Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Studier av celle-regulert genuttrykk av to komplementære cellesynkroniseringsprotokoller

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Vi rapporterer to cellesynkroniseringsprotokoller som gir en sammenheng for å studere hendelser relatert til bestemte faser av cellecyklussen. Vi viser at denne tilnærmingen er nyttig for å analysere reguleringen av spesifikke gener i en ubrukt cellesyklus eller ved eksponering for midler som påvirker cellesyklusen.

Abstract

Genuttrykksprogrammet til cellesyklusen representerer et kritisk trinn for å forstå cellesyklusavhengige prosesser og deres rolle i sykdommer som kreft. Cellsyklusregulert genekspresjonsanalyse avhenger av cellesynkronisering i spesifikke faser. Her beskriver vi en metode som benytter to komplementære synkroniseringsprotokoller som ofte brukes til å studere periodisk variasjon av genuttrykk under cellesyklusen. Begge prosedyrene er basert på forbigående blokkering av celle syklusen i ett definert punkt. Synkroniseringsprotokollen ved hydroksyurea (HU) -behandling fører til cellulær arrestering i sen G1 / tidlig S-fase, og frigjøring fra HU-mediert arrestering gir en cellulær befolkning jevnt fremgang gjennom S og G2 / M. Synkroniseringsprotokollen ved behandling med thymidin og nocodazol (Thy-Noc) blokkerer celler i tidlig mitose, og frigjøring fra Thy-Noc-mediert arrest gir en synkronisert cellulær populasjon egnet for G1-fase og S-fase-enPrøv studier. Anvendelse av begge prosedyrer krever overvåking av cellesyklusfordelingsprofiler, som typisk utføres etter propidiumjodid (PI) -farging av cellene og strømningscytometri-mediert analyse av DNA-innhold. Vi viser at kombinert bruk av to synkroniseringsprotokoller er en robust tilnærming for å tydelig bestemme transkripsjonsprofiler av gener som er differensielt regulert i cellesyklusen ( dvs. E2F1 og E2F7), og følgelig å få en bedre forståelse av deres rolle i cellesyklusen prosesser. Videre viser vi at denne tilnærmingen er nyttig for undersøkelsen av mekanismer som ligger til grund for narkotikabaserte terapier ( dvs. mitomycin C, et anticancermiddel) fordi det tillater å diskriminere gener som reagerer på det genotoksiske middel fra de som bare er berørt av cellecyklusforstyrrelser Pålagt av agenten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Overgang gjennom alle faser av celle syklusen er koblet til et tett regulert gen ekspresjon program. Denne koordinert "på og av" av gentranskripsjon gjennom cellesyklusen antas å være under kontroll av komplekse transkripsjonelle regulatorsystemer, og regulerer ikke bare timingen, men også nivåene av genuttrykk. Deregulering av nøkkelcellesykluskomponenter er kjent for å bidra til utviklingen av flere sykdommer og er et veletablert kjennemerke for tumorigenese 1 , 2 . Genom-brede transskriptomiske analyser utført i gjær- og pattedyrceller har vist at et stort antall gener utviser periodiske genuttrykksmønstre i cellesyklusen, noe som antyder at transkripsjonsfluktuasjon under cellesyklusen er en refleksjon av det tidsmessige kravet til et gitt genprodukt I en nøyaktig fase 3 , 4 , 5 .

En viktig oppgave i studiet av celle syklusregulert genuttrykk er synkroniseringen av celler i bestemte cellefaser. Cellsynkronisering bidrar til å tolke assosiasjon av et genuttrykksmønster til en bestemt cellefaseovergang, og det har ført til en bedre forståelse av reguleringen og funksjonen til mange gener. Cellsynkronisering er også viktig for å studere virkningsmekanismen for anticancer-legemidler, da kjemoterapeutiske midler er kjent for å påvirke både genuttrykk og cellecykluskinetikk 6 , 7 . Likevel er det ofte vanskelig å avgjøre om genuttrykksforskjeller som er resultatet av behandling med disse midlene, er et direkte respons på behandlingen, eller er bare konsekvensen av endringer i cellecyklusprofiler. For å skille mellom disse mulighetene, bør genuttrykk analyseres i celler som har vært sYnkronisert før tilsetning av det kjemoterapeutiske medikamentet.

Med unntak av noen primære celler som fersk isolerte lymfoide celler, som utgjør en homogen cellepopulasjon synkronisert i G08, vokser in vitro etablerte cellelinjer asynkront i kultur. Under vanlige vekstforhold finnes disse asynkront syklusceller i alle faser av cellecyklusen, men fortrinnsvis i G1 9 . Derfor gir denne sammenhengen ikke et optimalt scenario for funksjonelle eller genuttrykksanalyser i en bestemt cellefasefase ( f.eks. G1, S etc.). Ikke-transformerte immortaliserte cellelinjer ( f.eks. Fibroblaster) kan synkroniseres med såkalte fysiologiske metoder 10 . Disse metodene er basert på de beholdte primære cellefunksjonene i ikke-transformerte celler, slik som cellekontaktinhibering og vekstfaktoravhengighet for å fortsette sykling. fjerningAv serum i kombinasjon med kontaktinhibering gjør ikke-transformerte celler arrestert ved G0 / G1. Imidlertid krever synkronisert celle syklus oppføring og progresjon ofte subkultur, som også involverer kunstig løsgjørelse av cellene og replating 10 . Viktigst er denne metoden ikke egnet for synkronisering av transformerte cellelinjer, det store flertallet av etablerte cellelinjer som for tiden er i bruk, karakterisert ved manglende cellekontakt-mediert vekstinhibering eller respons på vekstfaktoruttak. Det er således klart at alternative metoder kreves for effektiv cellesynkronisering i spesifikke faser av cellesyklusen. Generelt sett er de mest brukte synkroniseringsmetodene basert på forbigående kjemisk eller farmakologisk inhibering av et definert punkt i cellesyklusen, typisk DNA-syntese eller mitotisk spindeldannelse. Inhibering av DNA-syntese synkroniserer celler ved å arrestere dem i sen G1 eller tidlig S-fase. Dette kan være achiEved ved tilsetning av forbindelser som mimosin, en inhibitor av nukleotidbiosyntese 11 , 12 , aphidicolin, en inhibitor av DNA-polymeraser 13 , 14 , hydroksyurea, en inhibitor av ribonukleotidreduktase 15 , 16 eller ved overskytende mengder av tymidin 17 , 18 . På den annen side er inhibitorer av mikrotubulumpolymerisasjon, slik som kolchicin eller nokodazol, i stand til å blokkere mitotisk spindeldannelse som fører til cellesynkronisering ved tidlig M-fase 19 , 20 , 21 .

I dette arbeidet beskriver vi en metode som involverer to komplementære synkroniseringsprotokoller basert på forbigående kjemisk inhibering for å studere ekspresjonen av celle-syklusregulerte gener ved mRNAnivå. Denne metoden er grunnleggende for å definere rollen som celle syklusgener i spesifikke celle syklus prosesser. Videre gir den en generell ramme for å studere effekten av anticancerbehandlinger for å nøyaktig oppdage medisinresponsive gener og for å minimere feilfortolkninger avledet fra forstyrrelser i cellecyklusprogresjon generert av disse legemidlene.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cellulær synkronisering, frigjøring og overvåkning av cellesyklusprogresjon

  1. Thymidin- og nokodazolbasert (Thy-Noc) synkronisering og frigjøring av U2OS-celler fra mykose
    1. Forbered det nødvendige cellekulturmediet. U2OS-celler dyrkes rutinemessig i DMEM-Glutamin-medium komplementert med 10% (vol / vol) FBS (valgfritt: 1% penicillin / streptomycin). Utfør alt medium forberedelse og manipulering under sterile forhold og oppvarmings komplementert medium (fra nå av referert til som "komplett medium") til 37 ° C før bruk.
    2. Frø 2 x 10 6 U2OS celler per 100 mm fat i 10 ml komplett dyrkningsmedium. For å beregne antall retter som trengs, må du ta hensyn til at hver 100 mm tallerken vanligvis gir nok mitotiske celler til å plate om ca. 5 brønner på en 6-brønn plate (0,2 - 0,25 x 106 celler / brønn) (se figur 1B ). To brønner per valgt tidspunkt er requirEd i forsøket (1 brønn for RNA-ekstraksjon og 1 brønn for celle syklus overvåking). I tillegg kan en tredje brønn bli samlet per tidspunkt for proteinanalyse.
      MERK: Plate celler om kvelden (rundt 7 pm) slik at påfølgende trinn kan utføres i arbeidstiden de følgende dagene. Inkluder 2 ekstra brønner av asynkrone voksende celler for å definere FACS analyse kompensasjonsinnstillinger.
    3. La celler feste ved å inkubere 100 mm tallerkener ved 37 ° C i en fuktig atmosfære med 5% CO2 i 24 timer.
    4. For tymidinblokken, lag en 200 mM tymidin-stamopløsning ved å oppløse 145,2 mg tymidinpulver i 3 ml H20 (eller tilsvarende mengder) og steriliser oppløsningen ved filtrering gjennom et 0,2 μm porestørrelsesfilter. Liten oppvarming kan bidra til oppløsning av tymidin. Tilsett 100 μl av den ferskt tilberedte 200 mM stammen til hver 100 mm dyrkningsskål (sluttkonsentrasjon 2 mM). Inkuber celler med tymidin i 20 timer ved 3776; C i en fuktig atmosfære med 5% CO2.
      MERK: Behandle celler om kvelden (rundt 7 pm), for å få tid til å utføre både thymidinfrigivelse og nocodazolblokk den følgende dag.
    5. For å frigjøre fra tymidinblokken fjerner du tymidinholdig vekstmedium om ettermiddagen den følgende dag (3 pm); Vask celler to ganger med forvarmet 1x PBS og tilsett 10 ml komplett medium til hver 100 mm tallerken. Inkubér celler i 5 timer ved 37 ° C i en fuktig atmosfære med 5% CO2.
    6. For mitotisk cellearrest, legg til nokodazol til en sluttkonsentrasjon på 50 ng / ml (8 pm). Forbered en stamløsning ved å oppløse nocodazolpulver i DMSO ( f.eks. 5 mg / ml) og lagre frosset ved -20 ° C. Inkuber celler med nokodazol i ikke lenger enn 10-11 timer ved 37 ° C i en fuktig atmosfære med 5% CO2.
    7. Frigivelse fra nokodazol-mediert arrest i tidlig M-fase (mitotisk shake-off) og samling av prøver på flere tidspunkterNts (starter klokka 6-7).
      1. Fjern avrundede (mitotiske) celler ved å riste hver plate og forsiktig pipettere nokodazol-holdig vekstmedium. Samle medium med frittliggende celler fra hver 100 mm plate i 50 ml sterile rør, sentrifuge (300 xg, 5 min, romtemperatur (RT)) og vaske celler to ganger ved å tilsette 1 x PBS etterfulgt av sentrifugering. Bruk av kald PBS eller PBS pluss nokodazol anbefales for å unngå mitotisk slippasje (se avsnittet Diskusjon).
      2. Resuspendere mitotiske celler samlet fra hver 100 mm plate i 10 ml komplett medium. Lagre 2 mL for RNA-ekstraksjon og 2 mL for FACS-analyse for 0 timepunktet (ca. 0,2-0,25 x 106 celler per prøve).
      3. Plasser gjenværende mitotiske celler igjen for etterfølgende tidspunkter i 6 brønnplater (2 ml / brønn, 0,2-0,25 x 106 celler / brønn).
        MERK: Husk at 2 brønner kreves per valgt tidspunkt (1 for RNA og 1 for FACS analyse).
    8. Samle prøver på selEcted tidspunkter. Hver 1,5 til 3 timer anbefales for å oppnå en tilstrekkelig profil av cellesyklusprogresjonen.
      1. For RNA-ekstraksjon, fjern medium, skyll godt med 2 ml pre-warm 1x PBS og tilsett 1 mL egnet RNA-isolasjonsreagens ( f.eks. TRIzol) i brønnen (utfør dette siste trinnet i et sikkerhetsskap for kjemikalier). Pipetter opp og ned for å løsne og lyse celler, overfør cellemelat til et 1,5 ml mikrocentrifugerør, inkuber 5 minutter ved RT og oppbevaringsrøret ved -80 ° C til videre bruk.
      2. For FACS-analyse skylles godt med 2 ml pre-warm 1x PBS, tilsett forsiktig oppløsning av trypsin-EDTA (0,3 ml / brønn) for å løsne celler, blokkere Trypsin-EDTA ved å tilsette 1 ml komplett medium og samle hver prøve i en separat 15 ml rør.
        1. Sentrifugerceller (300 xg, 5 min, RT), lagrer cellulær pellet og kasserer supernatant. For å fikse celler, resuspender celler i 1 ml avkjølt 70% (volum / volum) etanol i 1x PBS ved forsiktig vortexing rør, og plasser dem på is for appOmtrent 15 minutter før lagring ved 4 ° C eller flekker for videre analyse med FACS (beskrevet i trinnene 1.4-1.5).
  2. HU-basert synkronisering og utgivelse av U2OS-celler fra G1 / S-grensen
    1. Klargjør fullstendig cellekulturmedium som beskrevet i trinn 1.1.
    2. Seed 0,25 x 106 U2OS celler per brønn i 6 brønnplater (2 ml komplett dyrkningsmedium per brønn). For å beregne antall brønner som trengs for forsøket, må du ta hensyn til at to brønner kreves per valgt tidspunkt (1 brønn for RNA-ekstraksjon og 1 brønn for cellesyklusovervåking), og at 2 brønner av asynkrone voksende celler er Trengte å definere FACS analyse kompensasjon innstillinger.
    3. La celler feste ved å inkubere 6-brønnplater over natten (O / N) ved 37 ° C i en fuktig atmosfære med 5% CO2.
    4. Fjern komplett medium fra brønner følgende morgen og tilsett 2 mlAv forvarmet FBS-fri DMEM-Glutamin-medium per brønn. Inkubér celler i ytterligere 24 timer ved 37 ° C i en fuktig atmosfære med 5% CO2.
      MERK: Utfør dette trinnet i alle brønner unntatt 2 (de lagrede for å definere FACS-innstillinger). Serumuttakstrinn kan utelates dersom effektiv synkronisering oppnås ved ganske enkelt å inkubere celler med HU.
    5. G1 / S cellesyklusarrest med HU.
      1. Forbered fersk HU stamløsning (500 mM) før hver bruk. Tilsett 2 ml H20 til 76,06 mg HU pulver og bland til det er grundig oppløst. Steriliser løsningen ved filtrering gjennom et 0,2 μm porestørrelsesfilter. Bland 50 ml komplett medium med 400 μl filtersterilisert HU stamløsning for en slutt HU konsentrasjon på 4 mM.
      2. Fjern medium fra alle brønner unntatt de 2 brønnene som trengs for å definere FACS-innstillinger og erstatt med et nytilberedt 4 mM HU-holdig komplett medium (2 ml / brønn).
      3. Inkubér celler i 24 timer iHU-holdig medium ved 37 ° C i en fuktig atmosfære med 5% CO2.
    6. Frigivelse av celler fra HU-mediert arrestasjon. Fjern HU-holdig medium fra brønner og skyll brønnene to ganger med forvarmet 1x PBS (2 ml hver gang). Tilsett 2 ml komplett medium per brønn. Samle 2 prøver for 0 h tidspunktet (1 for RNA-ekstraksjon og 1 for cellecyklusarrest verifisering av FACS), samt 2 prøver lagret for FACS-innstillinger. Plasser gjenværende brønner i inkubatoren.
    7. Samle prøver hver 1.5 til 3 timer for å oppnå en tilstrekkelig fordeling av cellecyklusprogresjon. På hvert tidspunkt, utfør prøvebehandling (for RNA-ekstraksjon og for FACS-analyse) som beskrevet i 1.1.8.1-1.1.8.2.
  3. Behandling med DNA-skadelige stoffer
    MERK: Når målet er å belyse effekten av en forbindelse ( f.eks. DNA-skadelige midler) i cellesyklushendelser, kan noen av de tidligere beskrevne synkroniseringsmetoder væreKombinert med behandling av celler med det genotoksiske middel. For å kunne velge synkroniseringsmetoden, er det viktig å vurdere fasen av cellesyklusen som vi ønsker å analysere. Generelt kan Thy-Noc-prosedyren være egnet til å studere effekten av en forbindelse i G1-fase eller S-faseinngang, mens HU-mediert synkronisering kan være mer egnet til å studere virkningen i S til G2-faser eller i inngangen til mitose.
    1. Analyse av effekten av genotoksiske midler i G1-fase eller S-faseinngang
      1. Synkroniser celler som beskrevet i 1.1.2. Til 1.1.6.
      2. Frigjør celler fra nokodazol og replater dem som beskrevet i 1.1.7. Inkuber dem ved 37 ° C i en fuktig atmosfære med 5% CO2 i 3 timer for å la dem feste før tilsetning av stoffet (nødvendig inkubasjonsperiode kan variere avhengig av cellelinjen).
      3. Legg til agent og samle prøver som tidligere beskrevet i 1.1.8.
    2. Analyse av effekten av genotoksiske midler i SG2 faser eller M-inngang
      1. Synkroniser celler som beskrevet i 1.2.2. Til 1.2.5.
      2. Frigjør celler fra HU som beskrevet i 1.2.6. Og legg til agent straks.
      3. Samle prøver som tidligere beskrevet i 1.8.
  4. Overvåking av cellesynkronisering og progresjon gjennom cellesyklusen ved hjelp av propidiumjodid (PI) -farging og FACS-analyse
    MERK: Prøver samlet på alle tidspunkter sammen med de som kreves for å definere FACS-innstillinger, kan lagres ved 4 ° C når de er løst (som nevnt i 1.1.8.2). Utfør farging med PI-løsning etterfulgt av FACS-analyse for alle prøver av forsøket samtidig. PI interkalkerer inn i hovedsporet av dobbeltstrenget DNA som produserer et høyt fluorescerende signal når det blir opphisset ved 535 nm med en bred utslippstopp på rundt 600 nm. Siden PI også kan binde til dobbeltstrenget RNA, er det nødvendig å behandle cellene med RNase for optimal DNA-oppløsning.
    1. Forbered nyopprettet PI-fargeløsning. En PI-stamløsning kan fremstilles ved å oppløse PI-pulver i PBS ( f.eks. 5 mg / ml). Oppbevar oppløsningen ved 4 ° C (i mørket). Fargeløsning består av PI (140 μM), natriumcitrat (38 mM) og Triton X-100 (0,01% v / v).
    2. Varm opp en passende overflate ( f.eks. Ovn) til 37 ° C.
    3. Sentrifuger faste celler (450 xg, 5 min, RT), dekanter supernatant (etanol) og vask en gang med 1x PBS.
    4. Sentrifuger cellene igjen, fjern PBS og tilsett 300 μL PI-fargeløsning per prøve (unntatt til en av prøvene for FACS-innstillinger, legg til PBS til denne prøven i stedet).
    5. Overfør celler til FACS-rør (5 ml runde polystyrenrør).
    6. Tilsett 1 μL RNase A til hver prøve, bland og inkuber prøver i 30 minutter i mørket ved 37 ° C. Prøver kan lagres beskyttet mot lys ved 4 ° C i maksimalt 2 - 3 dager.
    7. Analyser DNA-innhold i prøver ved strømningcytometri. Definer FACS analyse kompensasjonsinnstillinger med PI-farget asynkron prøve. Bruk blank prøve (uten PI-fargeløsning) for å sjekke for autofluorescens. Grunnleggende om PI-fargemediert analyse av DNA-innhold ved hjelp av flytcytometri er tidligere beskrevet 9 .
  5. Bestemmelse av mitotisk indeks ved dobbelt fosfor-H3 (Ser 10) / PI-farging
    MERK: Celler som gjennomgår mitose kan lett oppdages ved hjelp av flytcytometri med antistoffer spesifikt for fosforhiston H3 i serin 10 (pH3). En samtidig PI-farging er nyttig for å bestemme DNA-innholdsbasert distribusjon av cellepopulasjonen. Det kreves 5 prøver for de optimale konfigurasjonene av FACS-innstillinger: tom, PI-kun, pH3-kun, sekundær antistoff-bare og dobbeltfarging.
    1. Sentrifuger faste celler (450 xg, 5 min, 4 ° C) og kast supernatanten. Følgende trinn er beskrevet for å utføre farging i 15 ml rør.
    2. Vask celler ved å legge til 1Ml PBS-T (PBS + 0,05% Tween-20) til pellet og sentrifuge (450 xg, 5 min, 4 ° C). Fjern supernatanten.
    3. Tilsett anti-pH3 antistoff fortynnet (1: 500) i 100-200 μl PBS-T + 3% BSA og inkuber med gynging i 2 timer ved RT (eller O / N ved 4 ° C).
    4. Tilsett 2 ml PBS-T (PBS + 0,05% Tween-20) og sentrifuger (450 xg, 5 min, 4 ° C). Fjern supernatanten.
    5. Vask enda en gang ved å tilsette 2 ml PBS-T til pelleten, sentrifuger og kast supernatanten.
    6. Tilsett sekundært antistoff (anti-kanin AlexaFluor 488 i tilfelle av valgt pH3-antistoff) fortynnet (1: 500) i 100-200 μl PBS-T + 3% BSA og inkuber med gynging i 1 time ved RT (eller O / N Ved 4 ° C). Beskytt prøver fra lys.
    7. Vask to ganger med PBS-T (2 ml) ved sentrifugering som beskrevet i trinn 1.5.4.
    8. Utfør PI-farging som beskrevet (trinn 1.4.1 til 1.4.6).

2. Prøveinnsamling og prosessering for genuttryksanalyse

  1. Ta1,5 ml mikrocentrifugeprøver i RNA-isolasjonsreagenset ut av fryseren og la dem tine på RT inne i et sikkerhetsskap for kjemikalier.
  2. Tilsett 400 μL kloroform til hver prøve og rist kraftig (men ikke vortex) til fullstendig blanding. Inkuber prøver i 5 min ved RT.
  3. Sentrifugerør i 15 minutter (≥8000 xg, 4 ° C) i en benk-mikropentrifuge.
  4. Overfør den vandige (øvre) fasen til et nytt 1,5 ml mikrocentrifugerør og registrer det overførte volumet (for å forenkle prosedyren anbefales det å samle like mengder i alle prøver av forsøket).
  5. Tilsett 1 volum 100% etanol sakte (drop-by-drop) til den vandige fasen under blanding. Ikke sentrifuger.
  6. Utfør de neste trinnene med det kommersielle RNA mini-prep-settet. Pipet opptil 700 μL av hver prøve, inkludert eventuell presipitat som kan ha dannet, til en spinnkolonne i et 2 ml oppsamlingsrør (levert av produsenten).
  7. LukkLokket og sentrifugen (≥ 8000 g, RT) i 15 s. Kast bort gjennomstrømmingen. Gjenta forrige trinn med gjenværende prøve (hvis noen).
  8. Følg produsentens instruksjoner for RNA-vasking og eluering (elu hver prøve i 30-40 μl nukleasefri H20 for å oppnå en passende RNA-konsentrasjon for neste trinn).
  9. Bestem RNA-konsentrasjon og renhet av prøver ved absorbansmålinger (et A 260/280 forhold på 2,0-2,1 indikerer god renhet av RNA-prøven). Oppbevar RNA-prøver ved -80 ° C til bruk for RT-qPCR-analyse.
  10. For RNA-konvertering til cDNA og påfølgende kvantitativ-PCR, ta 1 μg RNA per prøve og lagre retrotranscriptase-reaksjon i henhold til produsentens instruksjoner. Oppnådde cDNA-prøver kan lagres ved 4 ° C (i et par dager) eller ved -20 ° C (i lengre tidsperioder).
    MERK: Prøveforberedelse, primerdesign og andre hensyn til sanntids-PCR har vært exTett beskrevet i litteraturen 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Skjematisk fremstilling av Thy-Noc og HU-baserte protokoller for cellesynkronisering.

Figur 1 oppsummerer trinnene som kreves for U2OS-cellesynkronisering og etterfølgende prøveinnsamling for å verifisere progresjon gjennom cellesyklusen og å utføre genuttryksanalyser.

Fosfor-H3 og PI-farging er gode evalueringsparametere for å velge synkroniseringsmetoder.

Cellsynkroniseringsprosedyrer må vurderes og optimaliseres for hver cellelinje på grunn av inneboende heterogenitet av dyrkede celler. Synkronisering i mitose oppnås vanligvis med Thy-Noc-protokollen, og anrikning av mitotiske celler etter behandling med nokodazol kan vurderes med antistoffer som er spesifikke for fosforylert histon H3 (pH3), en typisk mitotisk markør. Ide Ntifisering av pH3-positive celler tillater diskriminering mellom mitotiske celler og de med et 4C-DNA-innhold som ikke gjennomgår mitose (som alle betraktes som en "G2" -populasjon ved PI-farging). I U2OS-celler fører Thy-Noc-protokollen til en betydelig anrikning av en populasjon med 4C DNA-innhold (Figur 2A, øvre venstre graf, blå populasjon ved PI-farging), og den relative fraksjonen av mitotiske celler i denne populasjonen var rutinemessig ganske ren (ca. 91% sammenlignet med 2% i asynkronceller). Frigivelse fra nokodazol resulterer i en synkronisert progresjon av celler til neste G1-fase, bestemt ved akkumulering av en populasjon med 2C DNA-innhold ( Figur 2A , øvre høyre graf, grønn populasjon ved PI-farging) og den nærmeste forsvinden av pH3-positiv mitotisk Celler ( figur 2A , nedre høyre graf). Således bekreftet pH3-fargingsresultater egnetheten til Thy-Noc-protokollen for mitotisk synkronisering av U2OS-celler.

E_content "fo: keep-together.within-page =" 1 "> Synkronisering av U2OS-celler i G1 / S ble testet med tymidin og hydroksyurea, to mye brukte synkroniseringsapparater. Berikning i forskjellige faser av cellesyklusen ble bestemt ved PI-farging og FACS-analyse og prosentandel av celler oppsummert i en tabell ( Figur 2B ). En 24-timers eksponering av U2OS-celler til Thy (2mM) var ineffektiv i å arrestere celler i G1 / S-grense ( figur 2B ), mens behandling med HU eller med en dobbel Tunnelundersmøring (DT) resulterte i en tilfredsstillende arrestering. Imidlertid gjenvunnet bare HU-behandlede celler fullstendig fra arrestasjonen og utviklet seg tilstrekkelig gjennom cellesyklusen. DT-blokk induserte derimot en permanent G1-armering i en betydelig del av cellepopulasjonen ( 13,3% av cellene i G1 ved 6 h tidspunkt med DT vs 3,1% med HU-basert protokoll), som negativt påvirket cellesynkronisering. Eksponering for HU anbefales derfor som en passende G1 / S synkroniseringsmetodeOd for U2OS-celler.

Thy-Noc- og HU-baserte protokoller er komplementære for cellesynkronisering.

Som vist i Figur 3A (0 timer), behandlet behandling med Thy-Noc-protokollen effektivt U2OS-celler i M-fase-inngang (populasjon med 4C DNA-innhold, vist i blått) og behandling ved HU-protokoll-arresterte celler i G1 / S-grense (Populasjon med 2C DNA-innhold, vist i grønt / rødt). Ved fjerning av legemidlene inngikk cellene og utviklet seg gjennom cellesyklusen på en synkronisert måte. Celler som ble gjenfunnet fra Thy-Noc-behandlingen ble først observert i tidlig G1-fase (populasjon i grønt) og deretter overført gjennom G1 og opp til S-fasen på en jevn måte. Celler som er gjenvunnet fra HU-behandling, utviklet seg synkront gjennom S (populasjon i rødt) og G2 / M. Progresjon gjennom neste celle syklus var samtidig med tap av synkronisitet. ConsequentlY, tidspunkter over 15 timer var ikke inkludert i disse analysene på grunn av tap av synkronisitet etter dette tidspunktet.

Western blot-analyse av cyklin E1 (et G1 / S-sylinder) og cyklin B1 (en G2 / M-cyklin), to proteiner hvis nivåer er tett regulert i cellesyklusen og av den mitotiske markør pH3, bekreftet cellesyklusfasen av hver Tidspunkt analysert av FACS ( Figur 3B ). Som forventet viste celler i M-fase (tilsvarende 0 h tidspunkt for Thy-Noc-synkroniserte celler) og celler i G2 til M fase (9 h til 12 h tidspunktspunkt for HU-synkroniserte celler) en dramatisk akkumulering av cyklin B1 Og uoppdagbare nivåer av syklin E1. Videre var Cyclin B1-nivåene lave til å ikke kunne detekteres i G1-fase (3 timer ved frigjøring fra nokodazol), og gradvis akkumulering ble observert når celler utviklet seg gjennom S (etter Thy-Noc-frigivelse) og inn i G2 (etter HU-frigivelse). Sterk pH3-merking av celler ved 0 timer etter Thy-Noc synkroniseringPå bekreftet anrikning av celler arrestert ved mitose på dette tidspunktet. En liten økning på pH3 nivåer ved 12 timer etter frigjøring fra HU viste at flertallet av celler med 4C DNA-innhold fortsatt var i G2 mens andelen celler i mitose ble økt ved 15 timer tidspunkt. I motsetning til dette viste uttrykksmønsteret for cyklin E1 en progressiv akkumulering fra tidlig G1 til S-fase inngang (Thy-Noc-prosedyre) og gradvis forsvinning i G2 / M-fase (HU-prosedyre).

Ekspresjon av gener som er differensielt regulert i cellesyklusen, kan analyseres nøyaktig med en kombinasjon av Thy-Noc- og HU-basert synkronisering.

Som et bevis på konseptet at cellesyklusregulert genekspresjonsanalyse best analyseres ved en kombinasjon av tocellesynkroniseringsmetoder, har mRNA-ekspresjon av to E2F-familiemedlemmer kjent for å ha forskjellig ekspresjonskinetikk i cellesyklusen(E2F1 og E2F7) ble undersøkt ved revers transkriptase kvantitativ PCR (RT-qPCR). Til dette formål ble Thy-Noc og HU synkroniseringsprotokoller anvendt, som oppsummert i figur 1 , og cellesyklusfordeling ble overvåket ved hjelp av flytcytometri som vist i figur 3A . Figur 4 viser E2F1 (øvre to grafer) og E2F7 (nedre to grafer) mRNA-profiler gjennom cellesyklusen. Transkripsjonsreguleringsprofilen for E2F1-kodende gen ble best observert med Thy-Noc-prosedyren, hvorved E2F1-ekspresjonen begynte å gradvis øke fra tidlig G1-fase for å nå en topp ved sen G1-fase (9 timer etter Thy-Noc-frigjøring, grønn bakgrunn). Dens nivåer ble deretter redusert samtidig med inngang i S- og G2-faser (rød og blå bakgrunn). I motsetning ble E2F7-genuttrykkskinetikken best detektert etter HU-basert synkronisering (nedre graf; rød bakgrunn), med et topputtrykk på 6 timer fra utgivelse (tilsvarende S til G2-faseovergang). Thy-NocProsedyren var derimot egnet for å observere induksjon av E2F7, men ikke dens downregulering. Av anmerkning gjengitt utvidelsen av analysen utover 15 h tidspunktet E2F1- og E2F7-mRNA-ekspresjonsprofiler av tidligere tidspunkter, men med et redusert utvalg av mRNA-variasjon (data ikke vist). Samlet sett bekrefter disse resultatene viktigheten av å jobbe med en riktig synkronisert cellepopulasjon for å vurdere ikke bare genuttrykkskinetikken, men også den nøyaktige amplitude av endringer i mRNA-nivåene.

Cellsynkronisering gir en bedre forståelse av genuttrykksprogrammet påvirket av anticancerbehandling.

For å analysere effekten av antitumormedikamentet mitomycin C (MMC) i cellesyklusdynamikk så vel som i genuttrykk, ble U2OS-celler først synkronisert med HU og deretter behandlet med MMC. Eksponering for dette genotoksiske middel aktiverte en kontrollpunktT i G2 fase som var tydelig etter 15 timers eksponering ( Figur 5A , nedre rad, blå topp). Derimot utviklet ubehandlede celler normalt gjennom G1 på dette tidspunktet ( Figur 5A , øvre rad, grønn topp). Langsiktig MMC-behandling (36 timer) avslørte en permanent arrestasjon av celler i G2-fase, mens celler uten MMC-behandling viste en cellecykeldistribusjon som lignet den som er vist av asynkroncellepopulasjonen.

E2F1 og p21 Cip1 (CDKN1A) ble valgt for geneksponeringsanalyse i MMC-behandlede celler ( Figur 5B ), gitt deres forskjellige cellesyklusavhengige regulering. Ekspresjon av E2F1 er G1-faseavhengig, som beskrevet i figur 4 , mens induksjon av p21 Cip1- ekspresjon er koblet til cellecyklusarrest / kontrollpunktsaktivering 24 . Som vist i figur 5B (øvre venstre graf), E2F1-genuttrykk kiNetik var lik i nærvær eller fravær av MMC, da celler utviklet seg gjennom G1 / S og inn i S-fasen. Forskjeller i E2F1-genuttrykk hos MMC-behandlede og ubehandlede celler ble observert etter 15 timers eksponering for MMC, hvor MMC-behandlede celler uttrykte lavere E2F1-mRNA-nivåer enn kontrollceller ( figur 5B , sammenlignet med faste og punkterte linjer). Til tross for den klare forskjellen i uttrykk, kan det imidlertid ikke konkluderes med at MMC nedregulerer E2F1-uttrykk fordi cellesyklusprofiler av MMC-behandlede og ubehandlede celler klart er forskjellige i disse senere tidspunkter på grunn av en vedvarende G2-fasearrest pålagt av MMC. Faktisk reflekterer lave E2F1-mRNA-nivåer etter 15-tiden i MMC-eksponerte celler sannsynligvis en effekt av legemidlet i cellesyklusdynamikk, snarere enn en effekt av MMC i E2F1-transkripsjonsregulering.

I motsetning til E2F1 er p21 Cip1 et MMC-responsivt gen. Forhøyde nivåer på p21 Cip1 ble detektert ved HU-pålagt G1 / S-arrester, som indikerte G1-kontrollpunktsaktivering ved HU ( Figur 5B , 0 h tidspunkt) og dets ekspresjon redusert deretter i ikke-MMC behandlede celler, i samsvar med en uopprettholdet cellecyklusprogresjon etter frigjøring fra arrestere. I motsetning hevde MMC-behandling til forhøyede p21 Cip1 mRNA-nivåer ( Figur 5B , øvre høyre graf, fast linje) mens celler akkumulerte i G2-fase (9 h MMC-eksponering). Til tross for at cellesyklusprofiler var like ved 9 h tidspunktet i kontroll og MMC-behandlede celler, viser genekspresjonsanalyse en fundamental forskjell. MMC-eksponerte celler viste et aktivert G2-kontrollpunkt, vist ved induksjon av p21 Cip1- uttrykk, mens ubehandlede celler gjennomgikk en uperturert overgang gjennom G2, med lave p21 Cip1- nivåer.

Data oppnådd ved strømningscytometrianalyse ( FiGure 5A) og data som resulterte fra RT-qPCR ( figur 5B , øvre grafer) ble kombinert i en enkelt graf for hvert av de valgte gener ( figur 4B , nedre grafer). MRNA ekspressionsnivåer hvor det vises som relativ høyde på stolpene mens cellesyklusfordelingen av celler for hver prøve ble illustrert med andelen av farger: grønt for G1-fase (2C DNA-innhold), blå for G2-fase (4C DNA-innhold) og rødt For S-fase (mellomliggende DNA-innhold). Denne kombinerte metoden for grafisk representasjon kan være nyttig for å tolke cellecykeldistribusjon og genuttrykksanalyser.

I sammendrag tillagde genuttrykksanalyse koblet til en kultursynkroniseringsmetode identifikasjon av et genotoksisk middel-responsivt gen (p21 Cip1 ) og ledet til å foreslå at endringer observert i E2F1-ekspresjon mellom celler behandlet og ubehandlet med midlet var indirekte, ogMuligens relatert til forskjeller i cellesyklusfordeling av celler.

Figur 1
Figur 1: Oversikt over to komplementære cellesynkroniseringsprotokoller: Thymidin-Nocodazol og Hydroxyurea. ( A ) Grafisk fremstilling av pattedyrcellesyklusen som angir punktene ved hvilken cellecyklusarrest oppnås ved cellesynkroniseringsmetoder. Thy-Noc-basert prosedyre blokkerer celler i tidlig mitose (M) mens HU blokkerer celler ved G1 / S-grensen. ( B ) Skjematisk fremstilling av Thy-Noc-protokollen for cellesynkronisering. Vist er trinnene som vanligvis brukes til genuttrykksanalyse og cellecyklusovervåkning i U2OS-celler. ( C ) Skjematisk representasjon av HU-basert protokoll for cellesynkronisering. Vist er trinnene som vanligvis brukes til geneekspresjonsanalyse og celle syklus overvåking i U2OS-celler. En kortere synkroniseringsprosedyre som utelukker serum sult kan også brukes hvis optimal synkronisering allerede er oppnådd ved 24 h eksponering for HU. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 2
Figur 2: Vurdering av passende synkroniseringsmetoder. ( A ) Asynkron og Thy-Noc-synkroniserte U2OS-cellekulturer ble utsatt for pH3-farging for å vurdere fraksjonen av mitotiske celler i hvert tilfelle. Samtidig PI-farging tillot overvåking av DNA-innholdet i celler. I den asynkrone populasjonen var bare en minimal brøkdel av celler med 4C DNA-innhold (i blått) positivt for mitosemarkøren. I kontrast, Thy-Noc protokoll effektivt akkuMulerte celler i mitose (positive for pH3-fargingen) og tillate riktig progresjon til neste G1-fasen (i grønt) ved fjerning av nokodazol (3 timer tidspunkt). Prosentandel av celler i hver fase er oppsummert i tabellen og merket med farger i henhold til de som er ansatt i PI-histogrammene: grønn for 2C DNA-innholdsceller (G1), blå for celler med 4C DNA-innhold (inkludert G2 og M-celler og betegnet som G2 i histogrammet for å forenkle figuren og rød for celler med mellomliggende DNA-innhold (S). ( B ) Thymidin og HU ble vurdert for deres cellecyklussynkroniseringseffektivitet i U2OS-celler. Celler ble behandlet med tymidin (en eller to Runder), eller med HU i 24 timer, og cellesynkronisering ble undersøkt ved PI-farging og FACS-analyse. Summit ble brukt til FACS-dataanalyse. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 3
Figur 3: Beskrivelse av temporale ramme for enhetlig fremgang av celler etter Thy-Noc- og HU-mediert synkronisering. ( A ) U2OS-celler ble synkronisert i M-fase med Thy-Noc-protokollen (øvre rad) eller i G1 / S-overgang ved HU-protokoll (nedre rad). Cellecyklusprogresjon ble overvåket ved PI-farging og FACS-analyse av DNA-innholdet i celler hver 3. time etter frigjøring fra kjemikalier. Summit ble brukt til FACS data analyse. Celler utgitt fra Thy-Noc-mediert arrest ble angitt synkront i tidlig G1-fase etter 3 timer, og utviklet seg jevnt opp til S-fasen ved etterfølgende tidspunkter. Celler utgitt fra HU-mediert arrestering overført synkront gjennom S og G2 faser. Celler samlet 15 timer etter utgivelse representerte grensene for cellesynkronisering, da fremgang til neste fase bare oppnåddeD av en brøkdel av befolkningen. ( B ) Cellsynkronisering ble overvåket ved Western blot-analyse ved å samle proteinprøver hver 3. time og opptil 15 timer etter frigjøring. Ekspresjonskinetikk av Cyclin E1 (CCNE1), en syklin hovedsakelig akkumulert gjennom S-fasen, cyklin B1 (CCNB1), hovedsakelig tilstede fra G2 til M fase og pH3, en markør for mitotiske celler, bekreftet cellesyklusfordelingsprofiler observert av flytcytometri. Actin B (ACTB) ble brukt som en endogen belastningskontroll fordi dets nivåer ikke er cellecyklusavhengige. (Som modifisert fra Mitxelena et al . 8 ). Vennligst klikk her for å se en større versjon av denne figuren.

Figur 4
Figur 4: Studie av cellesyklusfase-avhengighet T Transkripsjon av E2F-familiemedlemmer etter komplementære cellesynkroniseringsmetoder. U2OS-celler ble arrestert i G2 / M ved Thy-Noc-protokollen eller i G1 / S ved HU-behandling, og prøver ble samlet for RNA-ekstraksjon og FACS-analyse hver 3. time i opptil 15 timer ved frigjøring fra arrest. Gene-ekspresjonsanalyse ved RT-qPCR avslørte en E2F1-ekspresjonsprofil som ble omtalt hovedsakelig til G1 (øvre venstre graf) mens E2F7-genuttrykksprofilen ble forskjøvet til S-fase, med en gradvis nedregulering gjennom G2-fasen (nederste høyre graf). TBP ble brukt som endogent, ikke-celle syklusregulert gen for å beregne relative endringer i mRNA-nivåer og resultater ble representert som middelverdiene og standardavviket (SD). Progresjon gjennom cellesyklus ble bestemt ved PI-farging og FACS-analyse av DNA-innholdet i celler. Cellefaser ble representert som bakgrunnsfarger i grafer: svart (arrest ved tidlig mitose), grønn (G1-fase), rød (S-fase) og blå (G2-fase)..com / files / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Vennligst klikk her for å se en større versjon av denne figuren.

Figur 5
Figur 5: Virkning av MMC på genuttrykk og cellesyklusprogresjon. U2OS-celler ble behandlet med HU i 24 timer, og MMC (250 nM) ble tilsatt umiddelbart etter frigjøring fra HU-mediert G1 / S-arrestasjon. Prøver for FACS analyse og geneekspresjonsanalyse ble samlet på angitte tidspunkt. ( A ) Progresjon gjennom cellesyklusen ble bestemt ved PI-farging og FACS-analyse av DNA-innhold ved hjelp av Summit-programvare. MMC induserte en moderat forsinkelse i progresjonen gjennom S-fase (rød populasjon) og en permanent anholdelse i G2-fasen (blå befolkning), som vist ved fravær av celler i G1 (grønn populasjon) etter 15 timers behandling (nedre rad) sammenlignet med Til ikke-Behandlede (øvre rad) celler. ( B ) E2F1 og p21 Cip1 -genekspresjonsanalyse i MMC-behandlede eller ubehandlede celler ble utført på mRNA-nivå ved RT-qPCR. Oxa1L ble brukt som et endogent, ikke-MMC-responsivt gen, og resultatene ble representert som middelverdier og SD. Øvre grafer representerer relative mRNA-nivåer av utvalgte gener etter frigjøring fra HU og tilsetning av MMC. Nedre grafer kombinerer data oppnådd ved FACS analyse og RT-qPCR. Vennligst klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Analyse av finjusterte regulerte gener involvert i forbigående og spesifikke roller i cellesyklusen krever en jevn cellepopulasjon. Mange forskere bruker rutinemessig etablerte tumorcellelinjer til disse formål, og en rekke metoder har blitt utviklet for å oppnå synkron (eller delvis synkron) cellepopulasjoner, med sikte på å samle så mange celler som mulig i definerte cellesyklusfaser. Videre har det blitt gjort sterke anstrengelser for å forbedre og optimalisere veletablerte synkroniseringsmetoder. Ikke desto mindre har alle synkroniseringsprotokoller ulemper, som kan henføres til heterogenitet av cellekulturer, til suboptimal effektivitet av synkroniseringsprosedyrene, eller til sekundære effekter som kjemiske synkronisatorer har i cellefunksjon, blant andre. Disse begrensningene må tas i betraktning ved bruk av celsynkroniseringsprotokoller. Forskere må identifisere de mest hensiktsmessige synkroniseringsmetodene for deres spesifikkeIscelle type eller eksperiment. Selv dyrking av forskjellige cellelinjer på nøyaktig samme måte, kan resulterende synkroniseringshastigheter avvike på grunn av flere grunner. På den ene siden kan cellesyklusens lengde variere avhengig av den valgte cellelinjen; På den annen side kan den samme inhibitor ha kontrastvirkninger på forskjellige cellelinjer på grunn av spesielle egenskaper hos hver cellelinje 25 . Videre må valgt hemmerkonsentrasjon og eksponeringstid alltid justeres til hver cellelinje for å unngå eller minimere uønsket sidetoksisitet 26 . Selv etter optimalisering av alle disse aspektene oppnås 100% opphopning av celler i en gitt cellesyklusfase aldri, og asynkron øker gradvis etter fjerning av kjemikaliet 27 . Det er således viktig å forstå at synkroniseringsmetoder oppnår i beste fall delvise cellepopulasjonsberikninger i en bestemt tidsramme.

I denne w Ork to synkroniseringsprosedyrer (Thy-Noc og HU) har blitt optimalisert for bruk i U2OS-celler, som begge er omfattende brukt for cellesynkroniseringsanalyser 28 , 29 , 30 . For å arrestere celler i M-fase, virket en kombinasjon av tymidin og nokodazol effektivt i U2OS-celler. Gitt den cytotoksiske karakteren av nokodazol, var det viktig å bestemme eksponeringstiden og dosen av denne inhibitoren for å oppnå ikke bare en sterkt synkronisert cellepopulasjon, men også optimal celleoverlevelse. Tidligere eksponering for tymidin (eller teoretisk hvilken som helst annen lignende forbindelse som hydroksyurea) førte til en anrikning av cellepopulasjonen i G1- og S-faser, og derved reduserte den nødvendige nokodazoleksponeringstid. For å arrestere celler i G1 / S, ble flere muligheter vurdert, inkludert dobbelt tymidinblokk, en metode som er svært effektiv ved synkronisering av flere cellelinjer"> 31 , 32. Imidlertid ble tymidin kassert gitt sine skuffende resultater i U2OS. En runde tymidinbehandling arresterte bare en brøkdel av celler, mens to runder av tymidinbehandling effektivt blokkerte de fleste cellene i G1 / S, men en G1 Populasjonen ble opprettholdt etter frigjøring fra tymidin og cellecyklusprogresjonen gikk ikke jevnt. Tilsvarende ga hydroksyrureabehandling gode G1 / S-blokkeringsresultater og ensartet progresjon av celler gjennom S og inn i G2.

Cellsyklusfasefordeling bør undersøkes når det utføres cellesynkroniseringsforsøk ( f.eks. Ved propidiumjodidfarging eller pH3-merking etterfulgt av FACS-analyse eller ved immunblotting av cellecyklusfasespesifikke proteiner) 16 , 33 , 34 , for bedre å tolke geneekspresjon resultater. En feil synkroniseringseffektivitetNcy eller små inter-eksperimentelle forskjeller i progresjonen gjennom cellesyklusen kan føre til feil konklusjoner. For eksempel er nokodazolbehandling kjent for å forårsake manglende funksjon av mitotisk kontrollpunkt under visse forhold. Dette gir opphav til en population av celler med 4C DNA-innhold, men negativt for mitotiske markører 34 som "slipper" mitotisk deling og går tilbake til interfase med et 4C innhold 35 . Fremveksten av denne delmengden av celler, som kan detekteres ved immunfarging med anti-fosfor-H3-antistoffer (se figur 2A ), kan minimeres ved bruk av kald PBS for nocodazol-vasketrinnene. En annen effekt assosiert med bruk av kjemiske inhibitorer som påvirker cellesynkronisering er kontrollpunktsaktivering assosiert med eksponering for disse forbindelsene 36 , 37 , en mekanisme hvor cellen aktivt arresterer progresjon gjennom cellesyklusen til den kanSørge for at prosesser tidligere til det nøyaktige punktet (f.eks. Korrekt DNA-replikasjon, spindelmontering), er løst 38 . For at en synkroniseringsmetode skal være tilstrekkelig, må arresteringen ikke bare være effektiv, men også fullstendig reversibel. Således er det etter frigjøring av cellecyklusinhibitorer viktig å analysere om inhibitorens effekter har blitt reversert, for eksempel ved å analysere ekspresjon av kontrollpunktmarkører, slik som p21 CIP . Figur 5B viser at hydroksyureasynkroniserte U2OS-celler effektivt løst kontrollpunktet fordi p21- CIP- nivåer ble redusert til basal ekspresjon etter frigjøring.

I U2OS-celler faller anrikningsprosentene ved cellesyklusarrest innenfor rekkevidden rapportert av andre studier på cellesynkronisering 29 , 30 , 39 : rundt 85% av celler med 4C DNA-innhold (PI-farging) og ca.Mindre enn 90% av dem i mitose (pH3 positiv merking) ved behandling med tymidin-nokodazol, og rundt 80-90% av G1 / S celler etter hydroksyurea behandling. Frigivelse fra cellecyklusarrangement driver typisk fremdrift gjennom den neste eller to faser på en jevn måte, selv om synkronisering alltid går tapt etter flere timer og celler ikke klarer å fullføre en hel celle divisjon syklus på en synkronisert måte. Derfor, for å få et fullstendig bilde av alle faser av cellesyklusen, bruker protokollen som er foreslått i dette arbeidet to synkroniseringsmetoder fra forskjellige deler av cellecyklussen. Som vist i figur 3A var hver enkelt protokoll ikke sikret synkronisitet over en hel celle syklus. Thy-Noc-basert synkronisering ga en passende ramme for prosesser som forekom i G1 til S-faser, mens celler som ble frigjort fra HU var egnet for analyse av hendelser som fant sted under S og G2 / M. Komplementariteten til de valgte to prosedyreneEs ble demonstrert ved analysen av to medlemmer av E2F transkripsjonsfamilien ( Figur 4 ), som støtter ideen om at kombinasjon av to metoder som synkroniserer i forskjellige faser av cellesyklusen, er en kraftig tilnærming til nøyaktig etablering av celle-syklusregulert genuttrykk Mønstre og bedre forstå deres fysiologiske rolle.

En overbevisende anvendelse av cellesynkroniseringsprosedyrer fokuserer på å evaluere virkningen av potensielle terapeutiske midler. Effekten av farmasøytiske forbindelser, som de med antitumoraktivitet, studeres ofte i asynkroncellepopulasjoner. Under disse innstillingene er det mulig å bestemme implikasjonen til det valgte stoffet ved induksjon av flere prosesser som celledød, cellecyklusarrest eller senescens 7 , 40 . Men, valg av asynkroncelleinnstillinger for identifisering av presise molekylære hendelser regulerendeSlike prosesser kan føre til ufullstendige eller delvis feil konklusjoner. Dette punktet, som ofte overses, er illustrert i foreliggende arbeid ved å analysere effekten av det kjemoterapeutiske medikament MMC på E2F1 og p21 Cip1 -genekspression ( Figur 5 ). Samlet sett gir kombinasjon av cellesynkronisering og behandling med genotoksiske midler en egnet sammenheng for å studere ekspresjonen av gener som reagerer på det genotoksiske middel og å diskriminere fra de som er rammet av cellecyklusforstyrrelser pålagt av agenten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgments

Vi takker medlemmer av Zubiaga og Altmeyer laboratoriene for nyttige diskusjoner og teknisk støtte. Dette arbeidet ble støttet av tilskudd fra det spanske departementet (SAF2015-67562-R, MINECO / FEDER, UE), den baskiske regjeringen (IT634-13 og KK-2015/89) og Universitetet i Baskerland UPV / EHU ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Studier av celle-regulert genuttrykk av to komplementære cellesynkroniseringsprotokoller
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter