Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Studiare l'espressione del gene regolamentata mediante ciclo cellulare da due protocolli complementari di sincronizzazione delle cellule

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Riportiamo due protocolli di sincronizzazione delle celle che forniscono un contesto per studiare eventi legati a fasi specifiche del ciclo cellulare. Mostriamo che questo approccio è utile per analizzare la regolazione di geni specifici in un ciclo cellulare non selettivo o su esposizione ad agenti che interessano il ciclo cellulare.

Abstract

Il programma di espressione genica del ciclo cellulare rappresenta un passo fondamentale per comprendere i processi dipendenti dal ciclo cellulare e il loro ruolo in malattie come il cancro. L'analisi dell'espressione genica a ciclo-regolazione cellulare dipende dalla sincronizzazione cellulare in fasi specifiche. Qui descriviamo un metodo che utilizza due protocolli complementari di sincronizzazione comunemente usati per studiare la variazione periodica dell'espressione genica durante il ciclo cellulare. Entrambe le procedure sono basate sul blocco temporaneo del ciclo cellulare in un punto definito. Il protocollo di sincronizzazione con il trattamento con idrossiurea (HU) porta all'arresto cellulare nella fase tardiva G1 / fase iniziale S e la liberazione dall'arresto mediato da HU fornisce una popolazione cellulare che procede uniformemente attraverso S e G2 / M. Il protocollo di sincronizzazione da parte di timidina e nocodazolo (Thy-Noc) blocca le cellule in fase iniziale di mitosi e rilascio da arresto mediato da Thy-Noc fornisce una popolazione cellulare sincronizzata adatta per la fase G1 e la fase SProva gli studi. L'applicazione di entrambe le procedure richiede il monitoraggio dei profili di distribuzione del ciclo cellulare, che viene tipicamente eseguito dopo la colorazione del ioduro di propidium (PI) delle cellule e l'analisi della citometria a flusso analizzata del contenuto del DNA. Mostriamo che l'uso combinato di due protocolli di sincronizzazione è un approccio robusto per determinare chiaramente i profili trascrizionali di geni regolati in modo differenziato nel ciclo cellulare ( cioè E2F1 e E2F7) e di conseguenza avere una migliore comprensione del loro ruolo nel ciclo cellulare processi. Inoltre, dimostriamo che questo approccio è utile per lo studio di meccanismi che stanno alla base di terapie a base di droga ( cioè mitomicina C, un agente anticancro), perché consente di discriminare i geni che rispondono all'agente genotossico da quelli esclusivamente colpiti dalle perturbazioni del ciclo cellulare Imposto dall'agente.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

La transizione attraverso tutte le fasi del ciclo cellulare è accoppiata ad un programma di espressione genica fortemente regolamentato. Si ritiene che questa coordinata "on and off" della trascrizione genica per tutto il ciclo cellulare sia sotto il controllo di sistemi regolatori transcrittivi complessi, che regola non solo la tempistica ma anche i livelli di espressione genica. La deregulation dei componenti chiave del ciclo cellulare è noto per contribuire allo sviluppo di diverse malattie ed è un segno distintivo ben consolidato della tumorigenesi 1 , 2 . Le analisi trascrizionali a livello genomico effettuate nelle cellule di lieviti e mammiferi hanno rivelato che un gran numero di geni mostrano pattern periodici di espressione genica nel ciclo cellulare, suggerendo che la fluttuazione trascrizionale durante il ciclo cellulare è un riflesso del requisito temporale di un determinato prodotto genico In una fase precisa 3 , 4 , 5 .

Un compito importante nello studio dell'espressione genica del ciclo cellulare è la sincronizzazione delle cellule in fasi specifiche del ciclo cellulare. La sincronizzazione delle cellule aiuta a interpretare l'associazione di un modello di espressione genica a una particolare transizione di fase del ciclo cellulare e ha portato ad una migliore comprensione della regolazione e della funzione di numerosi geni. La sincronizzazione cellulare è anche importante per studiare il meccanismo d'azione dei farmaci antitumorali, in quanto gli agenti chemioterapici sono noti per influenzare sia l'espressione genica, sia la cinetica del ciclo cellulare 6 , 7 . Tuttavia, è spesso difficile determinare se le differenze di espressione genica risultanti dal trattamento con questi agenti sono una risposta diretta al trattamento o sono semplicemente la conseguenza dei cambiamenti nei profili del ciclo cellulare. Per distinguere tra queste possibilità, l'espressione genica deve essere analizzata in cellule che sono state sYnchronized prima dell'aggiunta del farmaco chemioterapico.

Ad eccezione di alcune cellule primarie come le cellule linfoidi appena isolate, che costituiscono una popolazione cellulare omogenea sincronizzata in G08, le linee cellulari stabilite in vitro crescono in modo asincrone nella cultura. In condizioni di crescita regolare, queste cellule cicliche asincrono si trovano in tutte le fasi del ciclo cellulare, ma preferibilmente in G1 9 . Pertanto, questo contesto non fornisce uno scenario ottimale per analisi funzionale o di espressione genica in una fase specifica del ciclo cellulare ( ad esempio G1, S, ecc.). Le linee cellulari immortalizzate non trasformate ( ad es. Fibroblasti) possono essere sincronizzate con i cosiddetti metodi fisiologici 10 . Questi metodi sono basati sulle caratteristiche delle cellule primarie mantenute delle cellule non trasformate, come l'inibizione del contatto cellulare e la dipendenza del fattore di crescita per continuare la ciclizzazione. RimozioneDel siero in combinazione con inibizione del contatto rende le cellule non trasformate arrestate a G0 / G1. Tuttavia, l'ingresso e la progressione del ciclo cellulare sincronizzato richiede spesso la subcultura, che prevede anche il distacco artificiale delle cellule e la ri-placcatura 10 . Il più importante, questo metodo non è adatto per la sincronizzazione di linee cellulari trasformate, la stragrande maggioranza delle linee cellulari esistenti attualmente in uso, caratterizzata per la mancanza di inibizione della crescita mediata dal contatto cellulare o risposta al ritiro del fattore di crescita. Quindi, è chiaro che sono necessari metodi alternativi per un'efficiente sincronizzazione delle cellule in fasi specifiche del ciclo cellulare. In termini generali, i metodi di sincronizzazione più utilizzati sono basati sull'inibizione chimica o farmacologica transitoria di un punto definito del ciclo cellulare, tipicamente la sintesi del DNA o la formazione di mandrini mitotici. L'inibizione della sintesi del DNA sincronizza le cellule arrestandole nella fase tardiva G1 o in fase iniziale S. Questo può essere achiEvitando l'aggiunta di composti come mimosina, inibitore della biosintesi nucleotida 11,12, afidicolina, inibitore delle DNA polimerasi 13 , 14 , idrossiacuri, inibitore della ribonucleotide reduttasi 15 , 16 o in eccesso di timidina 17 , 18 . D'altra parte, gli inibitori della polimerizzazione del microtubulo, come la colchicina o il nocodazolo, sono in grado di bloccare la formazione di mandrini mitotici che conducono alla sincronizzazione cellulare all'inizio della fase M 19 , 20 , 21 .

In questo lavoro descriviamo un metodo che coinvolge due protocolli complementari di sincronizzazione basati sull'inibizione chimica transitoria per studiare l'espressione dei geni regolati dal ciclo cellulare all'MRNAlivello. Questo metodo è fondamentale per definire il ruolo dei geni del ciclo cellulare nei processi specifici del ciclo cellulare. Inoltre, fornisce un quadro generale per studiare l'impatto dei trattamenti antitumorali al fine di rilevare accuratamente i geni reattivi di droga e minimizzare le interpretazioni erronee derivanti da perturbazioni nella progressione del ciclo cellulare generato da questi farmaci.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Sincronizzazione cellulare, rilascio e monitoraggio della progressione del ciclo cellulare

  1. Sincronizzazione e rilascio di cellule U2OS a base di timidina e nocodazolo (Thy-Noc) dalla mitosi
    1. Preparare il mezzo di coltura della cellula desiderato. Le cellule U2OS vengono coltivate regolarmente nel mezzo di DMEM-glutamina integrato con il 10% (vol / vol) FBS (opzionale: 1% di penicillina / streptomicina). Eseguire tutta la preparazione e manipolazione media in condizioni sterili e riscaldare il mezzo complementare (da ora in poi denominato "mezzo completo") a 37 ° C prima dell'uso.
    2. Seme 2 x 10 6 cellule U2OS per piatto da 100 mm in 10 ml di media completa di coltura. Per calcolare il numero di piatti necessari, prendere in considerazione che ciascun piatto da 100 mm in genere fornisce sufficienti celle mitotiche per ricaricare circa 5 pozzetti di una piastra a 6 pozzetti (0,2 - 0,25 x 10 6 cellule / pozzetto) (vedi Figura 1B ). Sono necessari due pozzetti per punto temporale selezionatoNell'esperimento (1 pozzo per l'estrazione di RNA e 1 pozzo per il monitoraggio del ciclo cellulare). Inoltre, un terzo pozzo può essere raccolto per punto di tempo per l'analisi proteica.
      NOTA: Celle di piastre alla sera (intorno alle 19.00) in modo che i passaggi successivi possano essere eseguiti durante le ore lavorative nei giorni successivi. Includere 2 pozzetti aggiuntivi di cellule in ascolto crescente per definire le impostazioni di compensazione dell'analisi FACS.
    3. Lasciare che le cellule attaccano incubando i piatti da 100 mm a 37 ° C in un'atmosfera umidificata con 5% di CO 2 per 24 h.
    4. Per il blocco di timidina, preparare una soluzione di stock di timidina da 200 mM sciogliendo 145,2 mg di polvere timidina in 3 mi di H 2 O (o in quantità equivalenti) e sterilizzare la soluzione filtrando attraverso un filtro di dimensione pari a 0,2 μm. Il leggero riscaldamento potrebbe aiutare a sciogliere la timidina. Aggiungere 100 μL dello stock di 200 mM appena preparati ad ogni piatto di coltura da 100 mm (concentrazione finale 2 mM). Incubare le cellule con timidina per 20 h a 37 ° C76 ° C in atmosfera umidificata con 5% CO 2 .
      NOTA: Trattare le cellule alla sera (intorno alle 19.00) per avere il tempo per eseguire il rilascio della timidina e bloccare il nocodazolo il giorno successivo.
    5. Per uscire dal blocco di timidine, rimuovere il mezzo di crescita contenente timidina nel pomeriggio del giorno successivo (ore 15); Lavare le cellule due volte con 1x PBS preriscaldato e aggiungere 10 ml di mezzo completo a ogni piatto da 100 mm. Incubare le cellule per 5 h a 37 ° C in un'atmosfera umidificata con 5% CO 2 .
    6. Per l'arresto cellulare mitotico, aggiungere nocodazolo ad una concentrazione finale di 50 ng / mL (8 pm). Preparare una soluzione di stock dissolvendo la polvere di nocodazolo in DMSO ( es. 5 mg / ml) e conservare congelato a -20 ° C. Incubare le cellule con nocodazolo per non più di 10-11 h a 37 ° C in atmosfera umidificata con 5% CO 2 .
    7. Rilascio dall'arresto mediato dal nocodazolo nella fase iniziale M (scossa mitotica) e raccolta di campioni in più tempo poiNts (a partire dalle ore 6-7).
      1. Staccare le cellule arrotondate (mitotiche) scuotendo ogni piastra e pipettando delicatamente il mezzo di crescita contenente nocodazolo. Raccogliere il mezzo con cellule staccate da ogni piastra da 100 mm in tubi sterili da 50 ml, centrifugare (300 xg, 5 min, temperatura ambiente) e lavare le cellule due volte con l'aggiunta di 1x PBS seguita da centrifugazione. È consigliabile utilizzare PBS o PBS più nocodazolo a freddo per evitare lo slittamento mitotico (vedere sezione Discussione).
      2. Resuspendere le cellule mitotiche raccolte da ogni piastra da 100 mm in 10 ml di mezzo completo. Salvare 2 mL per l'estrazione di RNA e 2 mL per l'analisi FACS per il tempo di 0 h (circa 0,2-0,25 x 106 cellule per campione).
      3. Ricostruire le cellule mitotiche rimanenti per i punti temporali successivi in ​​piastre a 6 pozzetti (2 mL / pozzetto, 0,2-0,25 x 10 6 cellule / pozzetto).
        NOTA: Ricorda che sono necessari due pozzetti per ogni punto temporale selezionato (1 per RNA e 1 per l'analisi FACS).
    8. Raccogli i campioni a selI punti temporali. Ogni 1,5 - 3 ore è raccomandato per ottenere un profilo adeguato della progressione del ciclo cellulare.
      1. Per l'estrazione del RNA, rimuovere il mezzo, sciacquare bene con 2 ml di PBS preriscaldato 1x e aggiungere 1 ml di reagente di isolamento RNA appropriato ( es. TRIzol) nel pozzetto (eseguire quest'ultima fase in un armadietto di sicurezza per le sostanze chimiche). Pipettare verso l'alto e verso il basso per staccare e lire le cellule, trasferire il lisato cellulare in un tubo di microcentrifuga da 1,5 ml, incubare 5 minuti a RT e memorizzare il tubo a -80 ° C fino ad un ulteriore utilizzo.
      2. Per l'analisi FACS sciacquare bene con 2 ml di PBS preriscaldato 1x, aggiungere la soluzione di Trypsin-EDTA preriscaldata (0,3 mL / pozzetto) per staccare le cellule, bloccare Trypsin-EDTA aggiungendo 1 ml di mezzo completo e raccogliere ogni campione in un Tubo da 15 ml.
        1. Centrifugare le cellule (300 xg, 5 min, RT), salvare il pellet cellulare e scartare il supernatante. Al fine di bloccare le cellule, risospendere le cellule in 1 mL di etanolo refrigerato di 70% (v / v) in 1x PBS provocando dolcemente i tubi di vortex e metterli in ghiaccio per app15 min prima della conservazione a 4 ° C o alla colorazione per ulteriore analisi da FACS (descritta nei passaggi 1.4 - 1.5).
  2. Sincronizzazione basata su HU e rilascio delle celle U2OS dal confine G1 / S
    1. Preparare il mezzo completo di coltura cellulare come descritto nel punto 1.1.
    2. Seme 0,25 x 10 6 cellule U2OS per pozzetto in 6 pozzetti (2 ml di media di coltura completa per pozzetto). Per calcolare il numero di pozzetti necessari per l'esperimento, prendere in considerazione che saranno necessari due pozzetti per punto temporale selezionato (1 pozzo per l'estrazione di RNA e 1 pozzetto per il monitoraggio del ciclo cellulare) e che due pozzetti aggiuntivi di cellule in ascolto crescente sono Necessario definire le impostazioni di compensazione dell'analisi FACS.
    3. Lasciare le cellule attaccare incubando le piastre a 6 pozzetti per notte (O / N) a 37 ° C in un'atmosfera umidificata con 5% CO 2 .
    4. Rimuovere il mezzo completo dai pozzetti la mattina successiva e aggiungere 2 mlDi materiale DMEM-Glutamina privo di FBS preriscaldato per pozzetto. Incubare le cellule per altri 24 h a 37 ° C in un'atmosfera umidificata con 5% di CO 2 .
      NOTA: eseguire questo passaggio in tutti i pozzetti tranne 2 (quelli salvati per definire le impostazioni FACS). La fase di ritiro del siero può essere omessa se si ottiene una sincronizzazione efficiente semplicemente incubando le cellule con HU.
    5. Arresto del ciclo cellulare G1 / S con HU.
      1. Preparare la soluzione di riserva HU fresca (500 mM) prima di ogni uso. Aggiungere 2 ml di H 2 O a 76,06 mg di polvere HU e mescolare fino a fondo disciolto. Sterilizzare la soluzione filtrando con un filtro di dimensione pari a 0,2 μm. Mescolare 50 ml di mezzo completo con 400 μL di soluzione a base di HU per filtrazione sterilizzata per una concentrazione finale di HU di 4 mM.
      2. Rimuovere il supporto da tutti i pozzetti tranne i 2 pozzetti necessari per definire le impostazioni FACS e sostituire con un mezzo completo completo di 4 mM contenente HU (2 mL / pozzetto).
      3. Incubare le cellule per 24 hContenente HU a 37 ° C in atmosfera umidificata con 5% CO 2 .
    6. Liberazione di cellule da arresto mediato da HU. Rimuovere il contenitore HU contenente i pozzetti e sciacquare i pozzetti due volte con PBS pre-riscaldato (2 mL ogni volta). Aggiungere 2 ml di mezzo completo per pozzetto. Raccogliere 2 campioni per il tempo di 0 h (1 per l'estrazione RNA e 1 per la verifica dell'arresto del ciclo cellulare da FACS) nonché 2 campioni salvati per le impostazioni FACS. Inserire i pozzi rimasti nell'incubatrice.
    7. Raccogliere campioni ogni 1,5 - 3 ore per ottenere un'adeguata distribuzione della progressione del ciclo cellulare. Ad ogni punto temporale, eseguire l'elaborazione del campione (per l'estrazione di RNA e per l'analisi FACS) come descritto in 1.1.8.1-1.1.8.2.
  3. Trattamento con agenti dannosi del DNA
    NOTA: Ogni volta che lo scopo è quello di chiarire l'effetto di un composto ( ad es. Agenti dannosi del DNA) negli eventi di ciclo cellulare, è possibile utilizzare uno qualsiasi dei metodi di sincronizzazione descritti in precedenzaCombinato con il trattamento delle cellule con l'agente genotossico. Per selezionare il metodo di sincronizzazione, è importante considerare la fase del ciclo cellulare che vorremmo analizzare. In generale, la procedura Thy-Noc può essere idonea a studiare l'effetto di un composto in fase di fase G1 o in fase di fase S mentre la sincronizzazione mediata da HU può essere più idoneo a studiare l'impatto nelle fasi S-G2 o all'ingresso alla mitosi.
    1. Analisi dell'effetto degli agenti genotossici nella fase G1 o nella fase S
      1. Sincronizzare le celle come descritto in 1.1.2. A 1.1.6.
      2. Rilasciare le cellule di nocodazolo e ricaricarle come descritto in 1.1.7. Incubarli a 37 ° C in un'atmosfera umidificata con 5% di CO 2 per 3 h per farli fissare prima dell'aggregatore (il periodo di incubazione desiderato può variare a seconda della linea cellulare).
      3. Aggiungere agente e raccogliere i campioni come precedentemente descritto in 1.1.8.
    2. Analisi dell'effetto degli agenti genotossici in SG2 fasi o entrata M
      1. Sincronizzare le celle come descritto in 1.2.2. A 1.2.5.
      2. Liberare le cellule da HU come descritto in 1.2.6. E aggiungere immediatamente l'agente.
      3. Raccogli i campioni come precedentemente descritto al punto 1.8.
  4. Monitoraggio della sincronizzazione cellulare e progressione attraverso il ciclo cellulare mediante la colorazione del ioduro di propidium (PI) e l'analisi FACS
    NOTA: i campioni raccolti in tutti i punti di tempo insieme a quelli richiesti per definire le impostazioni FACS possono essere memorizzati a 4 ° C una volta stati fissati (come indicato in 1.1.8.2). Eseguire la colorazione con la soluzione PI e seguire l'analisi FACS per tutti i campioni dell'esperimento contemporaneamente. PI intercalates nella scanalatura principale del DNA a doppio filamento che produce un segnale altamente fluorescente quando eccitato a 535 nm con un picco di emissione largo intorno a 600 nm. Poiché PI può anche legarsi a RNA a doppio filamento, è necessario trattare le cellule con RNase per una risoluzione ottimale del DNA.
    1. Preparare la soluzione di colorazione fresca PI. Una soluzione di stock PI può essere preparata sciogliendo la polvere di PI in PBS ( es. 5 mg / ml). Conservare la soluzione di riserva a 4 ° C (nell'oscurità). La soluzione di colorazione è composta da PI (140 μM), citrato di sodio (38 mM) e Triton X-100 (0,01% v / v).
    2. Riscaldare una superficie appropriata ( ad es. Forno) a 37 ° C.
    3. Centrifugare le cellule fisse (450 xg, 5 min, RT), superare il diluente (etanolo) e lavare una volta con 1x PBS.
    4. Centrifugare nuovamente le cellule, rimuovere PBS e aggiungere 300 μL di soluzione di colorazione PI per campione (ad eccezione di uno dei campioni per le impostazioni FACS, invece aggiungere PBS a questo campione).
    5. Trasferire le cellule ai tubi FACS (tubi in polistirene rotondo 5 ml).
    6. Aggiungere 1 μL di RNasi A ad ogni campione, mescolare ed incubare i campioni per 30 minuti nell'oscurità a 37 ° C. I campioni possono essere conservati protetti dalla luce a 4 ° C per un massimo di 2 - 3 giorni.
    7. Analizzare il contenuto del DNA nei campioni mediante flussocitometria. Definire le impostazioni di compensazione dell'analisi FACS con un campione asincrono colorato PI. Usare campioni vuoti (senza soluzione di colorazione PI) per verificare l'autofluorescenza. Le basi dell'analisi mediata dalla colorazione PI del contenuto del DNA mediante citometria a flusso sono state precedentemente descritte 9 .
  5. Determinazione dell'indice mitotico mediante colorazione a doppio fosfo-H3 (Ser 10) / PI
    NOTA: le cellule sottoposte a mitosi possono essere facilmente rilevate mediante citometria a flusso con anticorpi specifici per fosfo-istone H3 in Serine 10 (pH3). Una colorazione concomitante di PI è utile per determinare la distribuzione del DNA sul contenuto della popolazione cellulare. Sono necessari 5 campioni per le configurazioni ottimali delle impostazioni FACS: vuoto, solo PI, solo a pH3, solo anticorpo secondario e doppia colorazione.
    1. Centrifugare le cellule fisse (450 xg, 5 min, 4 ° C) e scartare il surnatante. Le seguenti fasi sono descritte per eseguire la colorazione in tubi da 15 mL.
    2. Lavare le cellule aggiungendo 1ML PBS-T (PBS + 0,05% Tween-20) al pellet e centrifuga (450 xg, 5 min, 4 ° C). Rimuovere il surnatante.
    3. Aggiungere un anticorpo anti-pH3 diluito (1: 500) in 100-200 μL di PBS-T + 3% BSA e incubare con dondolo per 2 ore a RT (o O / N a 4 ° C).
    4. Aggiungere 2 mL PBS-T (PBS + 0,05% Tween-20) e centrifugare (450 xg, 5 min, 4 ° C). Rimuovere il surnatante.
    5. Lavare ancora una volta aggiungendo 2 mL PBS-T al pellet, centrifugare e scartare il surnatante.
    6. Aggiungere un anticorpo secondario (anti-coniglio AlexaFluor 488 nel caso di un anticorpo selezionato pH3) diluito (1: 500) in 100-200 μL di PBS-T + 3% BSA e incubare con oscillazione per 1 h a RT (o O / N A 4 ° C). Proteggere i campioni dalla luce.
    7. Lavare due volte con PBS-T (2 mL) per centrifugazione come descritto al punto 1.5.4.
    8. Eseguire la colorazione PI come descritto (passaggi da 1.4.1 a 1.4.6).

2. Raccolta e lavorazione del campione per l'analisi dell'espressione di geni

  1. Prendere1,5 ml di campioni di microcentrifuga nel reagente di isolamento RNA dal congelatore e lasciarli scongelare a RT all'interno di un armadietto di sicurezza per le sostanze chimiche.
  2. Aggiungere 400 μL di cloroformio a ciascun campione e agitare energicamente (ma non vorticarsi) fino alla completa miscelazione. Incubare i campioni per 5 minuti a RT.
  3. Centrifugare i tubi per 15 minuti (≥8.000 xg, 4 ° C) in una microcentrifuga da banco.
  4. Trasferire la fase acquosa (superiore) a un nuovo tubo di microcentrifuga da 1,5 ml e registrare il volume trasferito (per semplificare la procedura, si raccomanda di raccogliere volumi uguali in tutti i campioni dell'esperimento).
  5. Aggiungere 1 volume di etanolo al 100% lentamente (goccia a goccia) alla fase acquosa durante la miscelazione. Non centrifugare.
  6. Eseguire i passaggi successivi con il kit di preparazione mini RNA commerciale. Pipettare fino a 700 μL di ogni campione, incluso qualsiasi precipitato che può essere formato, in una colonna di rotazione in un tubo di raccolta da 2 ml (fornito dal produttore).
  7. Chiudi ilCoperchio e centrifuga (≥ 8.000 g, RT) per 15 s. Scartare il flusso. Ripetere il passo precedente con il campione rimanente (se presente).
  8. Seguire le istruzioni dei produttori per il lavaggio e l'eluizione di RNA (eluire ogni campione in 30 - 40 μl H 2 O senza nucleasi per ottenere una concentrazione appropriata di RNA per il passo successivo).
  9. Determinare la concentrazione di RNA e la purezza dei campioni mediante misure di assorbanza (un rapporto A 260/280 di 2,0-2,1 indica una buona purezza del campione RNA). Conservare i campioni di RNA a -80 ° C fino all'uso per l'analisi RT-qPCR.
  10. Per la conversione di RNA in cDNA e successivo PCR quantitativo, prendere 1 μg di RNA per campione e preparare la reazione di retrotransprasasi secondo le istruzioni del produttore. I campioni di cDNA ottenuti possono essere conservati a 4 ° C (per un paio di giorni) oa -20 ° C (per periodi più lunghi).
    NOTA: la preparazione del campione, la progettazione dei primer e altre considerazioni per PCR in tempo reale sono state exTesi descritti in letteratura 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Rappresentazione schematica di protocolli Thy-Noc e HU per la sincronizzazione delle cellule.

La figura 1 sintetizza le fasi necessarie per la sincronizzazione delle cellule U2OS e la successiva raccolta dei campioni per verificare la progressione attraverso il ciclo cellulare e per eseguire analisi dell'espressione genica.

La colorazione di Phospho-H3 e PI sono buoni parametri di valutazione per selezionare i metodi di sincronizzazione.

Le procedure di sincronizzazione delle cellule devono essere valutate e ottimizzate per ogni linea cellulare a causa dell'eterogeneità intrinseca delle cellule colte. La sincronizzazione nella mitosi è tipicamente raggiunta con il protocollo Thy-Noc e l'arricchimento delle cellule mitotiche dopo il trattamento con nocodazolo può essere valutato con anticorpi specifici per l'istone H3 fosforilato (pH3), tipico marcatore mitotico. Ide La neutralizzazione delle cellule positive di pH3 permette di discriminare tra le cellule mitotiche e quelle con un contenuto di 4C-DNA non sottoposto a mitosi (tutte considerate una popolazione "G2" mediante la colorazione PI). Nelle cellule U2OS il protocollo Thy-Noc porta ad un arricchimento significativo di una popolazione con contenuto di DNA 4C (Figura 2A, grafico superiore sinistro, popolazione azzurra mediante colorazione PI) e la frazione relativa delle cellule mitotiche all'interno di questa popolazione è stata abitualmente piuttosto pura (circa 91% rispetto al 2% nelle celle asincrone). Il rilascio di nocodazolo provoca una progressione sincronizzata delle cellule alla successiva fase G1, determinata dall'accumulo di una popolazione con contenuto di DNA 2C ( figura 2A , grafico a destra in alto, popolazione verde mediante la colorazione PI) e prossima scomparsa di mitosi mitosi pH3 Cellule ( figura 2A , grafico a destra inferiore). Così, i risultati della colorazione pH3 hanno confermato l'idoneità del protocollo Thy-Noc per la sinottizzazione mitotica delle cellule U2OS.

E_content "fo: keep-together.within-page =" 1 "> La sincronizzazione delle cellule U2OS in G1 / S è stata testata con timidina e idrossiaurea, due sincronizzatori ampiamente utilizzati. L'arricchimento in diverse fasi del ciclo cellulare è stato determinato mediante L'analisi FACS e la percentuale di cellule riassunte in una tabella ( Figura 2B ). Un'esposizione 24 ore di cellule U2OS a Thy (2mM) era inefficiente nell'arresto delle cellule nel confine G1 / S ( Figura 2B ), mentre il trattamento con HU o con un doppio (DT) ha determinato un arresto soddisfacente, ma solo le cellule trattate con HU hanno recuperato completamente dall'arresto e sono state avanzate in modo adeguato attraverso il ciclo cellulare, mentre il blocco DT ha indotto un arresto permanente di G1 in una frazione significativa della popolazione cellulare 13,3% delle cellule in G1 a 6 ore con DT vs 3,1% con protocollo basato su HU), che ha influenzato negativamente la sincronia delle cellule. Pertanto, l'esposizione a HU è raccomandata come un appropriato metodo di sincronizzazione G1 / SOd per le cellule U2OS.

I protocolli Thy-Noc e HU sono complementari per la sincronizzazione cellulare.

Come mostrato nella figura 3A (punto 0 ora), il trattamento con il protocollo Thy-Noc ha arrestato in modo efficiente le cellule U2OS in entrata in fase M (popolazione con contenuto di 4C DNA, mostrato in blu) e il trattamento con protocollo HU arrestato le cellule nel limite G1 / S (Popolazione con contenuto di DNA 2C, mostrato in verde / rosso). Dopo la rimozione dei farmaci, le cellule entrarono e avanzavano attraverso il ciclo cellulare in modo sincronizzato. Le cellule recuperate dal trattamento Thy-Noc sono state osservate per la prima volta nella fase iniziale di G1 (popolazione in verde) e successivamente passate attraverso G1 e fino alla fase S in modo uniforme. Le cellule recuperate dal trattamento HU avanzano sincrono attraverso S (popolazione in rosso) e G2 / M. La progressione attraverso il successivo ciclo cellulare è stata concomitante alla perdita della sincronia. ConsequentlY, i punti di tempo oltre 15 ore non sono stati inclusi in queste analisi a causa della perdita di sincronicità dopo questo punto temporale.

L'analisi Western blot di Cyclin E1 (un ciclone G1 / S) e Cyclin B1 (un ciclo G2 / M), due proteine ​​i cui livelli sono strettamente regolati nel ciclo cellulare e il marker mitotico pH3 hanno confermato la fase di ciclo cellulare di ciascuna Punto temporale analizzato da FACS ( Figura 3B ). Come previsto, le cellule in fase M (corrispondenti a 0 h di cellule Thy-Noc-sincronizzate) e le cellule in fase G2-M (da 9 a 12 ore di tempo di cellule HU-sincronizzate) hanno mostrato un accumulo drammatico di cicline B1 E livelli indeterminati di ciclina E1. Inoltre, i livelli di Cyclin B1 erano bassi per non rilevabili in fase G1 (3 h dopo il rilascio da nocodazolo) e si è osservato un accumulo graduale come le cellule hanno progredito attraverso S (dopo il rilascio Thy-Noc) e in G2 (dopo il rilascio HU). Forte etichettatura pH3 delle cellule a 0 h su sincronizzati Thy-NocHa confermato l'arricchimento delle cellule arrestate alla mitosi in questo momento. Un lieve aumento sui livelli di pH3 a 12 h dopo il rilascio da HU ha rivelato che la maggior parte delle cellule con contenuto di 4C DNA era ancora in G2 mentre la proporzione di cellule in mitosi è stata aumentata a 15 ore punto di ora. Al contrario, il pattern di espressione di Cyclin E1 ha mostrato un accumulo progressivo dalla fase iniziale G1 a fase S (procedura Thy-Noc) e graduale scomparsa nella fase G2 / M (procedura HU).

L'espressione di geni regolarmente differenziati nel ciclo cellulare può essere accuratamente analizzata con una combinazione di sincronizzazione basata su Thy-Noc e HU.

Come prova di concetto che l'analisi dell'espressione genica regolata dal ciclo cellulare è meglio analizzata mediante una combinazione di due metodi di sincronizzazione delle cellule, l'espressione di mRNA di due membri della famiglia E2F noti per avere diverse cinetica di espressione nel ciclo cellulare(E2F1 e E2F7) sono stati esaminati mediante PCR quantitativa di reversi transcriptasi (RT-qPCR). A tal fine, sono stati utilizzati protocolli di sincronizzazione Thy-Noc e HU, come riassunto in Figura 1 , e la distribuzione del ciclo cellulare è stata monitorata mediante citometria di flusso come mostrato nella Figura 3A . La Figura 4 mostra i profili mRNA di E2F1 (due grafici superiori) e E2F7 (due grafici inferiori) attraverso il ciclo cellulare. Il profilo di regolazione trascrizionale del gene codificante E2F1 è stato meglio osservato con la procedura Thy-Noc, per cui l'espressione di E2F1 ha iniziato ad aumentare gradualmente dalla fase iniziale di G1 per raggiungere un picco alla fase tardiva G1 (9 h dopo il rilascio Thy-Noc, sfondo verde). I suoi livelli sono diminuiti in seguito, concomitanti con un'entrata in fasi S e G2 (sfondi rossi e blu). Al contrario, la cinetica di espressione genica E2F7 è stata meglio rilevata dopo la sincronizzazione basata su HU (grafico inferiore, sfondo rosso), con un'espressione di picco a 6 ore dalla release (corrispondente alla transizione di fase S a G2). Thy-NocLa procedura, d'altro canto, era adatta per osservare l'induzione di E2F7, ma non la sua downregulation. Da notare, l'estensione dell'analisi oltre i 15 h riporta i profili dell'espressione mRNA E2F1 e E2F7 di punti di tempo precedenti, anche se con una diminuzione della gamma di mRNA (dati non mostrati). Complessivamente, questi risultati confermano l'importanza di lavorare con una popolazione cellulare cellulare correttamente sincronizzata per valutare non solo la cinetica dell'espressione genica ma anche l'ampiezza precisa dei cambiamenti nei livelli di mRNA.

La sincronizzazione delle cellule fornisce una migliore comprensione del programma di espressione genica influenzata dalla terapia antitumorale.

Per analizzare l'effetto del farmaco antitumorale mitomicina C (MMC) nella dinamica del ciclo cellulare e nell'espressione genica, le cellule U2OS sono state sincronizzate con HU e successivamente trattate con MMC. L'esposizione a questo agente genotossico ha attivato un controlloT in fase G2 evidente dopo 15 ore di esposizione ( figura 5A , fila inferiore, picco blu). Al contrario, le cellule non trattate avanzano normalmente tramite G1 in questo punto temporale ( figura 5A , riga superiore, picco verde). Il trattamento MMC a lungo termine (36 h) ha rivelato un arresto permanente delle cellule in fase G2 mentre le cellule senza trattamento MMC hanno mostrato una distribuzione di ciclo cellulare simile a quella mostrata dalla popolazione cellulare asincrona.

E2F1 e p21 Cip1 (CDKN1A) sono stati scelti per l'analisi dell'espressione genica in cellule trattate con MMC ( Figura 5B ), data la loro diversa regolazione dipendente dal ciclo cellulare. L'espressione di E2F1 è G1 dipendente dalla fase, come descritto nella Figura 4 , mentre l'induzione dell'espressione p21 Cip1 è accoppiata all'attivazione del ciclo cellulare e all'attivazione del punto di controllo 24 . Come mostrato nella Figura 5B (grafico superiore sinistro), espressione del gene E2F1 kiLe netics erano simili in presenza o in assenza di MMC, come le cellule hanno progredito attraverso G1 / S e nella fase S. Le differenze nell'espressione genica di E2F1 tra le cellule trattate e non trattate con MMC sono state osservate dopo 15 ore di esposizione a MMC, per cui le cellule trattate con MMC hanno espresso livelli più bassi di mRNA E2F1 rispetto alle cellule di controllo ( Figura 5B , confronta linee solide e tratteggiate). Tuttavia, nonostante la chiara differenza di espressione, non si può concludere che MMC abbassa la regolazione dell'espressione di E2F1, perché i profili del ciclo cellulare delle cellule trattati con MMC e non trattati sono chiaramente differenti in questi punti successivi, a causa di un arresto continuo di G2 imposto da MMC. Infatti, i bassi livelli di mRNA E2F1 dopo il tempo di 15 h in cellule esposte a MMC riflettono probabilmente un effetto del farmaco nella dinamica del ciclo cellulare anziché un effetto di MMC nella regolazione trascrizionale E2F1.

A differenza di E2F1, p21 Cip1 è un gene responsivo MMC. Livelli elevati di p21 Cip1 sono stati rilevati all'arresto G1 / S imposto da HU, indicando l'attivazione del punto di controllo G1 da HU ( figura 5B , punto 0h) e la sua espressione è diminuita in seguito in cellule trattate non MMC, coerenti con una progressione del ciclo cellulare non rilasciata dopo il rilascio arresto. Al contrario, il trattamento MMC ha portato ad elevati livelli mRNA p21 Cip1 ( Figura 5B , grafico a destra destra, linea solida) mentre le cellule si accumulavano in fase G2 (9 ore di esposizione MMC). Nonostante il fatto che i profili del ciclo cellulare erano simili al punto di 9 h nelle cellule trattate con controllo e MMC, l'analisi dell'espressione genica dimostra una differenza fondamentale. Le cellule esposte MMC hanno mostrato un punto di controllo G2 attivato, evidenziato dall'induzione dell'espressione p21 Cip1 , mentre le cellule non trattate sono state sottoposte a una transizione imperturbata attraverso G2, con bassi livelli di p21 Cip1 .

Dati ottenuti mediante analisi della citometria a flusso ( Fi( Grafico 5A) e dati risultanti da RT-qPCR ( figura 5B , grafici superiori) sono stati combinati in un unico grafico per ciascuno dei geni selezionati ( figura 4B , grafici inferiori). I livelli di espressione di mRNA, dove è indicata come altezza relativa delle barre mentre la distribuzione del ciclo cellulare delle cellule per ogni campione è stata illustrata con la proporzione di colori: verde per la fase G1 (contenuto di DNA 2C), blu per la fase G2 (contenuto del DNA 4C) e rosso Per la fase S (contenuto di DNA intermedio). Questo metodo combinato di rappresentazione grafica può essere utile per interpretare la distribuzione del ciclo cellulare e le analisi dell'espressione genica.

In sintesi, l'analisi dell'espressione genica accoppiata ad un metodo di sincronizzazione della cultura ha permesso l'identificazione di un gene responsivo genotossico agente (p21 Cip1 ) e ha portato a proporre che i cambiamenti osservati nell'espressione E2F1 tra le cellule trattate e non trattate con l'agente erano indirette eEventualmente correlate alle differenze nella distribuzione cellulare delle cellule.

Figura 1
Figura 1: Panoramica di due protocolli complementari di sincronizzazione delle cellule: timidina-nocodazolo e idrossiacuri. ( A ) Rappresentazione grafica del ciclo cellulare di mammiferi che indica i punti in cui viene arrestato il ciclo di arresto del ciclo mediante metodi di sincronizzazione delle cellule. La procedura a base di Thy-Noc blocca le cellule in fase iniziale della mitosi (M) mentre HU blocca le cellule al confine G1 / S. ( B ) Rappresentazione schematica del protocollo Thy-Noc di sincronizzazione delle cellule. Sono mostrati i passi utilizzati tipicamente per l'analisi dell'espressione genica e il monitoraggio del ciclo cellulare nelle cellule U2OS. ( C ) Rappresentazione schematica del protocollo HU di sincronizzazione cellulare. Sono mostrati i passi utilizzati tipicamente per l'analisi dell'espressione genica e il monitoraggio del ciclo cellulare in UCellule 2OS. È anche possibile applicare una procedura di sincronizzazione più breve che evita la fame di siero se si ottengono sincronizzazioni ottimali con un esposizione a HU a 24 ore. Clicca qui per visualizzare una versione più grande di questa figura.

figura 2
Figura 2: Valutazione dei metodi di sincronizzazione adatti. ( A ) Le colture cellulari U2OS sincronizzate asincrone e Thy-Noc sono state sottoposte a colorazione pH3 per valutare la frazione di cellule mitotiche in ogni caso. La colorazione simultanea di PI consentiva il monitoraggio del contenuto di DNA delle cellule. Nella popolazione asincrona solo una frazione minima di cellule con contenuto di DNA 4C (in blu) era positiva per il marker di mitosi. Al contrario, il protocollo Thy-Noc efficace accu(Positiva per la colorazione pH3) e ha permesso una corretta progressione alla successiva fase G1 (verde) alla rimozione del nocodazolo (punto di tempo di 3 ore). La percentuale di cellule in ciascuna fase è riepilogata nella tabella ed etichettata con colori secondo quelli impiegati negli istogrammi PI: verde per le cellule di contenuto del DNA di 2C (G1), azzurro per le cellule contenenti il ​​contenuto di DNA 4C (comprese le cellule G2 e M e chiamate come G2 negli istogrammi per semplificare la figura e rossa per le cellule con contenuto di DNA intermedio (S). ( B ) La timidina ed il HU sono state valutate per la loro efficienza di sincronizzazione del ciclo cellulare nelle cellule U2OS Le cellule sono state trattate con timidina (una o due ) O con HU per 24 ore, e la sincronizzazione delle cellule è stata esaminata mediante la colorazione di PI e l'analisi FACS.Il Summit è stato utilizzato per l'analisi dei dati di FACS Clicca qui per visualizzare una versione più grande di questa figura.

Figura 3
Figura 3: Indicare il frame temporale per la progressione uniforme delle celle dopo la sincronizzazione mediata da Thy-Noc e HU. ( A ) le cellule U2OS sono state sincronizzate in fase M tramite protocollo Thy-Noc (riga superiore) o in G1 / S passaggio tramite protocollo HU (riga inferiore). La progressione del ciclo cellulare è stata monitorata mediante la colorazione PI e l'analisi FACS del contenuto di DNA delle cellule ogni 3 ore dopo il rilascio di sostanze chimiche. Il summit è stato utilizzato per l'analisi dei dati FACS. Le cellule rilasciate dall'arresto mediato da Thy-Noc sono entrate in sincronia nella fase iniziale di G1 dopo 3 ore e hanno fatto progressi uniformemente fino alla fase S nei punti temporali successivi. Le cellule rilasciate dall'arresto mediato da HU sono passate sincronicamente attraverso le fasi S e G2. Le cellule raccolte 15 h dopo il rilascio rappresentavano i limiti per la sincronizzazione cellulare, in quanto la progressione alla fase successiva fu raggiunta soloD per una frazione della popolazione. ( B ) La sincronizzazione cellulare è stata monitorata mediante analisi Western Blot raccogliendo campioni proteici ogni 3 h e fino a 15 h dopo il rilascio. La cinetica di espressione di Cyclin E1 (CCNE1), un ciclone prevalentemente accumulato attraverso la fase S, ciclina B1 (CCNB1), prevalentemente presente da fase G2 a M e pH3, un marcatore per cellule mitotiche, corroborato profili di distribuzione del ciclo cellulare osservati mediante citometria a flusso. Actin B (ACTB) è stato utilizzato come un controllo endogeno di caricamento perché i suoi livelli non dipendono dal ciclo cellulare. (Come modificato da Mitxelena e altri 8 ). Clicca qui per visualizzare una versione più grande di questa figura.

Figura 4
Figura 4: Studio del ciclo cellulare a fasi dipendenti T Trascrizione di membri della famiglia E2F mediante metodi di sincronizzazione delle cellule complementari. Le cellule U2OS sono state arrestate in G2 / M mediante protocollo Thy-Noc o in G1 / S mediante trattamento HU e campioni sono stati raccolti per l'estrazione di RNA e l'analisi FACS ogni 3 h fino a 15 h dopo il rilascio dall'arresto. L'analisi dell'espressione genica da RT-qPCR ha rivelato un profilo di espressione E2F1 circoscritto principalmente a G1 (grafico superiore sinistro) mentre il profilo di espressione genica E2F7 è stato spostato nella fase S, con una progressiva riduzione della regolazione attraverso la fase G2 (grafico a destra inferiore). TBP è stato usato come gene endogeno per la circolazione del ciclo non cellula per calcolare i cambiamenti relativi nei livelli di mRNA ed i risultati sono stati rappresentati come valori medi e deviazione standard. La progressione attraverso il ciclo cellulare è stata determinata mediante la colorazione PI e l'analisi FACS del contenuto di DNA delle cellule. Le fasi del ciclo cellulare sono state rappresentate come colori di sfondo nei grafici: il nero (arresto all'inizio della mitosi), verde (fase G1), rosso (fase S) e blu (fase G2)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Fare clic qui per visualizzare una versione più grande di questa figura.

Figura 5
Figura 5: Impatto di MMC sull'espressione di geni e sulla progressione del ciclo cellulare. Le cellule U2OS sono state trattate con HU per 24 h e MMC (250 nM) è stato aggiunto immediatamente dopo il rilascio da arresto G1 / S mediato da HU. I campioni per l'analisi FACS e l'analisi dell'espressione genica sono stati raccolti in punti indicati. ( A ) La progressione attraverso il ciclo cellulare è stata determinata mediante la colorazione di PI e l'analisi FACS del contenuto del DNA da parte del software Summit. MMC ha indotto un moderato ritardo nella progressione attraverso la fase S (popolazione rossa) e un arresto permanente nella fase G2 (popolazione blu), come dimostra l'assenza di cellule in G1 (popolazione verde) dopo 15 ore di trattamento (riga inferiore) A non-Trattate (celle superiori). ( B ) L'analisi dell'espressione genica di E2F1 e p21 Cip1 in cellule trattate o non trattate con MMC è stata eseguita a livello mRNA da RT-qPCR. Oxa1L è stato utilizzato come un gene endogeno non-MMC-responsive e i risultati sono stati rappresentati come valori medi e SD. I grafici superiori rappresentano i livelli mRNA relativi di geni selezionati dopo il rilascio da HU e l'aggiunta di MMC. I grafici inferiori combinano i dati ottenuti con l'analisi FACS e con RT-qPCR. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

L'analisi dei geni regolati a fine sintonia coinvolti in ruoli transitori e specifici nel ciclo cellulare richiede una popolazione cellulare uniforme. Molti ricercatori utilizzano rutinamente linee di cellule tumorali di lunga durata per questi scopi e sono state sviluppate vari metodi per ottenere popolazioni di cellule sincrone (o parzialmente sincrone), allo scopo di accumulare il maggior numero di cellule in fasi definite di ciclo cellulare. Inoltre, sono stati intrapresi forti sforzi per migliorare e ottimizzare approcci ben sincronizzati di sincronizzazione. Tuttavia, tutti i protocolli di sincronizzazione hanno inconvenienti, che possono essere imputabili all'eterogeneità delle colture cellulari, all'efficienza non ottimale delle procedure di sincronizzazione, o agli effetti secondari che i sincronizzatori chimici hanno nella funzione cellulare, tra gli altri. Queste limitazioni devono essere prese in considerazione durante l'applicazione di protocolli di sincronizzazione delle celle. I ricercatori devono identificare i metodi di sincronizzazione più idonei per la loro specificaTipo di cella o esperimento. Anche coltivando diverse linee cellulari esattamente nello stesso modo, i tassi di sincronizzazione risultanti possono variare a causa di più motivi. Da una parte, la lunghezza del ciclo cellulare può variare a seconda della linea cellulare selezionata; D'altra parte, lo stesso inibitore può avere effetti contrastanti sulle diverse linee cellulari a causa di particolari caratteristiche di ciascuna linea cellulare 25 . Inoltre, la concentrazione di inibitori selezionata e il tempo di esposizione devono sempre essere regolati ad ogni linea cellulare per evitare o minimizzare la tossicità laterale non desiderabile 26 . Anche dopo l'ottimizzazione di tutti questi aspetti, l'accumulo al 100% di cellule in una determinata fase di ciclo cellulare non viene mai raggiunto e l'asincrona aumenta gradualmente dopo la rimozione della sostanza chimica 27 . Quindi, è importante capire che i metodi di sincronizzazione ottengono al meglio l'arricchimento di una popolazione parziale di cellule in un determinato periodo di tempo.

In questo w Le due procedure di sincronizzazione (Thy-Noc e HU) sono state ottimizzate per il loro utilizzo nelle cellule U2OS, entrambe utilizzate ampiamente per i saggi di sincronizzazione delle cellule 28 , 29 e 30 . Per arrestare le cellule in fase M, una combinazione di timidina e nocodazolo ha funzionato in modo efficiente nelle cellule U2OS. Data la natura citotossica del nocodazolo, è stato importante determinare il tempo di esposizione e la dose di questo inibitore per ottenere non solo una popolazione cellulare altamente sincronizzata ma anche una sopravvivenza ottimale delle cellule. L'esposizione precedente alla timidina (o teoricamente qualsiasi altro composto simile, come l'idro-idrosiurea) ha portato ad un arricchimento della popolazione cellulare nelle fasi G1 e S, diminuendo in tal modo il tempo necessario per l'esposizione a nocodazolo. Per arrestare le cellule in G1 / S, sono state considerate diverse possibilità, tra cui doppio blocco di timidina, un metodo molto efficiente nella sincronizzazione di più linee cellulari"> 31 , 32 Tuttavia, la timidina è stata scartata data i suoi risultati deludenti in U2OS.Un ciclo di trattamento con timidina ha arrestato solo una frazione di cellule, mentre due cicli di trattamento di timidina hanno bloccato efficacemente la maggior parte delle cellule in G1 / S, ma un G1 La popolazione è stata mantenuta dopo il rilascio dalla timidina e la progressione del ciclo cellulare non ha proceduto uniformemente. Al contrario, il trattamento con idrossiurea ha fornito buoni risultati di blocco G1 / S e progressione uniforme delle cellule attraverso S e in G2.

La distribuzione della fase di ciclo cellulare dovrebbe essere esaminata ogni volta che effettuano esperimenti di sincronizzazione delle cellule ( ad esempio mediante colorazione di ioduro propidio o etichettatura pH3 seguita da analisi FACS o mediante immunoblotting delle proteine ​​specifiche di fase cellulare) 16 , 33 , 34 , al fine di interpretare meglio l'espressione genica risultati. Una sincronizzazione non corretto efficaceNicità o leggere differenze inter-sperimentali nella progressione attraverso il ciclo cellulare possono portare a conclusioni sbagliate. Ad esempio, il trattamento con nocodazolo è noto per causare la rottura della funzione di checkpoint mitotica in determinate condizioni. Ciò genera una popolazione di cellule con contenuto di DNA 4C ma negativo per marcatori mitotici 34 che "scivola" la divisione mitotica e ritorna all'interfaccia con un contenuto di 4C 35 . L'emergere di questo sottoinsieme di cellule, che può essere rilevato mediante immunostaining con anticorpi anti-fosfo-H3 (vedi figura 2A ), può essere ridotto al minimo mediante l'uso di PBS freddo per i passaggi di lavaggio del nocodazolo. Un altro effetto associato all'uso di inibitori chimici che impatta la sincronia cellulare è l'attivazione del punto di controllo associata all'esposizione a questi composti 36 , 37 , un meccanismo mediante il quale la cellula attesta attivamente la progressione attraverso il ciclo cellulare finché non puòAssicurarsi che i processi precedenti a quel preciso punto (ad es. La replica corretta del DNA, l'assemblea del mandrino) siano risolti 38 . Per un metodo di sincronizzazione adeguato, l'arresto deve essere non solo efficiente ma anche completamente reversibile. Pertanto, dopo il rilascio di inibitori del ciclo cellulare, è importante analizzare se gli effetti dell'inibitore sono stati ripristinati, ad esempio analizzando l'espressione di marcatori del punto di controllo, come p21 CIP . La Figura 5B mostra che le cellule U2OS sincronizzate con idrossiurasi hanno risolto in modo efficiente il punto di controllo, poiché i livelli di p21 CIP sono stati ridotti all'espressione basale dopo il rilascio.

Nelle cellule U2OS, le percentuali di arricchimento all'arresto del ciclo cellulare rientrano nell'intervallo riportato da altri studi sulla sincronizzazione cellulare 29 , 30 , 39 : circa l'85% delle cellule con contenuto di DNA 4C (colorazione PI) e approxiIl 90% di quelli in mitosi (etichettatura positiva pH3) sul trattamento con timidina-nocodazolo e circa l'80-90% delle cellule G1 / S dopo trattamento di idrossiurea. Il rilascio dall'arresto del ciclo cellulare in genere porta una corretta progressione attraverso la successiva o due fasi in modo uniforme, anche se la sincronizzazione viene perduta invariabilmente dopo diverse ore e le cellule non sono in grado di completare un intero ciclo di divisione cellulare in modo sincronizzato. Pertanto, per ottenere un quadro completo di tutte le fasi del ciclo cellulare, il protocollo proposto in questo lavoro utilizza due metodi di sincronizzazione provenienti da diverse parti del ciclo cellulare. Come mostrato nella Figura 3A , ogni singolo protocollo non ha assicurato la sincronicità su un intero ciclo cellulare. La sincronizzazione basato su Thy-Noc ha fornito un quadro appropriato per i processi che si verificano nelle fasi G1-S, mentre le cellule rilasciate da HU sono state adatte per l'analisi degli eventi che si verificano durante S e G2 / M. Le complementarità dei due procedimenti selezionatiSono state dimostrate dall'analisi di due membri della famiglia di fattori di trascrizione E2F ( Figura 4 ), sostenendo che la combinazione di due metodi che si sincronizzano in diverse fasi del ciclo cellulare è un approccio potente per stabilire con precisione l'espressione genica del ciclo-regolato E meglio comprendere il loro ruolo fisiologico.

Un'applicazione attenta delle procedure di sincronizzazione delle cellule si concentra sulla valutazione dell'impatto di potenziali agenti terapeutici. L'effetto dei composti farmaceutici, come quelli con attività antitumorale, è spesso studiato in popolazioni di cellule asincrone. In queste impostazioni è possibile determinare l'implicazione del farmaco selezionato nell'induzione di diversi processi come la morte cellulare, l'arresto del ciclo cellulare o la senescenza 7 , 40 . Tuttavia, la selezione di impostazioni delle celle asincrone per l'identificazione di eventi molecolari precisi che regolanoTali processi possono portare a conclusioni incomplete o parzialmente sbagliate. Questo punto, spesso trascurato, è stato illustrato nel presente lavoro analizzando l'effetto del farmaco MMC chemioterapico sull'E2F1 e sull'espressione del gene p21 Cip1 ( Figura 5 ). Nel complesso, la combinazione di sincronizzazione cellulare e il trattamento con agenti genotossici fornisce un contesto appropriato in cui studiare l'espressione di geni che sono reattivi all'agente genotossico e di discriminare da quelli colpiti dalle perturbazioni del ciclo cellulare imposte dall'agente.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno niente da rivelare.

Acknowledgments

Ringraziamo i membri del laboratorio Zubiaga e dei laboratori Altmeyer per un utile colloquio e per un supporto tecnico. Questo lavoro è stato sostenuto da sovvenzioni del ministero spagnolo (SAF2015-67562-R, MINECO / FEDER, UE), del governo basco (IT634-13 e KK-2015/89) e dell'Università del Paese basco UPV / EHU UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Studiare l'espressione del gene regolamentata mediante ciclo cellulare da due protocolli complementari di sincronizzazione delle cellule
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter