Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Ein universelles Protokoll für groß angelegte gRNA Bibliothek Produktion aus jeder DNA-Quelle

doi: 10.3791/56264 Published: December 6, 2017

Summary

Methoden zur Generierung von groß angelegten gRNA Bibliotheken sollte einfach, effizient und kostengünstig sein. Wir beschreiben ein Protokoll für die Herstellung von gRNA Bibliotheken basierend auf enzymatische Verdauung von Ziel DNA. Diese Methode CORALINA (umfassende gRNA Bibliothek Generation durch kontrollierte Nuklease Aktivität) stellt eine Alternative zu teuren benutzerdefinierte Oligonukleotid-Synthese.

Abstract

Die Popularität des CRISPR/Cas9-Systems für Genom und Epigenom Technik ergibt sich aus seiner Einfachheit und Anpassungsfähigkeit. Ein Effektor (Cas9-Nuklease oder eine Nuklease-Toten dCas9-Fusionsprotein) richtet sich an eine bestimmte Stelle im Genom durch eine kleine synthetische RNA als Guide RNA oder gRNA bekannt. Die zweiseitigen Charakter des CRISPR-System ermöglicht seine Verwendung in screening-Ansätze seit Plasmid Bibliotheken mit Expressionskassetten von Tausenden von einzelnen gRNAs verwendet werden können, um viele verschiedene Websites in einem einzigen Experiment zu verhören.

Bislang wurden gRNA Sequenzen für den Bau von Bibliotheken fast ausschließlich durch Oligonukleotid-Synthese, generiert die begrenzt der erreichbaren Komplexität der Sequenzen in der Bibliothek und ist relativ kostenintensiv. Hier ein detailliertes Protokoll zum CORALINA (umfassende gRNA Bibliothek Generation durch kontrollierte Nuklease Aktivität), eine einfache und kostengünstige Methode zur Erzeugung von hochkomplexen gRNA Bibliotheken basierend auf enzymatische Verdauung der Eingabe DNA, wird beschrieben. Da CORALINA Bibliotheken aus jeder beliebigen Quelle der DNA erzeugt werden können, gibt es viele Möglichkeiten zur Individualisierung, ermöglichen eine Vielzahl von CRISPR-basierte Bildschirme.

Introduction

Die Anpassung des Systems der bakteriellen CRISPR/Cas9 als molekulare targeting-Tool verursacht die neueste Revolution in der molekularen Biologie. Noch nie war es so einfach, Chromatin an definierten genomische stellen zu manipulieren. Gemeinsame Anwendungen CRISPR gehören gezielt Gene Mutationen1, Genom engineering2, Epigenom Bearbeiten3, transkriptionelle Aktivierung und Gen-silencing-4. Ein besonderer Vorteil des CRISPR-Systems ist, dass seine Anwendungen nicht beschränkt auf gut untersuchte Kandidat Seiten sind wie gRNA Bibliotheken weniger voreingenommen Bildschirme ermöglichen. Diese erleichtern die Entdeckung der funktionalen Loci im Genom ohne experimentelle Vorkenntnisse. Jedoch gRNA Bibliotheksbau beruht derzeit überwiegend auf Oligo-Nukleotid-Synthese, und gibt es nur begrenzte Möglichkeiten, gRNA Bibliotheken zu kaufen, die nicht von Menschen oder Maus Ursprung oder Ziel Regionen außerhalb öffnen Frames lesen. So, obwohl CRISPR-Bildschirme bereits, unglaublich starke5,6,7,8 bewiesen haben, hat ihr volle Potenzial noch nicht ausgeschöpft.

Um zu überwinden haben vor kurzem die Begrenzung der klassischen gRNA Generation Methoden zwei Strategien entwickelt. Beide basieren auf kontrollierte enzymatische Verdauung der Ziel-DNA, anstatt auf benutzerdefinierte Oligonukleotid-Synthese. Während CORALINA9 micrococcal Nuklease, die nur derzeit verfügbaren alternative Methode CRISPR-Essen10, beschäftigt macht Gebrauch von Restriktionsenzymen (HpaII, ScrFich, Bfaich und Mmeich). Wichtig ist, können beide Techniken auf jede Eingabe DNA dient als die Quelle der gRNA Protospacer Sequenzen angewendet werden. Während der CRISPR-Essen-Methode eine Strategie setzt, um die Anzahl der geklonten gRNAs verringern deren targeting Standorte werden nicht durch die erforderlichen S.pyogenes PAM (Protospacer angrenzenden Motiv) gefolgt, es erzeugt nur einen kleinen Bruchteil aller möglichen funktionalen gRNAs für eine bestimmten Region. CORALINA, auf der anderen Seite ist in der Lage, alle möglichen gRNAs für der Quellsequenz zu generieren, sondern beinhaltet auch einen höheren Anteil nichtfunktionale Guides. gRNA Bibliothek Generation durch kontrollierte Nuklease Aktivität ermöglicht die Produktion von umfassenden gRNA Bibliotheken für irgendeine Sorte jedes Cas9-Protein oder -Effektor-System in eine einfache und kostengünstige Weise. Darüber hinaus ist CORALINA anpassbar an Anpassung, wie entsprechende Eingabe- und Vektor Entscheidungen der Bibliothekstyp, Größe und Inhalt zu definieren. Hier wird ein detailliertes Protokoll präsentiert, kann für die Generierung von umfassenden gRNA Bibliotheken aus verschiedenen Quellen der DNA (Abbildung 1), einschließlich bakterielle künstliche Chromosomen (BACs) oder genomische DNA-9verwendet werden. Die repräsentativen Ergebnisse begleiten dieses Protokolls wurden durch die Anwendung des Protokolls CORALINA BAC DNA abgeleitet.

Protocol

(1) Verdauung der DNA mit Micrococcal Nuclease

  1. Führen Sie eine Optimierung Reaktion für jede neue Charge micrococcal Nuklease Enzyms (MNase).
    Hinweis: Die Anzahl der Einheiten des MNase verwendet sollte (über eine serielle Verdünnung, Abb. 2A) getestet werden. In der Regel 5-10 U MNase verdauen 1 µg der genomischen gereinigt oder BAC DNA auf einem Bereich von 5 bis 100 bp mit den Bedingungen beschrieben.
  2. Pro Reaktion, 1 µL 10 x MNase Buffer, 1 x Rinderserumalbumin (BSA), 1 µg der Ziel DNA, 1 µL MNase eingerichtet (0,1-50 Einheiten) in einer 10 µL Reaktionsvolumen.
  3. Inkubation bei 37 ° C für 15 Minuten.
  4. Sofort inaktivieren das Enzym durch Zugabe von 1 µL von 500 mM Ethylenglykol-Bis(β-aminoethyl ether)-N, N, N', N'-Tetraacetic Säure (EGTA).

2. Trennung von DNA-Fragmenten mit Polyacrylamid-Gelelektrophorese (PAGE)

  1. Fügen Sie Probe Puffer/Gel laden Farbstoff für DNA-Proben und laden auf eine 20 % Seite Gel. Laden Sie eine entsprechende DNA-Leiter für die Dimensionierung (5 bp DNA-Leiter). Überlasten Sie nicht das Gel (1 µg DNA pro Well).
  2. Laufen Sie Gele für bp, erreicht das untere Ende des Gels, um 1,5 h oder bis die untere Farbstoff-Front (Bromophenol blau, dunkel blau), die bei etwa 15 fährt in entsprechenden 1 X TRIS-Borat-EDTA (TBE) laufenden Puffer 150 V (konstante).
  3. Das Gel mit einer ultra-sensitive Nukleinsäure-Fleck Fleck und unter UV-Licht zu visualisieren.
  4. Bestimmen Sie aus dem Gelbild die optimale Konzentration der MNase verdauen DNA bis zu 20-30 bp in der Größe.
  5. Verwenden Sie die optimierten Konzentration von MNase Ziel DNA zu verdauen, durch Wiederholen der Schritte 1,2-2,2. In der Regel verdaut, Einrichten von 10-12, die Reaktionen (d.h. 10-12 µg der gesamten Ausgangsmaterial) genug erbringt DNA nach Seite Gel Extraktion, um mit weiteren Schritten fortfahren.
  6. Mit einem sterilen Skalpell, schneiden Sie das Gel neben der Marker-Spur und färben Sie nur den Teil des Gels mit der Leiter mit frischen 1 X TBE laufenden Puffer mit 1 X ein hochempfindliches Nukleinsäure-Fleck. Visualisieren Sie die DNA-Leiter und Verbrauchsteuern Sie MNase verdaut DNA-Fragmente in der Größenordnung zwischen etwa 18-30 bp mit einer Rasierklinge.
    Hinweis: Aussetzen Sie die MNase verdaut Fragmente mit UV-Licht. "Es ist möglich, verwenden Sie eine blaue Lichtquelle (statt UV) oder nehmen ein Bild der Leiter unter UV, drucken Sie es zu skalieren und verwenden Sie diese Option, um Exzision der MNase verdaut DNA-Fragmente zu führen). Dieser Schritt verhindert Fleckenbildung und DNA-Fragmente Exposition gegenüber UV-Licht. Verwenden Sie immer eine ungenutzte, sterile Einweg Skalpell oder einer Rasierklinge für diesen Schritt, um Verunreinigungen zu vermeiden.
  7. Übertragen Sie die Gel-Scheibe zu einem Microcentrifuge Schlauch.
  8. Flecken auf den Rest des Gels mit Nukleinsäure-Fleck als oben, UV-Licht aussetzen und zeichnen ein Bild, um das Gel Exzision Schritt aufzeichnen.

3. Isolation von DNA-Fragmenten aus Seite-Gele mit Crush und Einweichen Methode

Hinweis: Dieser Schritt wurde von Sambrook Et Al. übernommen 11

  1. Bereiten Sie Seite Gel Solubilisierung Puffer (1,88 mL Ammoniumacetat 4 M, 150 µL 1 M Magnesium-Acetat, 30 µL 0,5 M Ethylenediaminetetraacetic Säure (EDTA) (pH 8) in hochreinen H2O auf ein Gesamtvolumen von 15 mL).
  2. Zerdrücken Sie die ausgeschnittenen Gel Scheibe gegen die Wand der Mikro-Zentrifugenröhrchen mit einem sterilen Pipettenspitze.
  3. Fügen Sie 2 Bände der Seite Solubilisierung Puffer gel und Inkubation bei 37 ° C 16 h auf einer rotierenden Plattform hinzu.
  4. Zentrifugieren Sie Proben für 1 min bei maximaler Geschwindigkeit in einem Microcentrifuge. Übertragen des Überstands zu einem neuen Microcentrifuge Schlauch, kümmert sich nicht um irgendwelche Stücke zerkleinert Gel zu übertragen.
  5. Hinzufügen von 0,5 Volumen der Seite Solubilisierung Puffer auf das Gel Pellets, Wirbel, und wiederholen Sie die Zentrifugation (Schritt 3.4). Kombinieren Sie die Überstände.
  6. Die DNA-Fragmente über standard Phenol-Chloroform Extraktion zu extrahieren.
    Achtung: Phenol ist giftig bei Kontakt mit Haut oder beim Verschlucken. Sicherheitsvorkehrungen wie Handschuhe, Schutzbrille, einen Laborkittel und arbeiten in einer Dampfhaube sind entscheidend. Alle Phenol-haltige Abfälle des Instituts vorschriftsmäßig entsorgen.
    1. Hinzu kommen ein Volumen von Phenol: Chloroform: Isoamyl Alkohol (25:24:1) der Probe und Wirbel gründlich.
    2. Zentrifuge für 10 min. bei maximaler Geschwindigkeit (16.000 x g) in einer Tischplatte Zentrifuge bei Raumtemperatur. Übertragen Sie die oberen wässrige Phase sorgfältig auf einen frischen Microcentrifuge Schlauch. Achten Sie darauf, nicht über irgendwelche Phenol beim Pipettieren tragen.
    3. Wiederholen Sie die Schritte 3.6.1 und 3.6.2 einmal.
    4. Fügen Sie eine kleine Menge (0,2 µL) von Glykogen, 0,1 Volumen von 3 M Natriumacetat (pH 5,2) und 2 Bände von 100 % Ethanol (EtOH).
    5. Wirbel und Inkubation bei-20 ° C für mehrere Stunden oder über Nacht.
    6. Zentrifuge für 30 min bei maximaler Geschwindigkeit bei 4 ° C mit einer Tischplatte Zentrifuge.
    7. Nehmen Sie den Überstand vorsichtig und waschen das DNA-Pellet mit 70 % EtOH.
    8. Zentrifuge für 30 min bei maximaler Geschwindigkeit bei 4 ° C mit einer Tischplatte Zentrifuge.
    9. Entfernen Sie den Überstand zu und trocknen Sie das DNA-Pellet. Stellen Sie sicher, dass alle EtOH verdampft ist, aber achten Sie darauf, das Pellet übermäßig trocken.
    10. Auflösen von DNA-Pellet in 12 µL H2O.
      Hinweis: Seite Gel Extraktion ist sehr ineffizient. Erwarten Sie für jede 10 µg DNA mit MNase verdaut zu starten, ng 1-20 von gereinigten Fragmenten nach Gel Extraktion zu erholen. Betrag und die Integrität der Fragmente durch Laden von 1/6th Steuern (2 µL) auf einer Seite Gel (Abbildung 2).

4. Ende Reparatur MNase verdaut, Gel-gereinigte Fragmente

  1. Richten Sie die folgende Reaktion unter Verwendung einer DNS Abstumpfung Kit: 10 µL gereinigte DNA aus Schritt 3.6.10, 1,5 µL 10 X Abstumpfung, Puffer, 1,5 µL 1 mM dNTP-Mix, 0,6 µL abstumpfen Enzym, 1,4 µL H2O.
  2. Bei 22 ° C für 30 min inkubieren Sie, und dann inaktivieren Sie Hitze-das Enzym durch Inkubation bei 70 ° C für 10 Minuten.
  3. Fügen Sie 85 µL H2O und durchführen einer Reaktion Sanierung mit standard Phenol/Chloroform-Extraktion und EtOH-Niederschlag (siehe Abschnitt 3.6). Fahren Sie sofort mit Linker Ligatur.

(5) Linker Generation

Hinweis: Linker müssen parallel zu Abschnitt 3 sofort mit Linker Ligatur fortfahren können verstärkt werden. Primer-Sequenzen, die unten verwendet müssen für den gewählten gRNA Expressionsvektor geeignet sein. Die hier vorgestellten wurden für die Vektor-PgRNA-pLKO.1 entwickelt. Verwenden Sie 9 zur Verstärkung der 5' Linker aus PgRNA-pLKO.1, die Grundierung Sequenzen 5'-Linker-F (TTGGAATCACACGACCTGGA) und 5'-Linker-R (CGGTGTTTCGTCCTTTCCAC), ein 689 bp Amplikons nachgeben. Zur Verstärkung der 3' Linker aus PgRNA-pLKO.1 verwenden Sie die Primer 3'-Linker-f: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) und 3'-Linker-R: (ACTCGGTCATGGTAAGCTCC), die eine 848 bp Amplikons Ausbeute.

  1. PCR-verstärken Sequenzen der Adapter aus dem gRNA Ausdruck Vektor (mit Reagenzien und benutzerdefinierte Primer-Sequenzen, wenn nötig). Für PgRNA-pLKO.1 eingerichtet, die folgenden 50 µL-PCR-Reaktion: 25 µL des PCR-master-Mix, 2,5 µL Grundierung F (10 µM), 2,5 µL Grundierung R (10 µM), 0,1 ng gRNA Expressionsvektor (PgRNA-pLKO.1) in H2O.
  2. Inkubieren Sie Reaktionen auf einem Thermocycler mit den folgenden Bedingungen: 1 Zyklus 98 ° C für 30 s, 32 Zyklen 98 ° C für 10 s, 59 ° C für 10 s, 72 ° C für 30 s, 1 Zyklus 72 ° C für 10 Minuten.
  3. PCR-Reaktionen, die unter Verwendung der Festphase reversible Immobilisierung Korne entsprechend den Anweisungen des Herstellers zu reinigen. Eluieren Sie in 30 µL von H2O.
  4. Direktionale Ligatur der Linker den Ende repariert, MNase verdaut DNA-Fragmenten, Digest linker mit geeigneten Restriktionsenzymen (hier HindIII und SacII) durchzusetzen. Richten Sie die folgenden Reaktionen:
    1. Für die Verdauung von 5' Linker mit HindIII, 30 µL des gereinigten 5' Linker Amplikons aus Schritt 5.3 verwenden., 5 µL Puffer, 3 µL HindIII (20U/µL) und 12 µL H2O.
    2. Für die Verdauung von 3' Linker mit SacII, 30 µL des gereinigten 3' Linker Amplikons aus Schritt 5.3 verwenden., 5 µL Puffer, 3 µL des SacII (20 U/µL) und 12 µL H2O.
  5. Inkubieren Sie Übersichten bei 37 ° C für 3 h.
  6. Fügen Sie DNA-Gel laden Farbstoff hinzu und führen Sie das Restriktionsenzym verdaut auf einem 1 % Agarose-Gel. Verbrauchsteuern die Bänder an 637 bp (5' Linker "Digest") und 295 bp (3' Linker "Digest").
  7. Reinigen Sie die DNA aus den ausgeschnittenen Gel mit einem Gel Extraction Kit.

6. Linker Ligation und Verstärkung der Einsätze

  1. Richten Sie eine 14 µL Ligatur Reaktion unter Verwendung der äquimolaren Mengen an MNase verdaut, Ende repariert Fragmente und Linker Sequenzen.
    Hinweis: Linker Fragment-Verhältnisse kann optimiert werden. Es wird empfohlen, eine Kontrollreaktion keine-Fragment (NFC) enthalten.
    1. Verwendung 5 ng MNase verdaut Fragmente (Ende repariert und gereinigt), 120 ng von 5' Linker (HindIII "Digest", gereinigt), 55 ng 3' Linker (SacII "Digest", gereinigt), 1,4 µL T4-Ligase Puffer und 1,4 µL konzentrierte T4 DNA-Ligase in H2O.
  2. Inkubieren Sie die Ligatur Reaktionen bei 16 ° C 16 h. Tun nicht Hitze-inaktivieren das Enzym. Gehen Sie sofort zum Nick-Übersetzung.
    Hinweis: Die Ende repariert MNase verdaut Fragmente bieten die 5'-Phosphate notwendig für die Unterbindung der Linker, als Linker selbst un-phosphorylierten sind.
  3. Zu der Ligatur Reaktion (und die NFC-Reaktion) fügen Sie die folgenden: 25 µL Taq 2 X master-Mix (kann Einschnittübersetzung), 2,5 µL Grundierung Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µL Grundierung Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) und 6 µL H2O.
  4. Eine keine-Template-Kontrolle (NTC) gehören. Inkubieren Sie Reaktionen auf einem Thermocycler mit den folgenden Bedingungen: 1 Zyklus (Nick Übersetzung): 72 ° C für 20 min, 1 Zyklus: 95 ° C für 5 min, 3-4 Zyklen: 95 ° C für 15 s, 58 ° C für 15 s, 72 ° C für 30 s, 1 Zyklus: 72 ° C für 5 Minuten.
  5. Führen Sie eine Reaktion Säuberung unter Verwendung der Festphase reversible Immobilisierung Korne mit einer Probe Wulst-Verhältnis von 1:1. Eluieren Sie in 40 µL von H2O.
  6. Weiter verstärken das gewünschte Fragment (5' Linker + MNase fragment + 3 "Linker) mit entsprechenden PCR Reagenzien und die folgenden Primer:
    1. Verwenden Sie 12,5 µL des PCR-master-Mix, 1,25 µL Grundierung Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1,25 µL Grundierung Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µL des gereinigten Nick Übersetzung Produkt aus Schritt 6.4. und 7,5 µL H2O. verwenden Sie die folgenden Bedingungen: 1 Zyklus: 98 ° C für 30 s, 10-16 Zyklen: 98 ° C für 10 s, 63 ° C für 10 s, 72 ° C für 15 s, 1 Zyklus: 72 ° C für 10 Minuten.
      Hinweis: Bei Bedarf können mehrere Reaktionen gleichzeitig eingerichtet werden um sicherzustellen, dass es genug PCR-Produkt für die nachfolgenden Schritte. Um kleine Mengen an das PCR-Produkt auf einem Agarosegel zu visualisieren, richten Sie zusätzliche Reaktionen wie in Schritt 6.5 und erhöhen Sie die Anzahl der Zyklus von 15 bis 32. Diese Reaktion kann als Qualitätskontrolle, verwendet werden, wenn Amplifikate nach 15 Zyklen nicht sichtbar sind. Gehören Sie auch eine keine Vorlage Kontrolle (NTC).

7. die Größenauswahl

Hinweis: Dieser Schritt trennt MNase-Fragmente mit dem korrekt angeschlossenen 5' und 3'-Linker aus Fragmenten mit zwei 5' oder zwei 3' linker basierend auf Größe.

  1. Kombinieren Sie alle 15-Zyklus-PCR-Reaktionen aus Schritt 6.5., DNA loading Dye hinzufügen und ausführen auf einem 0,8 % Agarose-Gel. Verbrauchsteuern die prominenten Band auf 869 bp und DNA mit einem Gel Extraction Kit zu reinigen.
  2. Die Menge von DNA (z. B. mit einem Spektralphotometer) zu quantifizieren.

8. das Klonen der PCR verstärkt Fragmente in der gRNA Expressionsvektor von Gibson Versammlung

  1. Bereiten Sie Baugruppe meistern Mischung wie folgt:
    Hinweis: Die folgenden Schritte sind von Gibson Et al. 12.
    1. 6 mL isothermen Reaktion Puffer zu schaffen, durch die Kombination von 3 mL 1 M Tris (Hydroxymethyl) Aminomethane (Tris)-HCl pH 7.5, 300 µL 1 M MgCl, 60 µL 100 mM Deoxyguanosine Triphosphat (dGTP), 60 µL 100 mM Deoxyadenosine Triphosphat (dATP), 60 µL 100 mM Deoxythymidine Triphosphat (dTTP), 60 µL 100 mM Deoxycytidine Triphosphat (dCTP), 300 µL 1 M Dithiothreitol (DTT), 1,5 g Polyethylenglykol (PEG)-8000, 300 µL 100 mM Nicotinamid-Adenin-Dinucleotide (NAD) in hochreinen H2O.
      Hinweis: Dieses Puffers kann regelmÄÑig und bei-20 ° c gelagert werden
    2. Erstellen Sie durch die Kombination 320 µL 5 X isothermen Reaktion Puffer, 3 µL 10 U/µL T5 Exonuclease, 20 µL 2 U/µL DNA-Polymerase, 160 µL 40 U/µL DNA Ligase in hochreinen H2O. Einsatz 15 µL Montage-master-Mix mit 5 µL 1,2 mL-Montage-master-mix Fügen Sie ein.
      Hinweis: Die Montage-master-Mix kann regelmÄÑig und bei-20 ° C gelagert wo ist es seit mehr als einem Jahr stabil und verträgt mehrere Gefrier-Tau-Zyklen. Der gewählte Betrag von T5 Exonuclease ist ideal für den Einsatz mit langen Überhängen.
  2. Vektor Rückgrat Verdauung
    Hinweis: Stellen Sie sicher, eine ausreichende Menge des Vektors als Input für die gewünschte Anzahl der Montage Reaktionen im Schritt 8.3 zu verdauen.
    1. Pro Reaktion, fügen Sie die folgenden: 1,5 µg gRNA Expressionsvektor (PgRNA-pLKO.1), 5 µL Puffer, 1,5 µL altich (5U/µL) und 38,5 µL H2O. Incubate verdauen bei 37 ° C für 2 h.
  3. Dephosphorylation der linearisierten Vektor.
    Hinweis: Dieser Schritt ist beraten, aber nicht unbedingt notwendig. T5 Exonuclease in den master-Mix werden meist entfernen Alterich Überhänge, bevor die Taq-DNA-Ligase eine Chance zum handeln konnte. Übermäßige Re Unterbindung des Vektors ist daher nicht zu erwarten.
    1. Fügen Sie 2,5 µL Shrimp alkalische Phosphatase Enzym (rSAP, 1 U/µL).
    2. Inkubation bei 37 ° C für 30 min und dann inaktivieren das Enzym durch Inkubation bei 65 ° C für 5 Minuten.
  4. DNA-Reinigung durchführen
    Hinweis: Es wird empfohlen, ein Agarose-Gel-Extraktionsschritt durchführen. Alternativ kann die Spalte oder Perlen Reinigung verwendet werden. Es ist wichtig zu prüfen, ob die Vektor-Verdauung abgeschlossen, z. B. durch Agarose-Gelelektrophorese ist. Zum Vergleich sollte unverdaute Vektor parallel ausgeführt werden.
  5. Die Höhe der gereinigten verdauten Vektor in der Probe zu quantifizieren.
  6. Die Montage mit 2-fold Molaren Überschuss an Einsätzen für Vektor-eingerichtet. Pro 20 µL Reaktion Verwendung 100 ng des Vektors (Alterich aus Schritt 8,5 verdauen), 12.2 ng von einfügen (ab Schritt 7.1.), 15 µL des Montage-master-Mix aus Schritt 8.1.2. H2O.
  7. Bei 50 ° C für 1 h inkubieren.
  8. Reinigen Sie die Reaktionen mit Spalte Reinigung. Aufschwemmen die DNA in 75 µL H2O (oder entsprechende Lautstärke je nach Ausmaß der Elektroporation).
    Hinweis: Die Transformationseffizienz ist stark abhängig von DNA Reinheit. Weitere Reinigungsschritte (z.B. Phenol/Chloroform Extraktion) könnte die Effizienz erhöhen.

9. Vorbereitung der Electro-kompetente TG1 E. Coli Zellen

  1. Stellen Sie sicher, dass alle Flaschen Zentrifuge und Korbflaschen frei von Reinigungsmitteln durch Spülen und anschließende Füllung mit destilliertem Wasser vor dem Autoklavieren sind.
    Hinweis: Dieser Schritt hilft, um eventuelle Verunreinigungen zu entfernen, die Transformationseffizienz zu beeinträchtigen. Wasser sollte unmittelbar vor dem Gebrauch entsorgt werden. Alternativ kann die Verwendung von Einweg-Zentrifugation Flaschen ratsam sein.
  2. Sicherstellen Sie, dass die Zentrifuge Flaschen, Tuben und Lösungen für die Herstellung von Electrocompetent Zellen auf Eis vor dem Gebrauch gekühlt werden. Es empfiehlt sich, führen die folgenden Schritte in einem kalten Raum Temperatur-Schwankungen zu minimieren, die die Transformationseffizienz beeinträchtigen können.
  3. Bereiten Sie 2TY Medium. 16 g Bacto Tryptone hinzufügen Hefeextrakt 10 g und 5 g NaCl, destilliertes Wasser, 1 L, Mix und Autoklaven. Speicher Medium bei Raumtemperatur.
  4. Bereiten Sie 2TY-Agar beschichtet Bioassay Gerichte und 10 cm Petrischalen mit dem entsprechenden Antibiotikum. Platten bei 4 ° c lagern
    Hinweis: Die Wahl des Antibiotikums richtet sich nach der Art des Expressionsvektors gRNA, Einsatz 100 µg/mL Ampicillin für PgRNA-pLKO.1.
  5. Kratzen Sie aus einem Glycerin-bestand der TG1 Zellen 10 mL 2TY Medium (ohne Antibiotika) zu impfen.
  6. Inkubieren Sie Kultur bei 37 ° C über Nacht (~ 16 h) mit Schütteln bei 225 u/min.
  7. 1 L 2TY Medium (ohne Antibiotika) mit 10 mL der Übernacht-Kultur (1/100 Verdünnung) zu impfen und zwei 2 L Flaschen (mit Schikanen) gleichmäßig verteilen.
  8. Inkubieren Sie Kultur bei 37 ° C 225 u/min bis ein OD600 nm von 0,55 (nach ca. 1,5-2 h) erreicht ist. Verwenden Sie ein Spektralfotometer um OD600 nm, regelmäßig zu überprüfen.
  9. Chill-Kulturen für 30 min auf Eis.
  10. Die Kultur gleichmäßig auf vier 500 mL Zentrifuge Flaschen (Pre auf Eis gekühlt) aufgeteilt.
  11. Zentrifuge für 15 min bei 4.000 x g bei 4 ° C in einer Zentrifuge vorgekühlt.
  12. Dekantieren Sie Überstände und jeder der Zentrifuge Flaschen fügen Sie 1 Volumen (z.B. 250 mL) von vorgekühlt eiskalte sterilem destilliertem H2O hinzu. Aufschwemmen der bakteriellen Pellets von Wirbeln oder Umkehrung der Flaschenhals (oder sanfte pipettieren, falls erforderlich).
    Hinweis: Es ist einfacher, das Pellet Aufschwemmen von zunächst eine kleine Menge Wasser hinzufügen. Sicherstellen Sie, dass die Kugel schließlich vollständig Nukleinsäuretablette ist.
  13. Zentrifuge für 15 min bei 4.000 x g bei 4 ° C.
  14. Die Wäsche zwei Mal wiederholen (Schritte 9.12. und 9.13). Den Überstand zu entfernen. Seien Sie vorsichtig beim Umfüllen, da die bakterielle Pellet nach dem Waschen immer locker wird.
  15. Das Pellet in 50 mL steril, eiskalte 10 % Glycerin Aufschwemmen und überträgt es auf eine Pre-gekühlte 50 mL Zentrifugenröhrchen.
  16. Zentrifuge Zellen für 15 min bei ~ 4.000 x g bei 4 ° C. Entfernen Sie vorsichtig den überstand.
  17. Sanft Aufschwemmen der Bakterien in 2 mL eiskaltes sterile 10 % Glycerin.
  18. Halten Sie auf Eis, wenn die Zellen sofort für Elektroporation eingesetzt werden sollen.
    Hinweis: Die Zellen können in Aliquote von 50 µL in 0,5 mL Röhrchen in ein Trockeneis Ethanol Bad eingefroren und bei-80 ° C gelagert, aber dies wird nicht empfohlen.

10. die Elektroporation TG1 Electrocompetent E. Coli Zellen

Hinweis: Elektroporation ist eines der Engpässe in umfassenden Bibliothek Generation. Um die Bibliothek Darstellung zu erhalten, wird empfohlen, möglichst viele individuelle Elektroporation Reaktionen wie nötig/möglich durchzuführen und führen Sie die unten beschriebenen Schritte der Qualitätskontrolle (10.6. und 10.8.).

  1. Aliquoten gereinigten Reaktionen (aus Schritt 8,8) steril und vorgekühlt PCR tubes und halten sie auf dem Eis (1 µL pro Röhre). 1 mm Spalt Elektroporation Küvetten auf Eis abkühlen.
  2. Fügen Sie 25 µL des frisch zubereiteten TG1 Zellen ein Aliquot der DNA direkt hinzu und sofort übertragen Sie die Mischung in eine Küvette Elektroporation. Streichen Sie oder tippen Sie auf die Küvette um sicherzustellen, dass die Zellen/DNA-Mischung über die Länge der Küvette Kammer (ohne Lufteinschlüsse oder Bläschen) verteilt wird.
  3. Legen Sie die Küvette in die Folie Kammer und starten Sie das entsprechende Elektroporation-Programm (z. B. 1 Impuls von 1,8 kV (EC1)).
    Hinweis: Die Zeitkonstante sollte zwischen 5,7 und 6.0 Frau liegen, für den Fall, dass der Electroporator Bögen, streichen Sie die Küvette, sicherzustellen, dass keine Luftblasen in der Kammer und versuchen Sie es erneut.
  4. Fügen Sie 975 µL Raumtemperatur 2TY Medium sofort die Küvette hinzu.
  5. Mit einer Transferpipette, bewegen Sie die elektroporiert Bakterien, eine 50 mL-Tube. Wiederholen Sie ab Schritt 10.2. und sammeln Sie alle Zellen mit einer Bibliothek in eine 50 mL Tube transformiert.
  6. Das Gesamtvolumen zu dokumentieren.
  7. Qualitätskontrolle-Schritt
    1. Um die Kompetenz der frisch erzeugten Elektro-kompetente Zellen zu quantifizieren, führen Sie eine separate Elektroporation Reaktion mit einer definierten Menge ungeschnitten Plasmid DNA (z. B. 10 Pg pUC19 Kontrolle Plasmid). Auf einem 1,5 mL Microfuge Rohr übertragen.
      Hinweis: Die Kompetenz sollte mindestens 1010 Koloniebildenden Einheiten (KBE) pro µg DNA. Frisch zubereitete Zellen führen in der Regel besser als dieser.
  8. Inkubieren Sie transformierte Bakterien bei 37 ° C für 60 min schütteln bei 225 u/min.
  9. Qualitätskontrolle-Schritt:
    1. Platte eine definierte kleine Menge von Bakterien, die mit der Bibliothek (z. B. 10 µL einer 10-100 fache Verdünnung) auf einen 10 cm Agarplatte mit den entsprechenden Antibiotika Auswahl umgewandelt.
      Hinweis: Kenntnis der gesamten Kulturvolumen (ab Schritt 10.6.), die Anzahl der erhaltenen Kolonie lässt sich die Gesamtzahl der Kolonien für die gesamte Bibliothek zu schätzen. 20-30 fache Darstellung der Bibliothek sollte im Idealfall beibehalten werden.
  10. Verteilen Sie den Rest der Bakterien auf 2TY Agar beschichtet Bioassay Speisen mit der geeigneten Antibiotika-Auswahl.
    Hinweis: Die Lautstärke der Kultur kann durch Zentrifugation bei ~ 4.000 x g für 10 min (oder bis ein sichtbarer Pellet gebildet hat und der Überstand klar scheint) reduziert werden. Dies reduziert die Zeit, die Platten nach der Verbreitung der Kultur trocknen müssen. Verwendung von Platten statt Flüssigkultur minimiert überproportionales Wachstum der einzelnen Kolonien. 13
  11. Einem entsprechenden Volumen der pUC19 Kontrolle Elektroporation Reaktion auf eine zusätzliche 10 cm-Agar-Teller mit geeigneten Antibiotika Auswahl zu verbreiten.
  12. Inkubieren Sie Agarplatten über Nacht (16 h) bei 37 ° c
  13. Zählen Sie erhaltenen Kolonien auf den Steuerplatten (pUC19 und Kontrolle-Bibliothek-Platte), KBE/µg DNA für die Bakterien zu schätzen sowie Bibliothek Komplexität.

11. die Gewinnung von Plasmid DNA

  1. Die Übernachtung Platten 10 mL 2-TY Medien hinzu, kratzen Sie die bakterielle Schicht aus der Platte mit einem Einweg-Spreader und sammeln sie in einem 50 mL-Tube. Wiederholen Sie ein paar Mal, bis alle der Platte erscheint sauber.
  2. Extrahieren Sie DNA mit einem Plasmid Maxi-Kit (2-3 Spalten benötigt pro Bio-Assay Tafel).

Representative Results

Mit dem Protokoll zur hand, wurden CORALINA gRNA Bibliotheken aus Mensch und Maus genomische DNA-9 und BAC DNA (Abbildung 1) generiert. Um Fragmente der Eingabe DNA für Klonen in gRNA Expressionsvektoren geeignet zu produzieren, müssen optimale Bedingungen für die kontrollierte Nuklease Verdauung festgestellt werden. Ein typisches Ergebnis für die Optimierung der micrococcal Nuklease Verdauung ist in Abbildung 2Adargestellt. Unzureichende Menge an Nuklease (0,1, 2, 3, 4, 4,5 oder 5 Einheiten) produziert keine spürbare Produkte im Bereich erforderliche Größe (10-100 bp) und 5.5-7.5 Einheiten produziert noch Fragmente, die im Durchschnitt zu lang sind. Größere Mengen des Enzyms (50 Stück) führen zu einer übermäßigen Verschlechterung der Eingabe DNA nach 10 min. Infolgedessen wurde ein Zwischenbetrag (10 Stück) gewählt. Der Digest wurde skaliert, um genug erzeugen Fragmente für die anschliessende Reinigung und Klonen (Abb. 2 b) verdaut. Gele können danach für die Qualitätskontrolle der Verdauung und schneiden befleckt werden, obwohl empfohlen wird, wählen blind DNA-Fragmente durch Größe und nur auf der DNA-Leiter zur Orientierung zur Minimierung der Exposition von DNA-Fragmenten mit UV-Licht. Abbildung 2 b zeigt ein repräsentatives Beispiel für eine Seite-Gel aus der DNA Fragmente zwischen 20 und 30 bp herausgeschnitten worden haben. Gel gereinigt MNase Fragmente wurden auf 20 % geladen Seite Gel um erfolgreiche Größenauswahl und Reinigung des MNase verdaut Fragmente (Abbildung 2) zu prüfen. Das Protokoll zur hand ist kompatibel mit dem Einsatz von maßgeschneiderten Linker Sequenzen, ermöglicht die MNase verdaut Fragmente in gRNA Expressionsvektoren Wahl Klonen. GRNA PLKO9 diente hier als Rückgrat. Der Linker werden aus dem gRNA Ausdruck Vektor mit standard-PCR amplifiziert. Abb. 2D zeigt ein repräsentatives Beispiel für verstärkte Linker Sequenzen frei von zusätzlichen, falsche oder keine Vorlage Amplifikate. Als nächstes werden Linker Amplifikate verdaut mit Restriktionsenzymen um sicherzustellen, dass linker auf die MNase verdaut Fragmente in der richtigen Ausrichtung ligiert werden. Abb. 2D zeigt Agarose-Gele der 5' und 3' linker vor und nach der Verdauung mit HindIII und SacII bzw. komplette Verdauung der Linker die vorhergesagten 637 und 295 Angabe bp. Der rechten Teil des Gelbildes dokumentiert die Exzision der verdauten Linker Fragmente. Folgende gel Gewinnung von verdaute linker, der nächste Schritt des Protokolls ist die Unterbindung der Linker den Ende repariert MNase verdaut Fragmenten. Da Linker Sequenzen mittels PCR unter Verwendung unphosphorylated Zündkapseln erzeugt werden, sollte selbst Ligatur der Linker nicht auftreten. Nur die Ende repariert MNase verdaut DNA-Fragmente für Ligatur Phosphatgruppen liefern. Nach Nick Übersetzung ist die Ligatur-Produkt durch PCR verstärkt. Zur Vermeidung von übermäßigen PCR Verstärkung Voreingenommenheit, die die Darstellung der gRNA Sequenzen in der Bibliothek verzerren könnten, ist Verstärkung auf weniger als 20 Zyklen insgesamt beschränkt. Nach PCR sind die Amplifikationsprodukte schwer auf Agarose-Gele zu visualisieren. Separate Steuerung PCRs mit 32 Zyklen werden daher durchgeführt, um die Produkte zu erkennen (aber nicht für Bibliothek Vorbereitung verwendet werden). Ergebnisse aus diesem Steuerelement PCR sind in Abbildung 2Edargestellt. Dies ermöglicht die Ligatur Reaktionen zu optimieren und um sicherzustellen, dass Reaktionen frei von Artefakten, PCR, die manchmal, in "keine Fragmente Steuerelemente auftreten" (NFC). Abbildung 2E zeigt die gewünschten Amplikons (5' Linker + DNA-Fragment + 3' Linker, Länge: 869 bp) folgende Verstärkung der Ligatur Reaktionen durch äquimolaren (1:1) Verhältnisse zwischen Fragmenten und Linker Sequenzen.

Figure 1
Abbildung 1 : Zeitplan für die Vorbereitung einer gRNA Bibliothek vorgeschlagen. CORALINA bietet eine einfache und kostengünstige Strategie zur Erzeugung von umfassenden gRNA Bibliotheken aus einer Vielzahl von verschiedenen DNA-Quellen von jedem Organismus. Das Protokoll zur hand kann zum Abschluss während einer Arbeitswoche gebracht werden. Linker-Generation kann parallel mit DNA-Ende-Reparatur durchgeführt werden. Vorbereitung von Electrocompetent Bakterien dauert zwei Tage und beinhaltet einen Übernachtung Wachstum Schritt und sollte daher vor der Montage, die Reaktionen eingerichtet sind gestartet werden. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : Kritische Schritte während des Protokolls. (A) geregelten Verdauung BAC DNA-Fragmente unterschiedlicher Größe Generation ermöglicht. Hier dargestellt ist die Optimierung der MNase Verdauung. Gereinigte BAC-DNA wurde mit unterschiedlichen Mengen an MNase behandelt, für 10 min. 10 U MNase generieren DNA-Fragmente der gewünschten Länge (20-30 bp). (B) Größe Auswahl an Fragmente zwischen 20 und 30 bp mit Exzision von Polyacrylamid-Gele. Gereinigte BAC-DNA wurde mit 10 U MNase 10 min. lang behandelt. Das Bild wurde nach Exzision aufgenommen. (C) Qualitätskontrolle der Fragmente Gel gereinigt. Nach Gel-Reinigung 1/6 der gereinigten MNase Fragmente geladen wurde auf 20 % Seite Gel, erfolgreiche Größenauswahl und Reinigung zu überprüfen. (D) Verstärkung der Linker Sequenzen für Montage und Beschränkung Enzym Verdauung von linker gerichtete Klonen sicherzustellen. 5' und 3' linker wurden verstärkt und mit HindIII und SacII, bzw. geschnitten. No-Vorlagensteuerelemente (NTC) wurden aufgenommen, um Steuerung für PCR-Artefakte und DNA-Kontaminationen. Links: analytische Beispielanwendung; rechts: präparative Beispielanwendung. Bild wurde nach Gel Exzision aufgenommen. (E) erfolgreiche Unterbindung der Linker, DNA-Fragmente kann analysiert werden, mittels PCR mit einer erhöhten Anzahl von PCR-Zyklen (32) und durch keine Vorlage Kontrollen mit H2O (NTC) oder mit Hilfe den NTC aus dem vorherigen Nick Übersetzung Schritt kontrolliert als Input (NTC NT)). Es ist wichtig, eine keine Fragment-Kontrolle (NFC), die ist eine Verstärkung aus einer Ligatur und Nick Übersetzung Reaktion aus dem MNase Fragmente weggelassen wurden. Nur in welche MNase Fragmente mit Linker DNA kombiniert wurden Proben der erwarteten Amplikons produzieren (869 bp). Bitte klicken Sie hier für eine größere Version dieser Figur.

Discussion

CORALINA kann verwendet werden, um groß angelegte gRNA Bibliotheken durch kontrollierte Nuklease Verdauung der Ziel DNA zu generieren und bulk-Klonen von daraus resultierenden Doppel gestrandeten Fragmente. Statistische Inferenz zeigt, dass viele mehr als 107 individuelle gRNA Sequenzen bereits erfolgreich geklont wurden unter Verwendung des Protokolls bei Hand-9. CORALINA kann auf vielfältige Weise angepasst werden. Die Wahl der Schablone DNA definiert die Zielregion und die maximale Komplexität der generierten Bibliothek. Unter Verwendung dieses Protokolls, CORALINA Bibliotheken bisher von Menschen erzeugt wurden und die Maus genomischen DNS9. Repräsentative Ergebnisse zeigen die Generation einer CORALINA Bibliothek aus gereinigtem BAC-DNA. Weitere Anpassung kann durch die Wahl der gRNA Ausdruck Vektor und Linker Sequenzen erreicht werden. Wir haben bisher drei verschiedene Paare von Linker Längen für Gibson Montage mit kleinen Variationen in Effizienz9getestet.

Aufgrund ihrer Herkunft aus der Masse verdaut DNA Protospacer von CORALINA gRNAs sind in der Regel nicht genau 20 bp in Länge, sondern zeigen eine Längenverteilung mit einem Mittelwert, die beide hängt die Parameter der MNase Verdauung sowie die Größe der Exzision gemacht aus dem PAGE-Gel s. das repräsentative Beispiel in Abbildung 2 b und C, zeigt Fragmente mit einer mittleren Länge zwischen 19 und 27 bp. Nach unserer Erfahrung wird die Länge der Fragmente von der generierten gRNA Protospacer9treu bewahrt. Während Fragmente kürzer als 20 bp sollte vermieden werden, durch höhere Ziel-Rate von daraus resultierenden gRNAs, längere Fragmente sind wahrscheinlich viel weniger ein Problem für downstream-Anwendungen, da es wurde nachgewiesen, dass gRNAs mit Protospacers 45, solange bp sind noch funktionale9.

Die beiden wichtigsten Schritte im CORALINA Protokoll sind die Größenauswahl MNase verdaut Fragmente und Klonen Schritte. Generation von Fragmenten, die zu kurz sind (z. B. Durchschnitt unter 18 bp) oder Einbau von zu viele leere gRNA Expressionsvektoren wird die Bibliothek unbrauchbar. Daher ist es wichtig zu optimieren MNase Verdauung Schritt (Abbildung 2A), Exzision (Abb. 2 b, C) überwachen suchen komplette Verdauung gRNA Vektor Rückgrat und einschließlich keine Fragment-Kontrollen im gesamten Protokoll. Besondere Vorsicht ist auch zu ergreifen, um die Darstellung der gRNA Bibliothek zu bewahren. Ein gemeinsamer Engpass der Bibliothek-Generation ist im Allgemeinen die effiziente Übertragung der Plasmide in Bakterien für Verstärkung. So sind große Mengen von Bakterien mit hervorragenden Kompetenz und eine große Anzahl von einzelnen Elektroporation Veranstaltungen notwendig, um eine hohe Anzahl von gRNA Klone zu erreichen.

Neue Strategien für gRNA Bibliothek Produktion werden notwendig, um das volle Potenzial der CRISPR-basierten Screening Ansätze in den nächsten Jahrzehnten zu ernten. Es gibt eine erhebliche Nachfrage nach kostengünstigen, einfachen und anpassbare Methoden, um groß angelegte Bibliotheken erzeugen Voraussetzung Screening für eine größere Anzahl von Modellsystemen und CRISPR-basierten technischen Ansätze zugänglich zu machen. CORALINA bietet einen ersten Schritt in diese Richtung. Die Einsatzmöglichkeiten sind vielfältig, vor allem um umfassende Bibliotheken der Genome zu produzieren, cDNA-Bibliotheken seltener Modellsysteme, stark fokussierten Bibliotheken und Versuchsanordnungen in welche verschiedenen CRISPR-Proteine (mit unterschiedlichen PAM abgeleitet Anforderungen) werden in Kombination verwendet.

Im Gegensatz zu anderen Methoden erzeugt CORALINA alle möglichen gRNAs aus der Eingabe DNA. Ein Nachteil der Methode ist jedoch, dass gRNAs fehlt die erforderliche PAM Reihenfolge auch in der Bibliothek, ein Feature enthalten sind, die sie mit einer zweiten enzymatische Methode für gRNA Bibliothek Generation CRISPR-Essen (Tabelle 1) teilt. Die Wahl der idealen Methode für gRNA Bibliothek Generation hängt von den Vorgaben des geplanten Screenings experimentieren, vor allem die Natur (gen, intergenetischer) und die Größe der Zielregion (einzelne Locus, mehrere Regionen, genomweiten). Wir sehen ein besondere Vorteil bei der Verwendung von CORALINA wenn eine große Anzahl von nicht-kodierenden oder regulatorische Regionen sollen analysiert werden, ist unvollständig oder unzuverlässig Sequenzinformation (exotische Modellsysteme, Mischungen von Spezies (z.B. Mikrobiome) oder experimentell erhaltenen Eingang), wenn verschiedene CRISPR jedoch kombiniert werden oder Sättigung Analyse auf eine kurze und definiert (z. B. vertreten durch BACs) durchgeführt wird.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Die Autoren möchten Prof. Dr. Stephan Beck und Prof. Dr. Magdalena Götz für ihre Beiträge danken, Hilfe und Unterstützung bei der Entwicklung der CORALINA Methode, Maximilian Wiessbeck und Valentin Baumann für die hilfreichen Kommentare. Die Arbeit wurde von der DFG (STR 1385/1-1) unterstützt.

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Ein universelles Protokoll für groß angelegte gRNA Bibliothek Produktion aus jeder DNA-Quelle
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter