Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Studierande cellcykelreglerade genuttryck av två komplementära cellsynkroniseringsprotokoll

doi: 10.3791/55745 Published: June 6, 2017
* These authors contributed equally

Summary

Vi rapporterar två cellsynkroniseringsprotokoll som tillhandahåller ett sammanhang för att studera händelser relaterade till specifika faser av cellcykeln. Vi visar att detta tillvägagångssätt är användbart för att analysera regleringen av specifika gener i en ostoppad cellcykel eller vid exponering för medel som påverkar cellcykeln.

Abstract

Gencyklusprogrammet för cellcykeln representerar ett kritiskt steg för att förstå cellcykelberoende processer och deras roll i sjukdomar som cancer. Cellcykelsreglerad genuttrycksanalys beror på cellsynkronisering i specifika faser. Här beskriver vi en metod som använder två komplementära synkroniseringsprotokoll som vanligtvis används för att studera periodisk variation av genuttryck under cellcykeln. Båda förfarandena är baserade på att blockcykeln blockerar cellcykeln i en definierad punkt. Synkroniseringsprotokollet med hydroxiurea (HU) -behandling leder till cellulär arrestering i sen G1 / early S-fas, och frisättning från HU-medierad arrestering ger en cellpopulation ensartad framsteg genom S och G2 / M. Synkroniseringsprotokollet genom tymidin och nokodazol (Thy-Noc) -behandling blockerar celler i tidig mitos, och frisättning från Thy-Noc-medierad arrestering ger en synkroniserad cellulär population lämplig för G1-fas och S-fas-enFörsök studier. Applicering av båda förfarandena kräver övervakning av cellcykeldistributionsprofilerna, vilket typiskt utförs efter propidiumjodid (PI) -färgning av cellerna och flödescytometri-medierad analys av DNA-innehåll. Vi visar att den kombinerade användningen av två synkroniseringsprotokoll är ett robust tillvägagångssätt för att tydligt bestämma transkriptionsprofilerna för gener som differentiellt regleras i cellcykeln ( dvs E2F1 och E2F7) och följaktligen att få en bättre förståelse för deras roll i cellcykeln processer. Vidare visar vi att detta tillvägagångssätt är användbart för studier av mekanismer som ligger till grund för läkemedelsbaserade terapier ( dvs mitomycin C, ett anticancermedel), eftersom det tillåter att diskriminera gener som är mottagliga för det genotoxiska medlet från de som endast påverkas av cellcykelstörningar Införd av agenten.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Övergång genom alla faser av cellcykeln är kopplad till ett tätt reglerat genuttrycksprogram. Denna koordinerade "på och av" av gentranskription genom cellcykeln antas vara under kontroll av komplexa transkriptionsregleringssystem, som reglerar inte bara tidpunkten utan även nivåerna av genuttryck. Deregulering av viktiga cellcykelkomponenter är känd för att bidra till utvecklingen av flera sjukdomar och är ett väl etablerat kännetecken för tumörigenesen 1 , 2 . Genomförda transkriptomiska analyser utförda i jäst- och däggdjursceller har visat att ett stort antal gener uppvisar periodiska genuttrycksmönster i cellcykeln, vilket tyder på att transkriptionsfluktuationer under cellcykeln är en återspegling av det tidsmässiga kravet för en given genprodukt I en exakt fas 3 , 4 , 5 .

En viktig uppgift i studien av cellcykelsreglerat genuttryck är synkroniseringen av celler i specifika cellcykelfaser. Cellsynkronisering bidrar till att tolka association av ett genuttrycksmönster till en viss cellcykelfasövergång, och det har lett till en bättre förståelse av reglering och funktion hos flera gener. Cellsynkronisering är också viktig för att studera verkningsmekanismen hos antikankermedicin, eftersom kemoterapeutiska medel är kända för att påverka både genuttryck och cellcykelkinetik 6 , 7 . Det är emellertid ofta svårt att avgöra om genuttrycksskillnader som härrör från behandling med dessa medel är ett direkt svar på behandlingen eller är enbart konsekvensen av förändringar i cellcykelprofiler. För att skilja mellan dessa möjligheter ska genuttryck analyseras i celler som har varit sYnkroniseras före tillsats av det kemoterapeutiska läkemedlet.

Med undantag för några primära celler, såsom ny isolerade lymfoida celler, som utgör en homogen cellpopulation synkroniserad i G08, växer in vitro etablerade cellinjer asynkront i odling. Under vanliga tillväxtbetingelser finns dessa asynkront cykelceller i alla faser av cellcykeln men, företrädesvis i G1 9 . Därför ger detta sammanhang inte ett optimalt scenario för funktionella eller genuttrycksanalyser i en specifik cellcykelfas ( t.ex. G1, S etc.). Icke-transformerade immortaliserade cellinjer ( t ex fibroblaster) kan synkroniseras med så kallade fysiologiska metoder 10 . Dessa metoder är baserade på de kvarhållna primära cellegenskaperna hos icke-transformerade celler, såsom cellkontakthämning och tillväxtfaktorberoende för att fortsätta cykling. borttagningAv serum i kombination med kontaktinhibering gör icke-transformerade celler arresterade vid G0 / G1. Emellertid kräver synkroniserad cellcykelinträde och progression ofta subkultur, vilket också innefattar artificiell avlägsnande av cellerna och omplätering 10 . Viktigast är denna metod inte lämplig för synkronisering av transformerade cellinjer, den stora majoriteten av etablerade cellinjer som för närvarande används, kännetecknad av att den saknar cellkontaktmedierad tillväxtinhibering eller respons på tillväxtfaktoravdrag. Det är sålunda klart att alternativa metoder krävs för effektiv cellsynkronisering i specifika faser av cellcykeln. Generellt sett är de mest använda synkroniseringsmetoderna baserade på transient kemisk eller farmakologisk inhibering av en definierad punkt av cellcykeln, typiskt DNA-syntes eller mitotisk spindelbildning. Inhibering av DNA-syntes synkroniserar celler genom att arrestera dem i sen G1 eller tidig S-fas. Detta kan vara achiEved genom tillsats av föreningar såsom mimosin, en inhibitor av nukleotidbiosyntesen 11 , 12 , aphidikolin, en hämmare av DNA-polymeraser 13 , 14 , hydroxiurea, en inhibitor av ribonukleotidreduktas 15 , 16 eller med överskott av mängder tymidin 17 , 18 . Å andra sidan kan inhibitorer av mikrotubulapolymerisation, såsom kolchicin eller nokodazol, blockera mitotisk spindeldannande som leder till cellsynkronisering vid tidig M-fas 19 , 20 , 21 .

I detta arbete beskriver vi en metod som involverar två komplementära synkroniseringsprotokoll baserat på transient kemisk inhibering för att studera uttrycket av cellcykelsreglerade gener vid mRNAnivå. Denna metod är grundläggande för att definiera cellcykelgenernas roll i specifika cellcykelprocesser. Vidare ger den en allmän ram för att studera effekten av cancer mot cancer för att noggrant detektera läkemedelsreaktiva gener och för att minimera felinterpretationer härrörande från störningar i cellcykelförskjutning genererad av dessa läkemedel.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Cellsynkronisering, frigöring och övervakning av cellcykelprogression

  1. Thymidin- och nokodazolbaserad (Thy-Noc) -synkronisering och frisättning av U2OS-celler från mitos
    1. Förbered det önskade cellodlingsmediet. U2OS-celler odlas rutinmässigt i DMEM-Glutamin-medium komplementerat med 10% (vol / vol) FBS (valfritt: 1% penicillin / streptomycin). Utför alla medelberedningar och manipulering under sterila förhållanden och värm upp komplementerat medium (hädanefter kallad "komplett medium") till 37 ° C före användning.
    2. Frö 2 x 106 U2OS celler per 100 mm skål i 10 ml fullständigt odlingsmedium. För att beräkna antalet diskar som behövs, ta hänsyn till att varje 100 mm skål typiskt ger tillräckligt med mitotiska celler för att plåta ungefär 5 brunnar i en 6-brunnsplatta (0,2 - 0,25 x 106 celler / brunn) (se figur IB ). Två brunnar per vald tidpunkt är requirEd i experimentet (1 brunn för RNA-extraktion och 1 brunn för cellcykelövervakning). Dessutom kan en tredje brunn samlas per tidpunkt för proteinanalys.
      OBS: Plansceller på kvällen (runt 7 pm) så att efterföljande steg kan utföras under arbetstider de följande dagarna. Inkludera 2 ytterligare brunnar av asynkront växande celler för att definiera FACS analys kompensationsinställningar.
    3. Låt cellerna fästas genom att inkubera 100 mm rätter vid 37 ° C i en fuktad atmosfär med 5% CO2 under 24 timmar.
    4. För tymidinblocket, bereda en 200 mM tymidin-stamlösning genom att lösa 145,2 mg tymidinpulver i 3 ml H20 (eller ekvivalenta mängder) och sterilisera lösningen genom filtrering genom ett 0,2 μm porstorleksfilter. Lätt uppvärmning kan hjälpa till att lösa upp tymidin. Tillsätt 100 μl av den nyframställda 200 mM stammen till varje 100 mm odlingsskål (slutkoncentration 2 mM). Inkubera celler med tymidin i 20 h vid 3776; C i en fuktad atmosfär med 5% CO2.
      OBS: Behandla celler på kvällen (runt 7 pm), för att få tid att utföra både tymidinfrisättning och nocodazolblock följande dag.
    5. För att frigöra från tymidinblocket, ta bort tymidinhaltigt tillväxtmedium på eftermiddagen den följande dagen (3 pm); Tvätta cellerna två gånger med förvärmd 1x PBS och tillsätt 10 ml komplett medium till varje 100 mm fat. Inkubera celler i 5 h vid 37 ° C i en fuktad atmosfär med 5% CO2.
    6. För mitotisk cellstopp, sätt nocodazol till en slutlig koncentration av 50 ng / ml (8 pm). Förbered en stamlösning genom att lösa nocodazolpulver i DMSO ( t.ex. 5 mg / ml) och förvara fryst vid -20 ° C. Inkubera celler med nocodazol i inte längre än 10-11 h vid 37 ° C i en fuktad atmosfär med 5% CO2.
    7. Frigör från nocodazol-medierad arrestering i tidig M-fas (mitotisk shake-off) och samling av prover vid flera tillfällenNts (börjar vid 6-7 am).
      1. Lossa avrundade (mitotiska) celler genom att skaka varje platta och försiktigt pipettera nocodazolhaltigt tillväxtmedium. Samla medium med lossna celler från varje 100 mm platta i 50 ml sterila rör, centrifugera (300 xg, 5 min, rumstemperatur (RT)) och tvätta cellerna två gånger genom att tillsätta 1x PBS följt av centrifugering. Användning av kallt PBS eller PBS plus nokodazol rekommenderas för att undvika mitotisk glidning (se avsnittet Diskussion).
      2. Resuspendera mitotiska celler samlade från varje 100 mm platta i 10 ml komplett medium. Spara 2 ml för RNA-extraktion och 2 ml för FACS-analys för 0 h tidpunkten (ungefär 0,2-0,25 x 10 6 celler per prov).
      3. Omplastera återstående mitotiska celler för efterföljande tidpunkter i 6-brunnsplattor (2 ml / brunn, 0,2-0,25 x 106 celler / brunn).
        OBS! Kom ihåg att 2 brunnar krävs per vald tidpunkt (1 för RNA och 1 för FACS-analys).
    8. Samla prov på selEcted tidpunkter. Varje 1,5 till 3 h rekommenderas för att få en adekvat profil av cellcykelförskjutningen.
      1. För RNA-extraktion, avlägsna medium, skölj väl med 2 ml pre-warm 1x PBS och tillsätt 1 mL lämpligt RNA-isoleringsreagens ( t.ex. TRIzol) i brunnen (utför detta sista steg i ett säkerhetsskåp för kemikalier). Pipettera upp och ner för att lossa och lysera celler, överföra celllysat till ett 1,5 ml mikrocentrifugrör, inkubera 5 minuter vid RT och förvaringsrör vid -80 ° C tills vidare användning.
      2. För FACS-analys sköljas väl med 2 ml pre-warm 1x PBS, tillsätt förvärmd Trypsin-EDTA-lösning (0,3 ml / brunn) för att avlägsna celler, blockera Trypsin-EDTA genom att tillsätta 1 ml komplett medium och samla varje prov i en separat 15 ml rör.
        1. Centrifugera celler (300 xg, 5 min, RT), spara cellulär pellet och kasta supernatant. För att fixa celler resuspenderar cellerna i 1 ml kyld 70% (volym / volym) etanol i 1x PBS genom försiktigt virvelrör och lägger dem på is för appCa 15 min före lagring vid 4 ° C eller för färgning för vidare analys med FACS (beskrivet i steg 1,4-1,5).
  2. HU-baserad synkronisering och frisättning av U2OS-celler från G1 / S-gränsen
    1. Förbered fullständigt cellodlingsmedium som beskrivet i steg 1.1.
    2. Säd 0,25 x 106 U2OS celler per brunn i 6 brunnsplattor (2 ml komplett odlingsmedium per brunn). För att beräkna antalet brunnar som behövs för experimentet, ta hänsyn till att 2 brunnar krävs per vald tidpunkt (1 brunn för RNA-extraktion och 1 brunn för cellcykelövervakning) och att 2 ytterligare brunnar av asynkronväxande celler är Behövs för att definiera FACS analys kompensations inställningar.
    3. Låt cellerna fästas genom att inkubera 6-brunnsplattor över natten (O / N) vid 37 ° C i en fuktad atmosfär med 5% CO2.
    4. Ta bort komplett medium från brunnar följande morgon och tillsätt 2 mlAv förvärmt FBS-fri DMEM-Glutamin-medium per brunn. Inkubera celler i ytterligare 24 timmar vid 37 ° C i en fuktad atmosfär med 5% CO2.
      OBS! Utför detta steg i alla brunnar utom för 2 (de sparade för att definiera FACS-inställningar). Serumuttagningssteget kan utelämnas om effektiv synkronisering uppnås genom att enkelt inkubera celler med HU.
    5. G1 / S cellcykelstopp med HU.
      1. Förbered färsk HU stamlösning (500 mM) före varje användning. Tillsätt 2 ml H2O till 76.06 mg HU-pulver och blanda tills det är ordentligt upplöst. Sterilisera lösningen genom filtrering genom ett 0,2 μm porstorleksfilter. Blanda 50 ml komplett medium med 400 μL filtersteriliserad HU-stamlösning för en slutlig HU-koncentration på 4 mM.
      2. Ta bort medium från alla brunnar utom från de 2 brunnar som behövs för att definiera FACS-inställningar och ersätt med ett nyberedt 4 mM HU-innehållande komplett medium (2 ml / brunn).
      3. Inkubera celler i 24 timmar iHU-innehållande medium vid 37 ° C i en fuktad atmosfär med 5% CO2.
    6. Frigörande av celler från HU-medierad arrestering. Ta bort HU-innehållande medium från brunnar och skölj brunnarna två gånger med förvärmd 1x PBS (2 ml varje gång). Tillsätt 2 ml komplett medium per brunn. Samla 2 prover för 0 h-tidpunkten (1 för RNA-extraktion och 1 för cellcykelstopp verifiering av FACS) samt 2 prover sparade för FACS-inställningar. Placera kvarvarande brunnar i inkubatorn.
    7. Samla prov varje 1,5 till 3 h för att få en adekvat fördelning av cellcykelförlängning. Vid varje tidpunkt utföra provbehandling (för RNA-extraktion och för FACS-analys) som beskrivs i 1.1.8.1-1.1.8.2.
  3. Behandling med DNA-skadliga medel
    OBS: När syftet är att belysa effekten av en förening ( t ex DNA-skadliga medel) i cellcykelhändelser kan någon av de tidigare beskrivna synkroniseringsmetoderna varaKombinerat med behandling av celler med det genotoxiska medlet. För att kunna välja synkroniseringsmetod är det viktigt att överväga fasen av cellcykeln som vi skulle vilja analysera. I allmänhet kan Thy-Noc-förfarandet vara lämpligt att studera effekten av en förening i G1-fas eller S-fasinmatning, medan HU-medierad synkronisering kan vara mer lämplig för att studera inverkan i S-G2-faser eller i ingången till mitos.
    1. Analys av effekten av genotoxiska medel i G1-fas eller S-fasinmatning
      1. Synkronisera celler enligt beskrivningen i 1.1.2. Till 1.1.6.
      2. Släpp celler från nokodazol och omplatta dem enligt beskrivningen i 1.1.7. Inkubera dem vid 37 ° C i en fuktad atmosfär med 5% CO2 i 3 timmar för att låta dem fästa före tillsatsmedel (den önskade inkubationsperioden kan variera beroende på cellinjen).
      3. Lägg till agens och samla prov som tidigare beskrivits i 1.1.8.
    2. Analys av effekten av genotoxiska medel i SG2 faser eller M-ingång
      1. Synkronisera celler enligt beskrivning i 1.2.2. Till 1.2.5.
      2. Släpp celler från HU som beskrivs i 1.2.6. Och tillsätt omedelbart omedelbart.
      3. Samla prov som tidigare beskrivits i 1.8.
  4. Övervakning av cellsynkronisering och progression genom cellcykeln genom propidiumjodid (PI) färgning och FACS-analys
    OBS! Prov som samlats vid alla tidpunkter tillsammans med de som krävs för att definiera FACS-inställningar kan lagras vid 4 ° C när de har fixats (som nämns i 1.1.8.2). Utför färgning med PI-lösning följt av FACS-analys för samtliga prover av experimentet samtidigt. PI interkalkerar in i huvudspåret av dubbelsträngat DNA som producerar en starkt fluorescerande signal när den exciteras vid 535 nm med en bred emissionsstopp omkring 600 nm. Eftersom PI också kan binda till dubbelsträngat RNA är det nödvändigt att behandla cellerna med RNas för optimal DNA-upplösning.
    1. Förbered nyframställd PI-färglösning. En PI stamlösning kan framställas genom att lösa PI-pulver i PBS ( t ex 5 mg / ml). Förvara stamlösningen vid 4 ° C (i mörker). Färglösning består av PI (140 | im), natriumcitrat (38 mM) och Triton X-100 (0,01% volym / volym).
    2. Värm upp en lämplig yta ( t.ex. ugn) till 37 ° C.
    3. Centrifugera fasta celler (450 xg, 5 min, RT), dekantera supernatanten (etanol) och tvätta en gång med 1x PBS.
    4. Centrifugera cellerna igen, ta bort PBS och tillsätt 300 μL PI-färglösning per prov (förutom till ett av proverna för FACS-inställningar, lägg till PBS till det här provet istället).
    5. Överför celler till FACS-rör (5 ml rundbottna polystyrenrör).
    6. Tillsätt 1 μl RNas A till varje prov, blanda och inkubera prov under 30 minuter i mörker vid 37 ° C. Proverna kan förvaras skyddad mot ljus vid 4 ° C i högst 2 - 3 dagar.
    7. Analysera DNA-innehållet i prover med flödecytometri. Definiera FACS-analyskompensationsinställningar med PI-färgat asynkront prov. Använd blankprov (utan PI-färglösning) för att kontrollera autofluorescens. Grunderna för PI-färgningsmedierad analys av DNA-innehåll med flödescytometri har tidigare beskrivits 9 .
  5. Bestämning av mitotiskt index med dubbel fosfat-H3 (Ser 10) / PI-färgning
    OBS: Celler som genomgår mitos kan lätt detekteras med flödescytometri med antikroppar specifika för fosforhiston H3 i serin 10 (pH3). En samtidig PI-färgning är användbar för att bestämma DNA-innehållsbaserad fördelning av cellpopulationen. 5 prov krävs för optimala konfigurationer av FACS-inställningar: tomt, endast PI, endast pH3, sekundär antikropp-endast och dubbelfärgning.
    1. Centrifugera fixerade celler (450 xg, 5 min, 4 ° C) och kassera supernatanten. Följande steg beskrivs för att utföra färgning i 15 ml rör.
    2. Tvätta celler genom att lägga till 1Ml PBS-T (PBS + 0,05% Tween-20) till pelleten och centrifugen (450 xg, 5 min, 4 ° C). Ta bort supernatanten.
    3. Tillsätt anti-pH3-antikroppen utspädd (1: 500) i 100-200 μl PBS-T + 3% BSA och inkubera med rockning i 2 timmar vid RT (eller O / N vid 4 ° C).
    4. Tillsätt 2 ml PBS-T (PBS + 0,05% Tween-20) och centrifugera (450 xg, 5 min, 4 ° C). Ta bort supernatanten.
    5. Tvätta en gång till genom att tillsätta 2 ml PBS-T till pelleten, centrifugera och kasta supernatanten.
    6. Tillsätt sekundär antikropp (anti-kanin AlexaFluor 488 i fallet med vald pH3-antikropp) utspädd (1: 500) i 100-200 | il PBS-T + 3% BSA och inkubera med rockning i 1 h vid RT (eller O / N Vid 4 ° C). Skydda prov från ljus.
    7. Tvätta två gånger med PBS-T (2 ml) genom centrifugering enligt beskrivningen i steg 1.5.4.
    8. Utför PI-färgning enligt beskrivningen (steg 1.4.1 till 1.4.6).

2. Provsamling och bearbetning för genuttrycksanalys

  1. Ta1,5 ml mikrocentrifugprover i RNA-isolationsreagenset ur frysen och låt dem tina vid RT i ett säkerhetsskåp för kemikalier.
  2. Tillsätt 400 μL kloroform till varje prov och skaka kraftigt (men inte virvel) tills fullständig blandning. Inkubera prov i 5 minuter vid RT.
  3. Centrifugrör i 15 minuter (≥8000 xg, 4 ° C) i en mikrovågsugn.
  4. Överför den vattenhaltiga (övre) fasen till ett nytt 1,5 ml mikrocentrifugrör och registrera den överförda volymen (för att förenkla proceduren rekommenderas att samla lika stora volymer i alla prov av experimentet).
  5. Tillsätt 1 volym 100% etanol långsamt (droppvis) till vattenfasen under blandning. Centrifugera inte.
  6. Utför nästa steg med den kommersiella RNA mini-prep-enheten. Pipeten upp till 700 μL av varje prov, inklusive eventuell fällning som kan ha bildats, i en spinnkolonn i ett 2 ml uppsamlingsrör (tillhandahållet av tillverkaren).
  7. StängLock och centrifug (≥ 8000 g, RT) i 15 s. Kasta bort flödet. Upprepa föregående steg med det återstående provet (om det finns några).
  8. Följ tillverkarens instruktioner för RNA-tvätt och eluering (eluera varje prov i 30-40 | il nukleasfritt H2O för att uppnå en lämplig RNA-koncentration för nästa steg).
  9. Bestäm RNA-koncentration och renhet av prover genom absorbansmätningar (ett A 260/280 förhållande av 2,0-2,1 indikerar god renhet av RNA-provet). Förvara RNA-prover vid -80 ° C tills användning för RT-qPCR-analys.
  10. För RNA-omvandling till cDNA och efterföljande kvantitativ PCR, ta 1 μg RNA per prov och förbered retrotranscriptasreaktion enligt tillverkarens instruktioner. Erhållna cDNA-prov kan lagras vid 4 ° C (under ett par dagar) eller vid -20 ° C (under längre perioder).
    OBS: Provberedning, primerdesign och andra överväganden för realtids-PCR har varit exTätt beskrivet i litteraturen 22 , 23 .

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Schematisk representation av Thy-Noc och HU-baserade protokoll för cellsynkronisering.

Figur 1 sammanfattar de steg som krävs för U2OS-cellsynkronisering och efterföljande samling av prov för att verifiera progression genom cellcykeln och för att utföra genuttrycksanalyser.

Fosfor-H3- och Pl-färgning är goda utvärderingsparametrar för att välja synkroniseringsmetoder.

Cellsynkroniseringsprocedurer måste bedömas och optimeras för varje cellinje på grund av inneboende heterogenitet hos odlade celler. Synkronisering i mitos uppnås typiskt med Thy-Noc-protokollet och anrikning av mitotiska celler efter behandling med nokodazol kan bedömas med antikroppar specifika för fosforylerad histon H3 (pH3), en typisk mitotisk markör. Id Ntifiering av pH3-positiva celler möjliggör diskriminering mellan mitotiska celler och de med ett 4C-DNA-innehåll som inte genomgår mitos (vilka alla betraktas som en "G2" -population genom PI-färgning). I U2OS-celler leder Thy-Noc-protokollet till en signifikant anrikning av en population med 4C-DNA-innehåll (Figur 2A, övre vänstra graf, blå population genom PI-färgning) och den relativa fraktionen av mitotiska celler inom denna population var rutinmässigt ganska ren (ungefär 91% jämfört med 2% i asynkrona celler). Frigörande från nokodazol resulterar i en synkroniserad progression av celler till nästa G1-fas, bestämd genom ackumulering av en population med 2C-DNA-innehåll ( Figur 2A , övre högra graf, grön population vid PI-färgning) och den närmaste försvinnandet av pH3-positiva mitotiska Celler ( Figur 2A , nedre högra grafen). Således bekräftade pH3-färgningsresultatet lämpligheten av Thy-Noc-protokollet för mitotisk synkronisering av U2OS-celler.

E_content "fo: keep-together.within-page =" 1 "> Synkronisering av U2OS-celler i G1 / S testades med tymidin och hydroxiurea, två ofta använda synkroniseringsmedel. Berikning i olika faser av cellcykeln bestämdes genom PI-färgning och FACS-analys och procentandel av celler sammanfattade i en tabell ( Figur 2B ). En 24-timmarsexponering av U2OS-celler till Thy (2mM) var ineffektiv vid upphörande av celler i G1 / S-gränsen ( Figur 2B ), medan behandling med HU eller med en dubbel Runda av tymidin (DT) resulterade i en tillfredsställande arrestering. Endast HU-behandlade celler återfanns fullständigt från arresteringen och utvecklades adekvat genom cellcykeln. Däremot inducerade DT-block en permanent G1-arrestering i en signifikant fraktion av cellpopulationen ( 13,3% av cellerna i G1 vid 6 h tidpunkt med DT vs 3,1% med HU-baserat protokoll), vilket negativt påverkat cellsynkronisering. Därför rekommenderas exponering för HU som en lämplig G1 / S synkroniseringsmetodOd för U2OS-celler.

Thy-Noc- och HU-baserade protokoll är komplementära för cellsynkronisering.

Som visas i Figur 3A (0 h tidpunkt), behandlade behandling med Thy-Noc-protokoll effektivt U2OS-celler i M-fas-ingång (population med 4C-DNA-innehåll, visat i blått) och behandling av HU-protokoll-arresterade celler i G1 / S-gränsen (Population med 2C DNA-innehåll, visat i grönt / rött). Vid avlägsnande av drogerna ingick cellerna och utvecklades genom cellcykeln på ett synkroniserat sätt. Celler som återhämtade sig från Thy-Noc-behandling observerades först i tidig G1-fas (populationen i grön) och överfördes därefter genom G1 och upp till S-fasen på ett enhetligt sätt. Celler som återhämtats från HU-behandlingen utvecklades synkront genom S (population i rött) och G2 / M. Framsteg genom nästa cellcykel var samtidigt med förlusten av synkronicitet. ConsequentlY, tidspunkter över 15 timmar ingick inte i dessa analyser på grund av förlust av synkronicitet efter denna tidpunkt.

Western blot-analys av cyklin E1 (en G1 / S-cyklin) och cyklin B1 (en G2 / M-cyklin), två proteiner vars nivåer regleras tätt i cellcykeln och av den mitotiska markörens pH3, bekräftade cellcykelfasen hos varje Tidpunkt analyserad av FACS ( Figur 3B ). Som förväntat uppvisade celler i M-fas (motsvarande 0 h tidpunkt för Thy-Noc-synkroniserade celler) och celler i G2 till M-fas (9 h till 12 h tidpunkt för HU-synkroniserade celler) en dramatisk ackumulering av cyklin B1 Och odetekterbara nivåer av cyklin E1. Vidare var cyklin B1-nivåerna låga till odetekterbara i G1-fas (3 timmar vid frisättning från nokodazol) och gradvis ackumulation observerades när cellerna fortskred genom S (efter Thy-Noc-frisättning) och in i G2 (efter frisättning av HU). Stark pH3-märkning av celler vid 0 timmar efter Thy-Noc synkroniseringPå bekräftad anrikning av celler arresterade vid mitos vid denna tidpunkt. En liten ökning vid pH3-nivåer vid 12 h efter frisättning från HU avslöjade att majoriteten av celler med 4C-DNA-innehåll fortfarande var i G2 medan andelen celler i mitos ökades vid 15 h tidpunkt. Däremot uppvisade expressionsmönstret för cyklin E1 en progressiv ackumulation från tidig G1 till S-fasinmatning (Thy-Noc-procedur) och gradvis försvinnande i G2 / M-fas (HU-procedur).

Uttryck av gener som är differentiellt reglerad i cellcykeln kan analyseras noggrant med en kombination av Thy-Noc- och HU-baserad synkronisering.

Som ett bevis på konceptet att cellcykelsreglerad genuttrycksanalys bäst analyseras genom en kombination av tvåcellssynkroniseringsmetoder, har mRNA-uttryck av två E2F-familjemedlemmar som är kända för att ha olika uttryckskinetik i cellcykeln(E2F1 och E2F7) undersöktes genom omvänt transkriptas-kvantitativ PCR (RT-qPCR). För detta ändamål användes Thy-Noc och HU-synkroniseringsprotokoll, såsom sammanfattas i figur 1 , och cellcykelfördelning övervakades med flödescytometri som visas i figur 3A . Figur 4 visar E2F1 (övre två grafer) och E2F7 (nedre två grafer) mRNA profiler genom cellcykeln. Transkriptionsreguleringsprofilen för E2Fl-kodande gen observerades bäst med Thy-Noc-förfarandet, varigenom E2F1-uttryck började öka gradvis från tidig G1-fas för att nå en topp vid sen G1-fas (9 timmar efter Thy-Noc-frisättning, grön bakgrund). Därefter minskade dess nivåer, samtidigt som de kom in i S- och G2-faser (röda och blåa bakgrunder). Däremot upptäcktes E2F7-genuttryckskinetiken bäst efter HU-baserad synkronisering (nedre graf; röd bakgrund) med ett topputtryck vid 6 h från frisättning (motsvarande S-G2-fasövergång). Thy-NocProcedur var å andra sidan lämpligt för att observera induktion av E2F7, men inte dess nedreglering. Av anmärkningen reproducerades förlängning av analysen efter 15 h tidpunkt E2F1- och E2F7-mRNA-expressionsprofiler av tidigare tidpunkter, även om med ett minskat intervall av mRNA-variation (data ej visad). Sammantaget bekräftar dessa resultat vikten av att arbeta med en ordentligt synkroniserad cellpopulation för att bedöma inte bara genuttryckskinetiken utan även den korrekta amplituden av förändringar i mRNA-nivåerna.

Cellsynkronisering ger en bättre förståelse för genuttrycksprogrammet som påverkas av cancer mot cancer.

För att analysera effekten av antitumörmedikamentet mitomycin C (MMC) i cellcykeldynamik såväl som i genuttryck synkroniserades U2OS-celler först med HU och behandlades därefter med MMC. Exponering för detta genotoxiska medel aktiverade en kontrollpostT i G2-fas som var uppenbart efter 15 timmars exponering ( Figur 5A , nedre raden, blå topp). Däremot framsteg obehandlade celler normalt genom G1 vid denna tidpunkt ( Figur 5A , övre raden, grön topp). Långvarig MMC-behandling (36 h) avslöjade en permanent arrestering av celler i G2-fas medan celler med ingen MMC-behandling uppvisade en cellcykelfördelning som liknade den som visas av den asynkrona cellpopulationen.

E2F1 och p21 Cip1 (CDKN1A) valdes för genuttrycksanalys i MMC-behandlade celler ( Figur 5B ), med tanke på deras olika cellcykelberoende reglering. Uttryck av E2F1 är G1-fasberoende, såsom beskrivs i figur 4 , medan induktion av p21- Cip1- uttryck är kopplad till cellcykelhållande / kontrollpunktsaktivering 24 . Som visas i Figur 5B (övre vänstra graf), E2F1-genuttryck kiNetik var liknande i närvaro eller frånvaro av MMC, då cellerna utvecklades genom G1 / S och in i S-fasen. Skillnader i E2F1-genuttryck bland MMC-behandlade och obehandlade celler observerades efter 15 timmars exponering för MMC, varvid MMC-behandlade celler uttryckte lägre E2F1-mRNA-nivåer än kontrollceller ( Figur 5B , jämför fasta och streckade linjer). Trots den tydliga skillnaden i uttryck kan man dock inte dra slutsatsen att MMC nedreglerar E2F1-uttryck eftersom cellcykelprofiler av MMC-behandlade och obehandlade celler klart skiljer sig i dessa senare tidpunkter på grund av en långvarig G2-fashäktning som åläggs av MMC. Faktum är att låga E2F1-mRNA-nivåer efter 15h-tidpunkten i MMC-exponerade celler återspeglar antagligen en effekt av läkemedlet i cellcykeldynamik snarare än en effekt av MMC vid E2F1-transkriptionsreglering.

I motsats till E2F1 är p21 Cip1 en MMC-responsiv gen. Förhöjda nivåer av p21 Cip1 detekterades vid HU-pålagd G1 / S-arrestering, vilket indikerar G1-kontrollpunktsaktivering av HU ( Figur 5B , 0 h tidpunkt) och dess uttryck minskade därefter i icke-MMC-behandlade celler, i överensstämmelse med en ostoppad cellcykelprogression efter frisättning från arrestera. I motsats till detta ledde MMC-behandling till förhöjda p21- Cip1- mRNA-nivåer ( Figur 5B , övre högra grafen, fast linje) medan celler ackumulerades i G2-fasen (9 h MMC-exponering). Trots det faktum att cellcykelprofiler var likartade vid 9 h tidpunkten i kontroll och MMC-behandlade celler, visar genuttrycksanalys en grundläggande skillnad. MMC-exponerade celler uppvisade en aktiverad G2-kontrollpunkt, visad genom induktion av p21- Cip1- uttryck, medan obehandlade celler genomgick en ostoppad övergång genom G2 med låga P21 Cip1- nivåer.

Data erhållen genom flödescytometrianalys ( FiGur 5A) och data resulterande från RT-qPCR ( Figur 5B , övre grafer) kombinerades i ett enda diagram för var och en av de valda generna ( Figur 4B , nedre grafer). MRNA-expressionsnivåer, där de visade sig som relativ höjd av staplarna medan cellcykelfördelningen av celler för varje prov illustrerades med andelen färger: grön för G1-fas (2C DNA-innehåll), blå för G2-fas (4C-DNA-innehåll) och röd För S-fas (mellanliggande DNA-innehåll). Denna kombinerade metod för grafisk representation kan vara till hjälp för tolkning av cellcykelfördelning och genuttrycksanalyser.

Sammanfattningsvis tillåter genuttrycksanalys kopplad till en odlingssynkroniseringsmetod identifieringen av en genotoxisk agensresponsiv gen (p21 Cip1 ) och ledde till att föreslå att förändringar observerade vid E2F1-uttryck mellan celler behandlade och obehandlade med medlet var indirekta ochEventuellt relaterad till skillnader i cellcykelfördelning av celler.

Figur 1
Figur 1: Översikt över två komplementära cellsynkroniseringsprotokoll: Thymidin-Nocodazol och Hydroxyurea. ( A ) Grafisk representation av däggdjurscellcykeln som indikerar punkterna vid vilken cellcykelhållande uppnås genom cellsynkroniseringsmetoder. Thy-Noc-baserad procedur blockerar celler i tidig mitos (M) medan HU blockerar celler vid G1 / S-gränsen. ( B ) Schematisk representation av Thy-Noc-protokollet för cellsynkronisering. Visas är stegen som vanligtvis används för genuttrycksanalys och cellcykelövervakning i U2OS-celler. ( C ) Schematisk representation av HU-baserat protokoll för cellsynkronisering. Visas är stegen som vanligtvis används för genuttrycksanalys och cellcykelövervakning i U2OS-celler. Ett kortare synkroniseringsförfarande som utesluter serumsvältning kan också tillämpas om optimal synkronisering redan uppnås genom 24 h exponering för HU. Vänligen klicka här för att se en större version av denna figur.

Figur 2
Figur 2: Bedömning av lämpliga synkroniseringsmetoder. ( A ) Asynkrona och Thy-Noc-synkroniserade U2OS-cellkulturer utsattes för pH-3-färgning för att bedöma fraktionen av mitotiska celler i varje fall. Samtidig PI-färgning möjliggjorde övervakning av DNA-halten i celler. I den asynkrona populationen var endast en minimal fraktion av celler med 4C DNA-innehåll (i blått) positivt för mitosmarkören. Däremot ackumuleras Thy-Noc-protokollet effektivtMulerade celler i mitos (positivt för pH 3-färgningen) och möjliggjorde korrekt progression till nästa G1-fas (i grönt) vid avlägsnande av nokodazol (3 h tidpunkt). Procentandel celler i varje fas sammanfattas i tabellen och märks med färger enligt de som används i PI-histogrammen: grön för 2C DNA-innehållsceller (G1), blå för celler med 4C-DNA-innehåll (inklusive G2 och M-celler och betecknad som G2 i histogrammen för att förenkla figuren och röda för celler med mellanliggande DNA-innehåll (S). ( B ) Thymidin och HU bedömdes för deras cellcykelsynkroniseringseffektivitet i U2OS-celler. Celler behandlades med tymidin (en eller två Rundor) eller med HU i 24 h, och cellsynkronisering undersöktes genom PI-färgning och FACS-analys. Summit användes för FACS-dataanalys. Vänligen klicka här för att se en större version av denna figur.

Figur 3
Figur 3: Utformning av tidsramen för enhetlig framsteg av celler efter Thy-Noc- och HU-medierad synkronisering. ( A ) U2OS-celler synkroniserades i M-fas med Thy-Noc-protokoll (övre raden) eller i G1 / S-övergång med HU-protokoll (nedre raden). Cykelprogression monitorerades genom PI-färgning och FACS-analys av DNA-halten i celler var tredje timme efter frisättningen från kemikalier. Toppmötet användes för FACS-dataanalys. Celler som släpptes från Thy-Noc-medierad arrestering ingicks synkront i början av G1-fasen efter 3 timmar, och utvecklades jämnt upp till S-fasen vid efterföljande tidpunkter. Celler som släpptes från HU-medierad arrestering överfördes synkront genom S och G2 faser. Celler som samlades 15 h efter frisättning representerade gränserna för cellsynkronisering, eftersom progression till nästa fas endast uppnåddesD av en bråkdel av befolkningen. ( B ) Cellsynkronisering övervakades genom Western blot-analys genom att samla proteinprover var 3: e timme och upp till 15 timmar efter frisättning. Uttryckskinetik för cyklin E1 (CCNE1), en cyklin huvudsakligen ackumulerad genom S-fasen, cyklin B1 (CCNB1), huvudsakligen närvarande från G2 till M-fas och pH3, en markör för mitotiska celler, bekräftade cellcykelfördelningsprofiler observerade genom flödescytometri. Actin B (ACTB) användes som en endogen laddningskontroll eftersom dess nivåer inte är beroende av cellcykeln. (Som modifierad från Mitxelena et al . 8 ). Vänligen klicka här för att se en större version av denna figur.

Figur 4
Figur 4: Studie av cellcykelfasberoende T Transkription av E2F-familjemedlemmar genom kompletterande cellsynkroniseringsmetoder. U2OS-celler arresterades i G2 / M genom Thy-Noc-protokoll eller i G1 / S genom HU-behandling, och prover uppsamlades för RNA-extraktion och FACS-analys var tredje timme upp till 15 timmar vid frisättning från anhållande. Genuttrycksanalys med RT-qPCR avslöjade en E2F1-expressionsprofil omskriven huvudsakligen till G1 (övre vänstra grafen) medan E2F7-genuttrycksprofilen skiftades till S-fasen, med en gradvis nedreglering genom G2-fasen (nedre högra grafen). TBP användes som endogen icke-cellcykelsreglerad gen för att beräkna relativa förändringar i mRNA-nivåer och resultat representerades som medelvärden och standardavvikelse (SD). Progression genom cellcykel bestämdes genom PI-färgning och FACS-analys av DNA-halten i celler. Cellcykelfaser representerades som bakgrundsfärger i grafer: svart (grip vid tidig mitos), grön (G1-fas), röd (S-fas) och blå (G2-fas)..com / filer / ftp_upload / 55745 / 55745fig4large.jpg "target =" _ blank "> Vänligen klicka här för att se en större version av denna figur.

Figur 5
Figur 5: Påverkan av MMC på genuttryck och cellcykelprogression. U2OS-celler behandlades med HU i 24 timmar och MMC (250 nM) tillsattes omedelbart efter frisättning från HU-medierad G1 / S-arrestering. Prover för FACS-analys och genuttrycksanalys samlades upp vid angivna tidpunkter. ( A ) Progression genom cellcykeln bestämdes genom PI-färgning och FACS-analys av DNA-innehåll genom Summit-mjukvaran. MMC inducerade en måttlig fördröjning i progressionen genom S-fasen (röd population) och en permanent anställning i G2-fasen (blå population), vilket framgår av frånvaron av celler i G1 (grön population) efter 15 timmars behandling (nedre raden) jämfört med Till icke-Behandlade (övre raden) celler. ( B ) E2F1 och p21 Cip1 -genuttrycksanalys i MMC-behandlade eller obehandlade celler utfördes vid mRNA-nivån med RT-qPCR. Oxa1L användes som en endogen icke-MMC-responsiv gen och resultat representerades som medelvärden och SD. Övre grafer representerar relativa mRNA-nivåer av valda gener efter frisättning från HU och tillsats av MMC. Nedre grafer kombinerar data som erhållits genom FACS-analys och RT-qPCR. Vänligen klicka här för att se en större version av denna figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Analys av finjusterade reglerade gener som är involverade i övergående och specifika roller i cellcykeln kräver en likformig cellpopulation. Många forskare använder rutinmässigt etablerade tumörcellinjer för dessa ändamål och en rad olika metoder har utvecklats för att erhålla synkrona (eller delvis synkrona) cellpopulationer, i syfte att samla så många celler som möjligt i definierade cellcykelfaser. Dessutom har starka ansträngningar gjorts för att förbättra och optimera väletablerade synkroniseringsmetoder. Ändå har alla synkroniseringsprotokoll nackdelar som kan hänföras till heterogenitet av cellkulturer, till suboptimal effektivitet av synkroniseringsförfarandena eller till sekundära effekter som kemiska synkroniserare har i cellfunktion, bland andra. Dessa begränsningar måste beaktas vid tillämpning av cellsynkroniseringsprotokoll. Forskare behöver identifiera de mest lämpliga synkroniseringsmetoderna för deras specifikaIscells typ eller experiment. Även odla olika cellinjer på exakt samma sätt, resulterande synkroniseringshastigheter kan skilja sig på grund av flera anledningar. Å ena sidan kan cellcykelens längd variera beroende på den valda cellinjen; Å andra sidan kan samma inhibitor ha kontrasterande effekter på olika cellinjer på grund av speciella egenskaper hos varje cellinje 25 . Vidare måste vald hämmarkoncentration och exponeringstid alltid anpassas till varje cellinje för att undvika eller minimera oönskade sidotoxicitet 26 . Även efter optimering av alla dessa aspekter uppnås aldrig 100% ackumulering av celler i en given cellcykelfas, och asynkron ökar gradvis efter avlägsnande av kemikalien 27 . Det är sålunda viktigt att förstå att synkroniseringsmetoder erhåller i bästa fall delcellsberikningar i en viss tidsram.

I denna w Ork två synkroniseringsförfaranden (Thy-Noc och HU) har optimerats för deras användning i U2OS-celler, vilka båda används i stor utsträckning för cellsynkroniseringsanalyser 28 , 29 , 30 . För att arrestera celler i M-fas fungerade en kombination av tymidin och nokodazol effektivt i U2OS-celler. Med tanke på den cytotoxiska karaktären hos nocodazol var det viktigt att bestämma exponeringstiden och dosen av denna inhibitor för att inte bara få en mycket synkroniserad cellpopulation men också optimal cellöverlevnad. Tidigare exponering för tymidin (eller teoretiskt någon annan liknande förening som hydroxiurea) ledde till en berikning av cellpopulationen i Gl- och S-faser, varigenom den nödvändiga exponeringstiden för nocodazol exponeras. För att arrestera celler i G1 / S betraktades flera möjligheter, inklusive dubbel-tymidinblock, en metod som är mycket effektiv vid synkronisering av flera cellinjer"> 31 , 32. Tymidin kastades emellertid, med tanke på dess nedslående resultat i U2OS. En runda tymidinbehandling arresterade bara en bråkdel av celler, medan två runda tymidinbehandling effektivt blockerade majoriteten av cellerna i G1 / S, men en G1 Populationen upprätthölls efter frisättning från tymidin och cellcykelförskjutningen fortsatte inte likformigt. Däremot gav hydroxyurea-behandling goda G1 / S-blockerande resultat och enhetlig progression av celler genom S och in i G2.

Cellcykelfasfördelning bör undersökas när man utför cellsynkroniseringsexperiment ( t.ex. genom propidiumjodidfärgning eller pH3-märkning följt av FACS-analys eller genom immunoblottning av cellcykelfasspecifika proteiner) 16 , 33 , 34 , för att bättre tolka genuttryck resultat. En felaktig synkroniseringseffektivitetNcy eller små mellan experimentella skillnader i progressionen genom cellcykeln kan leda till felaktiga slutsatser. Till exempel är nocodazolbehandling känd att orsaka misslyckande av mitotisk kontrollpunktsfunktion under vissa förhållanden. Detta ger upphov till en population av celler med 4C DNA-innehåll men negativt för mitotiska markörer 34 som "slipsar" mitotisk delning och återgår till interfas med ett 4C-innehåll 35 . Framväxten av denna delmängd av celler, som kan detekteras genom immunförstärkning med anti-fosfor-H3-antikroppar (se figur 2A ) kan minimeras genom användning av kall PBS för nocodazol-tvättstegen. En annan effekt som är associerad med användningen av kemiska hämmare som påverkar cellsynkronisering är kontrollpunktsaktivering associerad med exponering för dessa föreningar 36 , 37 , en mekanism genom vilken cellen aktivt arresterar progression genom cellcykeln tills den kanSe till att processer tidigare än den exakta punkten (t.ex. korrekt DNA-replikering, spindelmontering) löses 38 . För att en synkroniseringsmetod ska vara tillräcklig måste arresteringen vara inte bara effektiv men också helt reversibel. Således är det efter frigöring av cellcykelhämmare viktigt att analysera huruvida inhibitorernas effekter har återgått, exempelvis genom att analysera uttryck av kontrollpunktmarkörer, såsom p21 CIP . Figur 5B visar att hydroxyureasynkroniserade U2OS-celler effektivt löst kontrollpunkten, eftersom p21- CIP- nivåer reducerades till basaluttryck efter frisättning.

I U2OS-celler faller anrikningsprocenterna vid cellcykelarrest inom intervallet som rapporterats av andra studier på cellsynkronisering 29 , 30 , 39 : omkring 85% celler med 4C DNA-innehåll (PI-färgning) och caMätt 90% av dem i mitos (pH3 positiv märkning) vid behandling med tymidin-nokodazol och omkring 80-90% av G1 / S-cellerna efter behandling med hydroxyurea. Frigörning från cellcykelhållande driver typiskt korrekt framsteg genom nästa eller två faser på ett enhetligt sätt, även om synkronisering avbryts oavbrutet efter flera timmar och celler kan inte slutföra en hel cellfördelningscykel på ett synkroniserat sätt. För att få en fullständig bild av alla faser av cellcykeln använder därför protokollet som föreslås i detta arbete två synkroniseringsmetoder från olika delar av cellcykeln. Såsom visas i figur 3A säkerställde varje enskilt protokoll inte synkronisitet över en hel cellcykel. Thy-Noc-baserad synkronisering tillhandahöll en lämplig ram för processer som förekommer i Gl-S-faser, medan celler som släpptes från HU var lämpliga för analysen av händelser som ägde rum under S och G2 / M. Komplementariteten hos de valda två procedurernaEs demonstrerades genom analysen av två medlemmar av E2F transkriptionsfaktorfamiljen ( Figur 4 ), som stöder tanken att kombination av två metoder som synkroniseras i olika faser av cellcykeln är ett kraftfullt sätt att exakt fastställa cellcykelsreglerat genuttryck Mönster och bättre förstå deras fysiologiska roll.

En övertygande tillämpning av cellsynkroniseringsprocedurer fokuserar på att utvärdera effekten av potentiella terapeutiska medel. Effekten av farmaceutiska föreningar, såsom de med antitumöraktivitet, studeras ofta i asynkroncellpopulationer. Under dessa inställningar är det möjligt att bestämma implikationen hos det valda läkemedlet vid induktion av flera processer såsom celldöd, cellcykelstopp eller senescens 7 , 40 . Men val av asynkrona cellinställningar för identifiering av exakta molekylhändelser som reglerarSådana processer kan leda till ofullständiga eller delvis felaktiga slutsatser. Denna punkt, som ofta förbises, har illustrerats i föreliggande arbete genom att analysera effekten av det kemoterapeutiska läkemedlet MMC på E2F1 och p21 Cip1 -genuttrycket ( Figur 5 ). Sammantaget ger kombinationen av celsynkronisering och behandling med genotoxiska medel ett lämpligt sammanhang för att studera uttrycket av gener som är mottagliga för det genotoxiska medlet och att diskriminera från de som påverkas av cellcykelförstörningar som åläggs agenten.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgments

Vi tackar medlemmarna i Zubiaga och Altmeyer laboratorierna för användbara diskussioner och för teknisk support. Detta arbete stöddes av bidrag från det spanska ministeriet (SAF2015-67562-R, MINECO / FEDER, UE), den baskiska regeringen (IT634-13 och KK-2015/89) och universitetet i Baskien UPV / EHU ( UFI11 / 20).

Materials

Name Company Catalog Number Comments
DMEM, high glucose, GutaMAX supplement Thermo Fisher Scientific 61965-059
FBS, qualified, E.U.-approved, South America origin Thermo Fisher Scientific 10270-106
Penicillin-Streptomycin (10,000 U/mL) Thermo Fisher Scientific 15140-122
0.25% Trypsin-EDTA (1x), phenol red Thermo Fisher Scientific 25200-072
Thymidine SIGMA T1895-5G Freshly prepared. Slight warming might help dissolve thymidine.
Nocodazole SIGMA M-1404 Stock solution in DMSO stored at -20 ºC in small aliquots
Hydroxyurea SIGMA H8627 Freshly prepared
Mitomycin C from Streptomyces caespitosus SIGMA M4287 1.5 mM stock solution in sterile H2O protected from light and stored at 4 ºC
Dimethyl sulfoxide SIGMA D2650
Propidium iodide SIGMA P4170 Stock solution in sterile PBS at 5 mg/ml, stored at 4 º C protected from light.
PBS pH 7.6 Home made
Ethanol PANREAC A3678,2500
Chloroform SIGMA C2432
Sodium Citrate PANREAC 131655
Triton X-100 SIGMA T8787
RNAse A Thermo Fisher Scientific EN0531
TRIzol Reagent LifeTechnologies 15596018
RNeasy Mini kit QIAGEN 74106
High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific 4368814
Anti-Cyclin E1 antibody Cell Signaling 4129 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-Cyclin B1 antibody Cell Signaling 4135 1:1000 dilution in 5% milk, o/n, 4 ºC
Anti-β-actin SIGMA A-5441 1:3000 dilution in 5 % milk, 1 hr, RT
Anti-pH3 (Ser 10) antiboty Millipore 06-570 Specified in the protocol
Secondary anti-rabbit AlexaFluor 488 antibody Invitrogen R37116 Specified in the protocol
Secondary anti-mouse-HRP antibody Santa Cruz Biotechnology sc-3697 1:3000 dilution in 5 % milk, 1 hr, RT
Forward E2F1 antibody (human)                    TGACATCACCAACGTCCTTGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F1 antibody (human)                    CTGTGCGAGGTCCTGGGTC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward E2F7 antibody (human)                    GGAAAGGCAACAGCAAACTCT Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse E2F7 antibody (human)                    TGGGAGAGCACCAAGAGTAGAAGA Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward p21Cip1 antibody (human)                    AGCAGAGGAAGACCATGTGGAC Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse p21Cip1 antibody (human)                    TTTCGACCCTGAGAGTCTCCAG Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward TBP antibody (human) reference gene                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse TBP antibody (human)                     Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Forward Oxa1L antibody (human) reference gene   CACTTGCCAGAGATCCAGAAG                  Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Reverse Oxa1L  antibody (human)    CACAGGGAGAATGAGAGGTTTATAG                 Biolegio Designed by PrimerQuest tool (https://eu.idtdna.com/site)
Power SYBRGreen PCR Master Mix Thermo Fisher Scientific 4368702
FACS Tubes  Sarstedt 551578
MicroAmp Optical 96-Well Reaction Plate Thermo Fisher Scientific N8010560
Corning 100 mm TC-Treated Culture Dish Corning
Corning Costar cell culture plates 6 well Corning 3506
Refrigerated Bench-Top Microcentrifuge Eppendorf 5415 R
Refrigerated Bench-Top Centrifuge Jouan CR3.12 Jouan 743205604
NanoDrop Lite Spectrophotometer Thermo Scientific ND-LITE-PR
BD FACSCalibur Flow Cytometer BD Bioscience
QuantStudio 3 Real-Time PCR System Thermo Fisher Scientific A28567

DOWNLOAD MATERIALS LIST

References

  1. Beato, M., Sánchez-Aguilera, A., Piris, M. A. Cell cycle deregulation in B-cell lymphomas. Blood. 101, (4), 1220-1235 (2003).
  2. Chen, H. Z., Tsai, S. Y., Leone, G. Emerging roles of E2Fs in cancer: an exit from cell cycle control. Nat Rev Cancer. 9, (11), 785-797 (2009).
  3. Cho, R. J., et al. Transcriptional regulation and function during the human cell cycle. Nat Genet. 27, (1), 48-54 (2001).
  4. Peña-Diaz, J., et al. Transcription profiling during the cell cycle shows that a subset of Polycomb-targeted genes is upregulated during DNA replication. Nucleic Acids Res. 41, (5), 2846-2856 (2013).
  5. Grant, G. D., et al. Identification of cell cycle-regulated genes periodically expressed in U2OS cells and their regulation by FOXM1 and E2F transcription factors. Mol Biol Cell. 24, (23), 3634-3650 (2013).
  6. Minderman, H., et al. In vitro and in vivo irinotecan-induced changes in expression profiles of cell cycle and apoptosis-associated genes in acute myeloid leukemia cells. Mol Cancer Ther. 4, (6), 885-900 (2005).
  7. McKenna, E., Traganos, F., Zhao, H., Darzynkiewicz, Z. Persistent DNA damage caused by low levels of mitomycin C induces irreversible cell senescence. Cell Cycle. 11, (16), 3132-3140 (2012).
  8. Infante, A., et al. E2F2 represses cell cycle regulators to maintain quiescence. Cell Cycle. 7, (24), 3915-3927 (2008).
  9. Cecchini, M. J., Amiri, M., Dick, F. A. Analysis of cell cycle position in mammalian cells. J Vis Exp. (59), (2012).
  10. Schorl, C., Sedivy, J. M. Analysis of cell cycle phases and progression in cultured mammalian cells. Methods. 41, (2), 143-150 (2007).
  11. Lalande, M. A reversible arrest point in the late G1 phase of the mammalian cell cycle. Exp Cell Res. 186, (2), 332-339 (1990).
  12. Park, S. Y., et al. Mimosine arrests the cell cycle prior to the onset of DNA replication by preventing the binding of human Ctf4/And-1 to chromatin via Hif-1α activation in HeLa cells. Cell Cycle. 11, (4), 761-766 (2012).
  13. Ikegami, S., et al. Aphidicolin prevents mitotic cell division by interfering with the activity of DNA polymerase-alpha. Nature. 275, (5679), 458-460 (1978).
  14. Baranovskiy, A. G., et al. Structural basis for inhibition of DNA replication by aphidicolin. Nucleic Acids Res. 42, (22), 14013-14021 (2014).
  15. Adams, R. L., Lindsay, J. G. Hydroxyurea reversal of inhibition and use as a cell-synchronizing agent. J Biol Chem. 242, (6), 1314-1317 (1967).
  16. Mitxelena, J., Apraiz, A., Vallejo-Rodríguez, J., Malumbres, M., Zubiaga, A. M. E2F7 regulates transcription and maturation of multiple microRNAs to restrain cell proliferation. Nucleic Acids Res. (2016).
  17. Bootsma, D., Budke, L., Vos, O. Studies on synchronous division of tissue culture cells initiated by excess thymidinE. Exp Cell Res. 33, 301-309 (1964).
  18. Galgano, P. J., Schildkraut, C. L. G1/S Phase Synchronization using Double Thymidine Synchronization. CSH Protoc. (2), (2006).
  19. Edwin Taylor, W. Kinetics of inhibition and the binding of h3-colchicine. J Cell Biol. 25, 145-160 (1965).
  20. Zieve, G. W., Turnbull, D., Mullins, J. M., McIntosh, J. R. Production of large numbers of mitotic mammalian cells by use of the reversible microtubule inhibitor nocodazole. Nocodazole accumulated mitotic cells. Exp Cell Res. 126, (2), 397-405 (1980).
  21. Matsui, Y., Nakayama, Y., Okamoto, M., Fukumoto, Y., Yamaguchi, N. Enrichment of cell populations in metaphase, anaphase, and telophase by synchronization using nocodazole and blebbistatin: a novel method suitable for examining dynamic changes in proteins during mitotic progression. Eur J Cell Biol. 91, (5), 413-419 (2012).
  22. Nolan, T., Hands, R. E., Bustin, S. A. Quantification of mRNA using real-time RT-PCR. Nat Protoc. 1, (3), 1559-1582 (2006).
  23. Thornton, B., Basu, C. Real-time PCR (qPCR) primer design using free online software. Biochem Mol Biol Educ. 39, (2), 145-154 (2011).
  24. Abbas, T., Dutta, A. p21 in cancer: intricate networks and multiple activities. Nat Rev Cancer. 9, (6), 400-414 (2009).
  25. Kung, A. L., Sherwood, S. W., Schimke, R. T. Cell line-specific differences in the control of cell cycle progression in the absence of mitosis. Proc Natl Acad Sci U S A. 87, (24), 9553-9557 (1990).
  26. Borel, F., Lacroix, F. B., Margolis, R. L. Prolonged arrest of mammalian cells at the G1/S boundary results in permanent S phase stasis. J Cell Sci. 115 (Pt. 14, 2829-2838 (2002).
  27. Knehr, M., et al. A critical appraisal of synchronization methods applied to achieve maximal enrichment of HeLa cells in specific cell cycle phases). Exp Cell Res. 217, (2), 546-553 (1995).
  28. Zhu, W., Giangrande, P. H., Nevins, J. R. E2Fs link the control of G1/S and G2/M transcription. EMBO J. 23, (23), 4615-4626 (2004).
  29. Whitcomb, E. A., Dudek, E. J., Liu, Q., Taylor, A. Novel control of S phase of the cell cycle by ubiquitin-conjugating enzyme H7. Mol Biol Cell. 20, (1), 1-9 (2009).
  30. Bruinsma, W., Macurek, L., Freire, R., Lindqvist, A., Medema, R. H. Bora and Aurora-A continue to activate Plk1 in mitosis. J Cell Sci. 127, 801-811 (2014).
  31. Thomas, D. B., Lingwood, C. A. A model of cell cycle control: effects of thymidine on synchronous cell cultures. Cell. 5, (1), 37-42 (1975).
  32. Whitfield, M. L., et al. Identification of genes periodically expressed in the human cell cycle and their expression in tumors. Mol Biol Cell. 13, (6), 1977-2000 (2002).
  33. Lim, S., Cdks Kaldis, P. cyclins and CKIs: roles beyond cell cycle regulation. Development. 140, (15), 3079-3093 (2013).
  34. Tapia, C., et al. Two mitosis-specific antibodies, MPM-2 and phospho-histone H3 (Ser28), allow rapid and precise determination of mitotic activity. Am J Surg Pathol. 30, (1), 83-89 (2006).
  35. Andreassen, P. R., Martineau, S. N., Margolis, R. L. Chemical induction of mitotic checkpoint override in mammalian cells results in aneuploidy following a transient tetraploid state. Mutat Res. 372, (2), 181-194 (1996).
  36. Wei, F., Xie, Y., He, L., Tao, L., Tang, D. ERK1 and ERK2 kinases activate hydroxyurea-induced S-phase checkpoint in MCF7 cells by mediating ATR activation. Cell Signal. 23, (1), 259-268 (2011).
  37. Kubota, S., et al. Activation of the prereplication complex is blocked by mimosine through reactive oxygen species-activated ataxia telangiectasia mutated (ATM) protein without DNA damage. J Biol Chem. 289, (9), 5730-5746 (2014).
  38. Hartwell, L. H., Weinert, T. A. Checkpoints: controls that ensure the order of cell cycle events. Science. 246, (4930), 629-634 (1989).
  39. St-Denis, N. A., Derksen, D. R., Litchfield, D. W. Evidence for regulation of mitotic progression through temporal phosphorylation and dephosphorylation of CK2alpha. Mol Cell Biol. 29, (8), 2068-2081 (2009).
  40. Min, A., et al. RAD51C-deficient cancer cells are highly sensitive to the PARP inhibitor olaparib. Mol Cancer Ther. 12, (6), 865-877 (2013).
Studierande cellcykelreglerade genuttryck av två komplementära cellsynkroniseringsprotokoll
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).More

Apraiz, A., Mitxelena, J., Zubiaga, A. Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols. J. Vis. Exp. (124), e55745, doi:10.3791/55745 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter