति की पुष्टि करने के लिए का चयन करें। इन वाणिज्यिक ट्रिप्सिन अभिकर्मक का उपयोग कर नमूनों की कुल शाही सेना निकालेंनिर्माता के प्रोटोकॉल के बाद। निर्माता के प्रोटोकॉल के बाद पहले भूग्रस्त सीडीएनए संश्लेषण करने और एक टेम्पलेट के रूप में उपयोग का परीक्षण करने के लिए कि क्या वायरस सफलतापूर्वक बदल दिया जाता।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

माता-पिता कि HaDV2 मुक्त (चित्रा 3A) थे से संततियों NONINF तनाव के रूप में पाला गया। हम सफलतापूर्वक एक ही डीएनए टेम्पलेट का उपयोग कर पता चलता है कि डीएनए टेम्पलेट्स अच्छी गुणवत्ता (चित्रा 3 बी) के थे actin जीन परिलक्षित। इसके अलावा, बेतरतीब ढंग से चुना आठ संततियों भी HaDV2 (चित्रा -3 सी), HaNPV (चित्रा 3 डी), और Wolbachia (चित्रा 3E) से मुक्त थे। फिर, हम निष्कर्ष निकाला है कि संततियों के डीएनए नमूनों, अच्छी गुणवत्ता के थे क्योंकि actin जीन के एक हिस्से को सफलतापूर्वक सभी जांचे गए नमूनों (चित्रा 3F) के लिए विस्तार दिया जाता था।

एक मानक वक्र शुरू कर सामग्री की गुणवत्ता और प्राप्त की सीटी मूल्यों का लॉग के बीच के रिश्ते को परिभाषित चित्र 4 में के रूप में, जनरेट किया गया था। एक मजबूत रैखिक सहसंबंध (आर (चित्रा 4) के बीच मिला था।

हाल में रची लार्वा HaDV2 तरल 10 4 और 10 8 प्रतिलिपि संख्या / μL के बीच 10 गुना धारावाहिक dilutions का उपयोग कर तरल पदार्थ का एक मुद्दा मानक वक्र के साथ टीका कर रहे थे। हम संक्रमण आवृत्ति और HaDV2 तरल तरल पदार्थ की सांद्रता के बीच एक रैखिक सहसंबंध प्राप्त; 10 8 प्रतिलिपि संख्या / μL कपास bollworm के लिए 100% संक्रमण सामने आए, लेकिन अन्य सांद्रता (भी जू एट अल। 31 देखें) नहीं था। विभिन्न HaDV2 संक्रमण स्थितियों के साथ माता-पिता से संततियों के HaDV2 संक्रमण आवृत्तियों इस प्रकार थे: ♀ के लिए 100% + / ♂-, 78% के लिए ♀- / ♂ +, और 100 ♀ के लिए + / ♂ + (यह भी देखें जू% एट अल। 31)।

ग करने के लिएorrect HaDV2 अनुमापांक में व्यक्तिगत मतभेदों के लिए, हम प्रत्येक ऊतक के मिलीग्राम प्रति HaDV2 प्रतिलिपि संख्या और विशिष्ट ऊतक के लिए कुल HaDV2 अनुमापांक का प्रतिशत गणना की। परिणामों से पता चला है कि मुख्य रूप से HaDV2 वसा शरीर में वितरित किया गया (चित्रा 5; यह भी देख जू एट अल 31।)। लार्वा अवधि, प्यूपा अवधि, वयस्क लंबाई, और उपजाऊपन सहित जीवन तालिका मापदंडों की तुलना, तालिका 1 में दिखाया गया है (यह भी जू एट अल। 31 देखें)। लार्वा और पोटा संबंधी जनता के रूप में जू एट अल द्वारा प्रकाशित किया गया। 31। दोनों NONINF तनाव और INF तनाव में HaDV2 संक्रमण स्थितियों पीसीआर (जू एट अल। 31 द्वारा प्रकाशित परिणाम) द्वारा निर्धारित किया गया है।

आकृति 1
चित्र 1 विच्छेदित ऊतकों के लिए (ए) लार्वा, (बी) एकमहिला वयस्क, और (सी) एक नर एडल्ट। एच, सिर (मस्तिष्क); उन्होंने कहा कि, hemolymph; अमेरिकन प्लान, वसा शरीर; माउंट, Malpighian tubules; जी, पेट; , अग्रांत्र FG; एमजी, आद्यमध्यांत्र; HG, पश्चांत्र; म्यू, मांसपेशियों; हे, अंडाशय, टी, वृषण। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र 2
चित्र 2. Bioassay प्रक्रिया कपास bollworm पर HaDV2 के प्रभाव को निर्धारित करने के लिए। (ए) HaDV2 साथ हाल में रची लार्वा के इनोकुलेशन। (बी) 48 घंटे के बाद 24-अच्छी तरह से प्लेटों के लिए HaDV2 संक्रमित और HaDV2 मुक्त व्यक्तियों के हस्तांतरण। (सी) HaDV2 संक्रमित और -free व्यक्तियों के विभिन्न आकार। (डी) नई गिलास ट्यूब (10 सेमी ऊंचाई, 2 सेमी व्यास) को पांचवीं इनस्टार लार्वा का हस्तांतरण। (ई) एक की नियुक्तिमहिला और एक ही पिंजरे में एक नर कीट वयस्क दीर्घायु, अंडा उत्पादन, और पक्षियों के बच्चे दर निर्धारित करने के लिए। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्र तीन
चित्रा 3. HaDV2, HaNPV, या Wolbachia के लिए संक्रमण की स्थिति HaDV2 संक्रमित और HaDV2 मुक्त कालोनियों में। महिला और पुरुष माता-पिता में HaDV2 संक्रमण की स्थिति (ए)। बेतरतीब ढंग से चुना संततियों में HaDV2 (सी), HaNPV (डी), और Wolbachia (ई) के संक्रमण की स्थिति। जीनोमिक डीएनए के गुणवत्ता की जांच करने के लिए, गृह व्यवस्था जीन actin भी माता-पिता (बी) और संततियों (एफ) के लिए विस्तार दिया जाता था। लेन एम DL2000 मार्कर (2,000 बीपी, 1000 बीपी, 750 बीपी, 500 बीपी, 250 बीपी, एक से पता चलताघ 100 बीपी)। लेन 1: महिला माता पिता। लेन 2: पुरुष माता पिता। 3 लेन - 10: संततियों। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 4
चित्रा 4. मानक वक्र सम्बंधित प्रवेश करें 2-बदल HaDV2 सांद्रता साइकिल थ्रेसहोल्ड (सीटी) मान सकते हैं। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

चित्रा 5
चित्रा लार्वा (ए) में HaDV2 की 5. होस्ट-ऊतक वितरण, वयस्क महिला (बी), और वयस्क पुरुष (सी) कपास bollworms। प्रतिशत (%) = विभिन्न ऊतकों में HaDV2 के अनुपात (मिलीग्राम प्रति), के रूप में मैं वर्णितn कदम 4.7 डेटा विचरण (एनोवा) और Tukey के परीक्षण के विश्लेषण का उपयोग सांख्यिकीय विश्लेषण किया गया (लार्वा: एन = 7; वयस्क पुरुषों: n = 6, वयस्क मादा: एन = 6)। ± एसई मतलब है। परिणाम जू एट अल द्वारा प्रकाशित किए गए थे। 31। यह आंकड़ा का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें।

जीवन का इतिहास मानकों HaDV2 + HaDV2- टी मूल्य df पी मूल्य
लारवल अवधि (दिन) नर 16.51 (± 0.72) 16.93 (± 1.21) 4.147 379 <0.001
महिला 16.51 (± 0.79) 16.80 (± 1.05) 2.732 312 0.0067
पोटा संबंधी अवधि (दिन) नर 13.02 (± 0.68) 13.31 (± 0.69) 4.057 379 <0.001
महिला 11.62 (± 0.67) 12.00 (± 0.63) 5.1 312 <0.001
वयस्क की दीर्घायु (दिन) नर 10.69 (± 1.98) 10.93 (± 2.46) 0.915 367 0.36
महिला 9.07 (± 1.98) 8.51 (± 1.58) 2.992 367 0.003
अंडे की संख्या मादा प्रति उत्पादित 482 (± 174) 403 (± 180) 2.172 93 0.032
महिला के अनुसार hatchings की संख्या 207 (± 108) 143 (± 99) 3.026 93 0.0032

तालिका 1. के लिए HaDV2 + और HaDV2-कपास bollworms जीवन-इतिहास पैरामीटर। विद्यार्थी t- परीक्षण महत्व के स्तर को निर्धारित करने के लिए प्रयोग किया जाता है। इसका मतलब ± एसई दिखाए जाते हैं। इस तालिका में प्रस्तुत डाटा जू एट अल द्वारा प्रकाशित किए गए थे। 31।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

पिछले कुछ दशकों में, कीट-वायरस बातचीत पर ज्यादातर अध्ययन में मधु मक्खी स्वास्थ्य 34, 35, 36, मानव रोग 37 की वैक्टर पर जोर दिया है, संयंत्र 38 वायरस, और कुछ कीट रोगजनक वायरस जैविक नियंत्रण एजेंट 39 के रूप में काफी संभावना है। थोड़ी-सी देखभाल, कीड़े में गुप्त वायरस के लिए भुगतान किया गया है विशेष रूप से lepidopteran कीटों में। यहाँ, हम एक गुप्त वायरस और उसके मेजबान कीट के बीच संबंधों के अध्ययन के लिए एक प्रोटोकॉल प्रस्तुत करते हैं। वायरस से संक्रमित और वायरस मुक्त मेजबान व्यक्तियों के लिए जीवन तालिका मानकों की तुलना आदर्श मेजबान आनुवंशिक पृष्ठभूमि में मतभेद के किसी भी प्रभाव को बाहर कर देना चाहिए। वायरल फेनोटाइप का अध्ययन करने के लिए, कई पिछले अध्ययनों जीवन तालिका टीका एक ही कॉलोनी या व्यक्तियों में या तो स्वाभाविक रूप से संक्रमित या असंक्रमित व्यक्तियों के मापदंडों की तुलना में हैmicroinjection द्वारा, लेकिन इस प्रयास समय 23 उपभोक्ता, 40 है। HaDV2 साथ कपास bollworms, यहाँ वर्णित के मौखिक टीका, वायरल समलक्षणियों विश्लेषण करने के लिए एक सरल और प्रभावी साधन के रूप में कार्य करता है। यह प्रक्रिया भी HaDV2 संक्रमित और HaDV2-uninfected कालोनियों के लिए एक ही आनुवंशिक पृष्ठभूमि सुनिश्चित करता है।

वायरस inoculum कई मायनों में तैयार किया जा सकता। उच्च गति centrifugation का उपयोग कर वायरस कणों की शुद्धि वायरस संक्रामकता को रोकता है, कम संक्रामकता में जिसके परिणामस्वरूप; इसलिए, वायरस युक्त फ़िल्टर किए गए तरल कपास bollworm लार्वा 31 संक्रमित करने के लिए इस्तेमाल किया गया था। तथ्य यह है कि 0.22-सुक्ष्ममापी झिल्ली तरल HaDV2 युक्त फ़िल्टर्ड से और कहा कि HaDV2 मुक्त फ़िल्टर्ड तरल नियंत्रण के रूप में इस्तेमाल किया गया था हमारे परिणामों पर अन्य वायरस के प्रभाव को बहिष्कृत कर सकता सबसे फंगल और बैक्टीरियल कणों को फ़िल्टर कर सकते। हालांकि, हम संभावना को बाहर नहीं कर सकते कि bioassay परिणाम सकता है एकLSO अनदेखा वायरस से पक्षपाती हो। इसलिए, उच्च संक्रामकता साथ HaDV2 कणों आदर्श मजबूत परिणाम प्राप्त करने के लिए भविष्य में शुद्ध किया जाना चाहिए।

वायरस एकाग्रता सकारात्मक वायरस संक्रामकता के साथ सहसंबद्ध; इसलिए, हम HaDV2 एकाग्रता कि 100% संक्रमण निकलेगा का निर्धारण करने में रुचि रखते थे। हमारे नतीजे बताते हैं कि 10 8 प्रतिलिपि संख्या / μL इस संक्रमण दर प्राप्त करने के लिए वायरस टीका के लिए इस्तेमाल किया जा सकता है। निस्संदेह, वायरस अनुमापांक और संक्रमण दर के बीच संबंध अन्य वायरस मेजबान भविष्य में अध्ययन बातचीत के लिए अध्ययन किया जाना चाहिए। इसके अलावा, इस क्षेत्र में प्रत्येक व्यक्ति के वायरस अनुमापांक भी पता लगाया जाना चाहिए। इसलिए, हम तो क्षेत्र में व्यक्तियों पर वायरस के प्रभाव अनुकरण कर सकते हैं।

क्योंकि वे आसानी से घातक रूप से क्षतिग्रस्त हो रहे हैं पहले कुछ दिनों के बाद अंडों से निकलने के दौरान नाजुक लार्वा की कोमल हैंडलिंग, बहुत महत्वपूर्ण है। इसके अलावा, HaDV2-uninfected colony HaDV2 को रोकने के लिए ग्रीन हाउस में अलग से रखा जाना चाहिए संदूषण-HaDV2 की संक्रमण दर, बहुत ज्यादा हो पाया गया है दोनों क्षेत्र में और प्रयोगशाला 31 में।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों की घोषणा वे कोई प्रतिस्पर्धा वित्तीय हितों की है।

Acknowledgments

यह काम चीन के राष्ट्रीय कुंजी बुनियादी अनुसंधान कार्यक्रम (सं 2013CB127602) और के लिए चीन के राष्ट्रीय विज्ञान फाउंडेशन (सं 31,321,004) के क्रिएटिव अनुसंधान समूह विज्ञान कोष द्वारा समर्थित किया गया।

Materials

Name Company Catalog Number Comments
24-well plate Corning 07-200-740 Multiple suppliers available.
DNA extraction kit TIANGEN DP304-03 Multiple suppliers available.
thermal cycler Veriti; Applied Biosystems 4375786
PBS Corning 21-040-CV
0.22 µm membrane filter Millipore SLGS025NB
pEASY-T Cloning Vector TransGen, Beijing, China CT301-02
Tweezers IDEAL-TEK 2.SA
Premix Ex Taq (Probe qPCR) Takara RR390A
Probes Invitrogen Custom order
Primers Invitrogen Custom order
microspectrophotometry NanoDrop 2000c  Thermo scientific  not available
7500 Real-Time PCR system Applied Biosystems not available
stereomicroscope SZX-16 Olympus not available
sucrose Multiple suppliers available.
vitamin complex Multiple suppliers available.

DOWNLOAD MATERIALS LIST

References

  1. Tang, P., Chiu, C. Metagenomics for the discovery of novel human viruses. Future Microbiol. 5, 177-189 (2010).
  2. Rosario, K., Breitbart, M. Exploring the viral world through metagenomics. Curr. Opin. Virol. 1, 289-297 (2011).
  3. Hugenholtz, P., Tyson, G. W. Microbiology - metagenomics. Nature. 455, 481-483 (2008).
  4. Kristensen, D. M., Mushegian, A. R., Dolja, V. V., Koonin, E. V. New dimensions of the virus world discovered through metagenomics. Trends Microbiol. 18, 11-19 (2010).
  5. Kleiner, M., Hooper, L. V., Duerkop, B. A. Evaluation of methods to purify virus-like particles for metagenomic sequencing of intestinal viromes. BMC Genomics. 16, 7 (2015).
  6. Ho, T., Tzanetakis, I. E. Development of a virus detection and discovery pipeline using next generation sequencing. Virology. 471, 54-60 (2014).
  7. Marx, C. J. Can you sequence ecology? Metagenomics of adaptive diversification. PLoS Biol. 11, e1001487 (2013).
  8. Radford, A. D., et al. Application of next-generation sequencing technologies in virology. J. Gen. Virol. 93, 1853-1868 (2012).
  9. Liu, S. J., Chen, Y. T., Bonning, B. C. RNA virus discovery in insects. Curr. Opin. Insect Sci. 8, 54-61 (2015).
  10. Mokili, J. L., Rohwer, F., Dutilh, B. E. Metagenomics and future perspectives in virus discovery. Curr. Opin. Virol. 2, 63-77 (2012).
  11. Liu, S. J., Vijayendran, D., Bonning, B. C. Next generation sequencing technologies for insect virus discovery. Viruses-Basel. 3, 1849-1869 (2011).
  12. Cook, S., et al. Novel virus discovery and genome reconstruction from field RNA samples reveals highly divergent viruses in Dipteran hosts. PLoS ONE. 8, e80720 (2013).
  13. Webster, C. L., et al. The discovery, distribution, and evolution of viruses associated with Drosophila melanogaster. PLoS Biol. 13, e1002210 (2015).
  14. Granberg, F., et al. Metagenomic detection of viral pathogens in spanish honeybees: co-infection by aphid lethal paralysis, israel acute paralysis and lake sinai viruses. PLoS ONE. 8, e57459 (2013).
  15. Runckel, C., et al. Temporal analysis of the honey bee microbiome reveals four novel viruses and seasonal prevalence of known viruses, Nosema, and Crithidia. PLoS ONE. 6, 20656 (2011).
  16. Cox-Foster, D. L., et al. A metagenomic survey of microbes in honey bee colony collapse disorder. Science. 318, 283-287 (2007).
  17. Chandler, J. A., Liu, R. M., Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 6, 185 (2015).
  18. Shi, C. Y., et al. A metagenomic survey of viral abundance and diversity in mosquitoes from Hubei province. PLoS ONE. 10, e0129845 (2015).
  19. Nouri, S., Salem, N., Nigg, J. C., Falk, B. W. Diverse array of new viral sequences identified in worldwide populations of the Asian citrus psyllid (Diaphorina citri) using viral metagenomics. J. Virol. 90, 2434-2445 (2016).
  20. Dayaram, A., et al. Identification of diverse circular single-stranded DNA viruses in adult dragonflies and damselflies (Insecta Odonata) of Arizona and Oklahoma, USA. Infect. Genet. Evol. 30, 278-287 (2015).
  21. Jakubowska, A. K., et al. Simultaneous occurrence of covert infections with small RNA viruses in the lepidopteran Spodoptera exigua. J.Invert. Pathol. 121, 56-63 (2014).
  22. Roossinck, M. J. Move over, Bacteria! Viruses make their mark as mutualistic microbial symbionts. J. Virol. 89, 6532-6535 (2015).
  23. Ryabov, E. V., Keane, G., Naish, N., Evered, C., Winstanley, D. Densovirus induces winged morphs in asexual clones of the rosy apple aphid, Dysaphis plantaginea. Proc. Natl. Acad. Sci. USA. 106, 8465-8470 (2009).
  24. Roossinck, M. J. The good viruses: viral mutualistic symbioses. Nat. Rev. Microbiol. 9, 99-108 (2011).
  25. Venkataraman, S., et al. Structure of seneca valley virus-001: an oncolytic picornavirus representing a new genus. Structure. 16, 1555-1561 (2008).
  26. Deterding, K., et al. Hepatitis a virus infection suppresses hepatitis c virus replication and may lead to clearance of hcv. J. Hepatol. 45, 770-778 (2007).
  27. Barton, E. S., et al. Herpesvirus latency confers symbiotic protection from bacterial infection. Nature. 447, 326-329 (2007).
  28. Ponferrada, V. G., Mauck, B. S., Wooley, D. P. The envelope glycoprotein of human endogenous retrovirus herv-w induces cellular resistance to spleen necrosis virus. Arch. Virol. 148, 659-675 (2003).
  29. Márquez, L. M., Redman, R. S., Rodriguez, R. J., Roossinck, M. J. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science. 315, 513-515 (2007).
  30. Xu, P. J., et al. Complete genome sequence of a monosense densovirus infecting the cotton bollworm, Helicoverpa armigera. J. Virol. 86, 10909-10909 (2012).
  31. Xu, P. J., Liu, Y. Q., Graham, R. I., Wilson, K., Wu, K. M. Densovirus is a mutualistic symbiont of a global crop pest (Helicoverpa armigera) and protects against a baculovirus and Bt biopesticide. PLoS Pathog. 10, e1004490 (2014).
  32. Liang, G. M., Tan, W. J., Guo, Y. Y. An improvement in the technique of artificial rearing cotton bollworm. Plant Protec. 25, 15-17 (1999).
  33. Zhou, W. G., Rousset, F., O'Neill, S. Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. P. Roy. Soc. B-Biol. Sci. 265, 509-515 (1998).
  34. Mondet, F., de Miranda, J. R., Kretzschmar, A., Le Conte, Y., Mercer, A. R. On the front line: quantitative virus dynamics in honeybee (Apis mellifera L.) colonies along a new expansion front of the parasite Varroa destructor. PLoS Pathog. 10, e1004323 (2014).
  35. Chen, Y. P., et al. Israeli acute paralysis virus: epidemiology, pathogenesis and implications for honey bee health. PLoS Pathog. 10, e1004261 (2014).
  36. Hunter, W., et al. Large-scale field application of RNAi technology reducing israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae). PLoS Pathog. 6, e1001160 (2010).
  37. Halstead, S. B. Dengue virus - mosquito interactions. Annu. Rev. Entomol. 53, 273-291 (2008).
  38. Whitfield, A. E., Falk, B. W., Rotenberg, D. Insect vector-mediated transmission of plant viruses. Virology. 479-480, 278-289 (2015).
  39. Moscardi, F. Assessment of the application of baculoviruses for control of Lepidoptera. Annu. Rev. Entomol. 44, 257-289 (1999).
  40. Szelei, J., et al. Susceptibility of North-American and European crickets to Acheta domesticus densovirus (AdDNV) and associated epizootics. J. Invert. Pathol. 106, 394-399 (2011).
कपास bollworm में होस्ट-ऊतक वितरण, पारेषण मोड, और एक Densovirus की होस्ट स्वास्थ्य पर प्रभाव की जांच के लिए प्रोटोकॉल
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).More

Yang, X., Xu, P., Graham, R. I., Yuan, H., Wu, K. Protocols for Investigating the Host-tissue Distribution, Transmission-mode, and Effect on the Host Fitness of a Densovirus in the Cotton Bollworm. J. Vis. Exp. (122), e55534, doi:10.3791/55534 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter