Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

פרוטוקול אוניברסלי עבור gRNA בקנה מידה גדול ספריית הפקה מכל מקור ה-DNA

doi: 10.3791/56264 Published: December 6, 2017

Summary

שיטות ליצירת ספריות gRNA בקנה מידה גדול צריך להיות פשוט, יעיל וחסכוני. אנו מתארים פרוטוקול לייצור של ספריות gRNA מבוסס על עיכול אנזימטי של יעד ה-DNA. שיטה זו, CORALINA (ספריית gRNA מקיף הדור באמצעות פעילות נוקלאז מבוקר) מציג אלטרנטיבה סינתזה יקר oligonucleotide מותאם אישית.

Abstract

הפופולריות של המערכת CRISPR/Cas9 הגנום והנדסה epigenome נובעת וסתגלתנות, הפשטות שלה. אפקטור (של נוקלאז Cas9 או חלבון פיוז'ן נוקלאז-מת dCas9) לאוכלוסייה אתר מסוים הגנום על ידי RNA מלאכותי קטן המכונה RNA מדריך, או gRNA. הטבע דו-צדדי של מערכת CRISPR מאפשרת להשתמש בו הקרנת גישות מאז פלסמיד ספריות קלטות ביטוי המכיל אלפי gRNAs בודדים יכול לשמש כדי לחקור אתרים שונים רבים בניסוי יחיד.

עד כה, רצפים gRNA להקמת ספריות נוצרו באופן כמעט בלעדי על ידי סינתזה oligonucleotide, אשר מגביל את המורכבות השגה של רצפי בספריה היא יחסית עלות עתירי. כאן, פרוטוקול מפורט עבור CORALINA (gRNA מקיף ספריית הדור באמצעות פעילות נוקלאז מבוקרת), פשוטה, שיטה חסכונית לדור של ספריות gRNA מורכב המבוסס על עיכול אנזימטי של קלט ה-DNA, המתוארים. מאז CORALINA ספריות יכול להיווצר מכל מקור ה-DNA, שפע של אפשרויות התאמה אישית קיים, מאפשר מגוון גדול של המסכים CRISPR מבוסס.

Introduction

ההסתגלות של מערכת CRISPR/Cas9 חיידקי ככלי מיקוד מולקולרית גרם המהפכה האחרונה בביולוגיה מולקולרית. מעולם זה היה כל כך קל לתמרן כרומטין במיקומים מוגדרים גנומית. יישומים נפוצים של CRISPR כוללים גנים יישוב מוטציות1, הגנום הנדסה2, epigenome עריכה3, הפעלת גנים ברמת השעתוק ו ג'ין להשתיק4. יתרון מסוים אחד של המערכת CRISPR היא וביישומיה אינם מוגבלים לאתרי המועמד למד היטב, כפי gRNA ספריות מאפשרים פחות משוחד מסכי. אלה להקל על גילוי לוקוסים תפקודי הגנום ללא כל ידע ניסיוני מוקדמת. עם זאת, בניית ספריה gRNA מבוסס כיום בעיקר על סינתזה oligo-נוקלאוטיד, ישנן אפשרויות מוגבלות לרכוש ספריות gRNA שאינן של האדם או אזורים המוצא או היעד העכבר מחוץ לפתוח קריאה מסגרות. לפיכך, למרות CRISPR המסכים כבר הוכיחו חזק מאוד5,6,7,8, את מלוא הפוטנציאל שלהם לא טרם נוצלה.

כדי להתגבר על המגבלה של gRNA קלאסית דור שיטות שתי אסטרטגיות לאחרונה פותחו. שניהם מבוססים על עיכול אנזימטי מבוקרת של DNA היעד במקום להסתמך על סינתזה oligonucleotide מותאם אישית. בעוד CORALINA9 מעסיקה נוקלאז micrococcal, שיטת חלופי זמין רק כעת, אוכלי CRISPR10, עושה שימוש אנזימי הגבלה (HpaII, ScrFאני, Bfaאני, גברתאני). חשוב לציין, בשתי הטכניקות ניתן ליישם דנ קלט, אשר משמש כמקור של רצפים protospacer gRNA. בעוד השיטה אוכלי CRISPR מעסיקה אסטרטגיה כדי להקטין את מספר משובטים gRNAs אשר אתרי מיקוד, לא מלוות את פאם S.pyogenes הנדרשים (מניע סמוכים protospacer), שהיא מייצרת רק חלק קטן של כל gRNAs תפקודית אפשרית עבור אזור נתון. CORALINA, מצד שני, הוא מסוגל לייצר כל פוטנציאל gRNAs את הרצף מקור, אך משלבת גם חלק גבוה יותר של מדריכים שאינם פונקציונליים. gRNA דור הספרייה באמצעות פעילות נוקלאז מבוקרת מאפשר הייצור של הספריות gRNA מקיפים של מין, כל מערכת Cas9-חלבון או - אפקטור בצורה פשוטה וחסכונית. יתר על כן, CORALINA ניתנת להתאמה התאמה אישית, כפי המתאימה אפשרויות קלט, וקטור מגדיר את ספריית סוג וגודל תוכן. . הנה, פרוטוקול מפורט מוצג זה יכול לשמש עבור הדור של הספריות gRNA מקיפים ממקורות מגוונים של דנ א (איור 1), כולל חיידקי מלאכותי כרומוזומים (BACs) או דנ א גנומי9. התוצאות נציג המלווה פרוטוקול זה נשאבו על ידי החלת פרוטוקול CORALINA BAC ה-DNA.

Protocol

1. מערכת העיכול של DNA עם נוקלאז Micrococcal

  1. בצע לתגובה אופטימיזציה עבור כל אצווה חדשה של האנזים נוקלאז micrococcal (MNase).
    הערה: מספר יחידות של MNase היה צריך להיבדק (באמצעות לדילול טורי, איור 2A). בדרך כלל, 5-10 U של MNase לעכל µg 1 של מטוהרים גנומית או BAC DNA עד טווח של 5-100 bp עם התנאים המתוארים להלן.
  2. לכל תגובה, להגדיר µL 1 של 10 x מאגר MNase, 1 x שור אלבומין (BSA), µg 1 של יעד ה-DNA, 1 µL של MNase (0.1-50 יחידות) באמצעי אחסון התגובה 10 µL.
  3. דגירה ב 37 מעלות צלזיוס למשך 15 דקות.
  4. מיד להשבית את האנזים על-ידי הוספת 1 µL של 500 מ מ אתילן גליקול-bis(β-aminoethyl ether)-N, N, N', N'-חומצה tetraacetic (EGTA).

2. הפרדה של ה-DNA קטעים באמצעות אלקטרופורזה בג'ל לזיהוי (עמוד)

  1. להוסיף מאגר מדגם/טעינת לצבוע את דגימות די אן איי ג'ל, להעמיס על 20% ג'ל דף. לטעון על סולם הדנ א המתאים עבור שינוי גודל (5 bp סולם הדנ א). אל תעמיס את הג'ל (1 µg DNA לכל טוב).
  2. הפעל ג'לים במאגר המתאים 1 x טריס-בוראט-EDTA (TBE) פועל ב-150 V (קבוע) עבור סביב 1.5 שעה או עד צבע הקדמי (bromophenol כחול כהה, צבע כחול) שעובר בסביבות 15 bp, מגיע לקצה התחתון של הג'ל.
  3. מכתים את הג'ל בעזרת כתם של חומצת גרעין לאולטרה רגישות והמחש תחת אור UV.
  4. מהתמונה ג'ל, לקבוע ריכוז אופטימלי של MNase לדנ א digesting ל 20-30 bp בגודל.
  5. להשתמש את הריכוז אופטימיזציה של MNase כדי לעכל את המטרה DNA על-ידי חזרה על צעדים 1.2-2.2. בדרך כלל, הגדרת 10-12 תגובות (כלומר 10-12 µg הכולל החל חומר) תניב מספיק מתעכל DNA בעקבות דף ג'ל החילוץ להמשיך לשלבים הבאים.
  6. באמצעות אזמל סטרילי, לחתוך את הג'ל לצד השביל סמן, כתם רק את החלק של הג'ל המכיל את הסולם עם טרי 1 x TBE פועל מאגר המכיל 1 X של כתם חומצת גרעין לאולטרה רגישות. דמיינו את סולם הדנ א, בלו שברי DNA MNase-מעוכלים בטווח גודל בין כ 18-30 bp באמצעות סכין גילוח.
    הערה: למנוע חשיפת השברים MNase מתעכל לאור UV. זה אפשרי להשתמש מקור אור כחול (במקום UV) או לקחת תמונה של הסולם מתחת UV, להדפיס אותו קנה המידה, השתמש באפשרות זו כדי להנחות כריתה של קטעי DNA מתעכל MNase). שלב זה מונע צביעת וחשיפה של קטעי DNA אור UV. תמיד להשתמש באזמל חד פעמיות שאינם בשימוש, סטרילי או גילוח בשלב זה כדי למנוע זיהום.
  7. להעביר את הפרוסה ג'ל צינור microcentrifuge.
  8. כתם השארית של הג'ל עם הכתם חומצת גרעין כמו לעיל, לחשוף לאור UV ולהקליט תמונה כדי לשמור רשומה של השלב כריתה ג'ל.

3. בידוד של דנ א שברים דף-ג'לים באמצעות למחוץ שיטת הטבילה

הערה: שלב זה כבר אומץ מ. Sambrook et al. 11

  1. להכין דף מאגר solubilization ג'ל (1.88 מ"ל של אצטט אמוניום 4 מטר, 150 µL אצטט מגנזיום 1 מ', µL 30 0.5 M חומצה ethylenediaminetetraacetic (EDTA) (pH 8) הנדסה גנטית H2O כדי הנפח הכולל של 15 מ"ל).
  2. לרסק את הפרוסה ג'ל נכרת הקיר של הצינור מיקרו-צנטריפוגה באמצעות טיפ פיפטה סטרילי.
  3. להוסיף 2 ג'ל כרכים של מאגר solubilization דף ו דגירה ב 37 מעלות צלזיוס במשך 16 h על פלטפורמה מסתובבת.
  4. Centrifuge את הדגימות עבור 1 דקות במהירות מקסימלית microcentrifuge. להעביר את תגובת שיקוע צינור microcentrifuge, לטפל בהעברת כל פיסות ג'ל כתוש.
  5. להוסיף 0.5 כרכים של דף מאגר solubilization לג'ל גלולה, מערבולת, וחזור על צנטריפוגה (שלב 3.4). לשלב את supernatants.
  6. לחלץ את שברי DNA באמצעות פנול סטנדרטי-כלורופורם החילוץ.
    התראה: פנול רעיל, אם הוא בא במגע עם העור או אם בלע. אמצעי זהירות כגון כפפות, מגן eyewear, חלוק מעבדה ועבודה בשכונה fume הם קריטיים. השלך כל פסולת המכילה פנול לפי התקנות של המכון.
    1. הוסף אמצעי אחסון אחת של אלכוהול פנול: כלורופורם: isoamyl (25:24:1) לדוגמה, מערבולת ביסודיות.
    2. צנטריפוגה 10 דקות במהירות המרבית (16,000 x g) ומפרידה שולחן בטמפרטורת החדר. להעביר בזהירות מימית השלב העליון צינור microcentrifuge טריים. הקפידו לא לשאת מעל כל פנול במהלך pipetting.
    3. חזור על שלבים 3.6.1 ו- 3.6.2 פעם אחת.
    4. להוסיף כמות קטנה (0.2 µL) של גליקוגן, 0.1 כרכים של 3 מ' סודיום אצטט (pH 5.2), 2 כרכים של 100% אתנול (EtOH).
    5. מערבולת, דגירה ב-20 מעלות צלזיוס במשך מספר שעות או למשך הלילה.
    6. צנטריפוגה למשך 30 דקות במהירות המרבית ב 4 ° C באמצעות צנטריפוגה שולחן.
    7. בזהירות להסיר את תגובת שיקוע ולשטוף בגדר DNA עם 70% EtOH.
    8. צנטריפוגה למשך 30 דקות במהירות המרבית ב 4 ° C באמצעות צנטריפוגה שולחן.
    9. הסר את תגובת שיקוע, מילה נהדרת בגדר ה-DNA. ודא כי כל EtOH התאדו אבל להיזהר לא להתייבש יתר בגדר.
    10. להמיס צניפה DNA ב 12 µL של H2O.
      הערה: דף ג'ל החילוץ הוא יעיל מאוד. עבור כל 10 µg של הקמת ה-DNA מתעכל עם MNase, מצפה להחלים 1-20 ng שברי מטוהרים לאחר החילוץ ג'ל. לשלוט כמות ותקינות של קטעים על-ידי טעינת 1/6th (2 µL) על דף ג'ל (איור 2C).

4. סוף תיקון שברי MNase-מעוכלים, מטוהרים-ג'ל

  1. להגדיר את התגובה הבאה באמצעות של DNA blunting קיט: µL 10 של ה-DNA מטוהרים מהשלב 3.6.10, µL 1.5 של 10 X blunting מאגר µL 1.5 של 1 מ מ dNTP מיקס, 0.6 µL של האנזים blunting, µL 1.4 של H2O.
  2. דגירה ב 22 מעלות צלזיוס למשך 30 דקות ולאחר מכן חום-בטל את האנזים על ידי דגירה-70 מעלות צלזיוס למשך 10 דקות.
  3. להוסיף µL 85 של H2O ולבצע את התגובה לנקות באמצעות תקן פנול/כלורופורם-חילוץ ו- EtOH-משקעים (כמתואר בסעיף 3.6). המשך מיד מקשר מצדו.

5. מקשר דור

הערה: Linkers צריך להיות מוגבר במקביל בסעיף 3 יוכלו להמשיך מיד עם מקשר מצדו. רצפים פריימר להשתמש מתחת חייב להיות מתאים וקטור ביטוי gRNA שבחרת. אלה המובאים כאן עוצבו עבור וקטור pgRNA-pLKO.1. 9 עבור הגברה של מקשר 5' של pgRNA-pLKO.1, השתמש פריימר רצפים 5'-מקשר (linker)-F (TTGGAATCACACGACCTGGA) ו- 5'-מקשר-R (CGGTGTTTCGTCCTTTCCAC), מניב אמפליקון bp 689. עבור הגברה של מקשר 3' של pgRNA-pLKO.1, השתמש תחל 3'-מקשר-f: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) 3'-מקשר-r: (ACTCGGTCATGGTAAGCTCC), אשר תשואה של אמפליקון bp 848.

  1. PCR-להגביר המתאם רצף מן הווקטור ביטוי gRNA (בעזרת ריאגנטים של בחירה, רצפים פריימר מותאם אישית, במידת הצורך). בשביל להגדיר את התגובה הבאה של ה-PCR 50 µL pgRNA-pLKO.1: 25 µL של ה-PCR מיקס מאסטר, µL 2.5 של פריימר F (10 מיקרומטר), 2.5 µL של פריימר R (10 מיקרומטר), 0.1 ng של וקטור ביטוי gRNA (pgRNA-pLKO.1) H2O.
  2. דגירה תגובות על thermocycler שימוש בתנאים הבאים: 1 מחזור 98 ° C ל 30 s, 32 מחזורי 98 ° C עבור 10 s, 59 ° C עבור 10 s, 72 ° C ל 30 s, 1 מחזור 72 מעלות צלזיוס למשך 10 דקות.
  3. לטהר תגובות PCR באמצעות מעבדתי הנייח הפיך חרוזים לפי הוראות היצרן. Elute ב- 30 µL של H2O.
  4. כדי לאכוף כיוונית מצדו של מקשר את שברי DNA תוקן קצה, MNase-מעוכלים, תקציר linkers עם אנזימי הגבלה המתאים (כאן הינדהשלישי ו שקII). להגדיר את התגובות הבאות:
    1. לעיכול של 5' מקשר עם הינדהשלישי, להשתמש µL 30 של מקשר אמפליקון מטוהרים 5' מ שלב 5.3., 5 µL של המאגר, 3 µL של היינדהשלישי (20U/µL) ו- µL 12 של H2O.
    2. לעיכול של 3' מקשר עם השקהשני, להשתמש µL 30 של מקשר אמפליקון מטוהרים 3' מ שלב 5.3., 5 µL מאגר, 3 µL של שקII (20 U/µL), ו- µL 12 של H2O.
  5. דגירה מעכל ב 37 מעלות צלזיוס במשך 3 שעות.
  6. להוסיף ג'ל DNA בטעינת צבע ולהפעיל מעכל את אנזים הגבלה על ג'ל agarose 1%. בלו הלהקות-637 bp (5' מקשר תקציר) ו- 295 bp (3' מקשר תקציר).
  7. לטהר את הדנ א של החלקים ג'ל נכרת באמצעות ערכת חילוץ ג'ל.

6. מקשר מצדו, הגברה של מוסיף

  1. להגדיר את תגובת מצדו 14 µL באמצעות כמויות equimolar של MNase-מעוכלים, תוקן קצה קטעים ורצפים מקשר.
    הערה: מקשר את הרסיס יחסי עשוי להיות מוטבת. מומלץ לכלול תגובה לא-קטע שליטה (NFC).
    1. שימוש 5 ng שברי MNase-מעוכלים (תוקן קצה וטיהרו), 120 ננוגרם של 5' מקשר (הינדהשלישי תקציר, מטוהרים), 55 ng של 3' מקשר (שקII תקציר, מטוהרים), µL 1.4 של T4 ליגאז מאגר µL 1.4 של מרוכז T4 DNA ליגאז H2O.
  2. דגירה תגובות מצדו ב 16 ° C עבור 16 h. האם לא חום-בטל את האנזים. המשך מיידית תרגום-ניק.
    הערה: שברי תוקן קצה מתעכל MNase לספק את 5' מלחי הכרחי עבור מצדו של linkers, כמו מקשר את עצמם הם לא phosphorylated.
  3. כדי מצדו התגובה (ואת התגובה NFC) להוסיף את הקוד הבא: µL 25 של Taq 2 X מיקס מאסטר (יכולת של ניק התרגום), 2.5 µL של פריימר מקשר (linker)-Minus450-F (10 מיקרומטר, GGGCAAGTTTGTGGAATTGG), µL 2.5 של פריימר מקשר (linker)-Plus275-R (10 מיקרומטר, AAGTGGATCTCTGCTGTCCC) ו 6 µL של H2O.
  4. כוללות פקד לא-תבנית (NTC). דגירה תגובות על thermocycler שימוש בתנאים הבאים: 1 מחזור (ניק תרגום): 72 מעלות צלזיוס למשך 20 דקות, מחזור 1: 95 מעלות צלזיוס למשך 5 דקות, 3-4 מחזורים: 95 ° C 15 s, 58 ° C 15 s, 72 ° C ל 30 s, מחזור 1: 72 מעלות צלזיוס במשך 5 דקות.
  5. לבצע את התגובה לנקות באמצעות מעבדתי הנייח הפיך חרוזים דוגמית חרוז יחס של 1:1. Elute ב 40 µL של H2O.
  6. להגביר עוד יותר את המקטע הרצוי (5' מקשר + MNase קטע +3' מקשר) באמצעות ריאגנטים המתאימים PCR ותחל את הבאים:
    1. השתמש µL 12.5 של מיקס מאסטר PCR, µL 1.25 של פריימר מקשר (linker)-Minus450-F (10 מיקרומטר, GGGCAAGTTTGTGGAATTGG), µL 1.25 של פריימר מקשר (linker)-Plus275-R (10 מיקרומטר, AAGTGGATCTCTGCTGTCCC), 2.5 µL של ניק מטוהרים מוצר התרגום מהשלב 6.4. 7.5 µL של H2O. להשתמש בתנאים הבאים: מחזור 1: 98 ° C ל 30 s, 10-16 מחזורים: 98 ° C עבור 10 s, 63 ° C עבור 10 s, 72 ° C 15 s, מחזור 1: 72 מעלות צלזיוס למשך 10 דקות.
      הערה: אם יש צורך, מספר תגובות באפשרותך להיות להגדיר במקביל כדי לוודא שיש מספיק מוצר ה-PCR והשלבים. כדי להמחיש כמויות קטנות של המוצר PCR על ג'ל agarose, להגדיר תגובות נוספות כמו שלב 6.5 ולהגדיל את מספר מחזור בין 15 ל- 32. התגובה הזו יכולה לשמש בקרת איכות, אם amplicons אינם גלויים לאחר 15 מחזורים. כוללים גם אין תבנית פקד (NTC).

7. בחירת גודל

הערה: שלב זה מפריד MNase-קטעים עם מחובר כראוי את 5' ו 3' מקשר בין שברי עם שני 5" או שני 3' linkers בהתאם לגודל.

  1. לשלב את כל מחזור-15 תגובות PCR מ שלב 6.5., להוסיף DNA בטעינת צבע ולהפעיל על ג'ל agarose 0.8%. לסלק את הלהקה הבולטים-869 bp ולטהר הדנ א באמצעות ערכת חילוץ ג'ל.
  2. לכמת את כמות ה-DNA (למשל באמצעות ספקטרופוטומטרים).

8. שיבוט של קטעים מוגבר-PCR לתוך gRNA הביטוי וקטור על ידי העצרת גיבסון

  1. להכין הרכבה מאסטר מיקס כדלקמן:
    הערה: השלבים הבאים הם ממאמרו של גיבסון. et al. 12.
    1. יצירת מאגר התגובה איזותרמי 6 מ על ידי שילוב של 3 מ של 1 מ' טריס (hydroxymethyl) aminomethane (טריס)-HCl pH 7.5, 300 µL של 1 מ' MgCl µL 60 של 100 מ מ deoxyguanosine טריפוספט (dGTP), µL 60 של 100 מ מ deoxyadenosine טריפוספט (dATP), µL 60 של 100 מ מ deoxythymidine טריפוספט (dTTP), µL 60 של 100 מ מ deoxycytidine טריפוספט (dCTP), µL 300 של 1 מ' dithiothreitol (DTT), 1.5 גר' פוליאתילן גליקול (PEG)-8000, µL 300 של 100 מ מ nicotinamide אדנין dinucleotide (NAD) הנדסה גנטית H2O.
      הערה: מאגר זה ניתן aliquoted ומאוחסן ב-20 ° C.
    2. ליצור מיקס מאסטר הרכבה 1.2 מ על ידי שילוב של 320 µL של 5 X תגובת איזותרמי מאגר, 3 µL של אקסונוקלאז U/µL T5 10, 20 µL של 2 U/µL DNA פולימראז, 160 µL של 40 U/µL DNA ליגאז ב הנדסה גנטית H2O. שימוש 15 µL של מיקס מאסטר הרכבה עם 5 µL של הכנס.
      הערה: תערובת הבסיס הרכבה יכול להיות aliquoted ומאוחסן ב-20 ° C, איפה זה יציב במשך יותר משנה, יכול לסבול מספר מחזורים ההקפאה-הפשרה. כמות T5 אקסונוקלאז שבחרת אידיאלי לשימוש עם המסוכך על זמן.
  2. וקטור עמוד השדרה עיכול
    הערה: ודא לעכל כמות מספקת של וקטור כקלט עבור המספר הרצוי של מכלול התגובות בשלב 8.3.
    1. לכל תגובה, להוסיף את הקוד הבא: µg 1.5 gRNA ביטוי וקטור (pgRNA-pLKO.1), µL 5 המאגר, µL 1.5 של גיל(5U/µL), µL 38.5 של H2O. Incubate לעכל ב 37 מעלות צלזיוס במשך שעתיים.
  3. Dephosphorylation של וקטור ליניארית.
    הערה: השלב זה מומלץ, אבל לא הכרחי. אקסונוקלאז T5 בתערובת מאסטר בעיקר יסיר את גילחופות סלעיות לפני Taq DNA ליגאז יש לו הזדמנות לפעול. לכן, מוגזמת מצדו מחדש של וקטור לא צפוי.
    1. להוסיף 2.5 µL של האנזים אלקליין פוספטאז שרימפס (rSAP, U 1/µL).
    2. דגירה ב 37 מעלות צלזיוס למשך 30 דקות ולאחר מכן בטל את האנזים על ידי המקננת ב 65 מעלות צלזיוס במשך 5 דקות.
  4. לבצע טיהור DNA
    הערה: מומלץ לבצע צעד החילוץ agarose ג'ל. לחלופין, ניתן להשתמש טיהור עמודה או חרוז. חשוב לבדוק כי עיכול וקטור הוא מוחלט, למשל על-ידי agarose בג'ל. לשם השוואה, וקטור מעוכל צריכה לפעול במקביל.
  5. לכמת את כמות מטוהרים וקטור מתעכל במדגם.
  6. להגדיר את מכלול עם 2-fold טוחנת עודף של מוסיף וקטוריים. לכל 20 µL התגובה שימוש 100 ננוגרם של וקטור (גילמעכל מהשלב 8.5), 12.2 ng של הכנס (מתוך שלב 7.1.), µL 15 של הרכבה מיקס מאסטר מהשלב 8.1.2. H2O.
  7. דגירה ב 50 מעלות לשעה.
  8. לטהר את התגובות באמצעות עמודות טיהור. Resuspend ה-DNA ב- 75 µL של H2O (או מתאים נפח בהתאם מידה של אלקטרופורציה).
    הערה: היעילות טרנספורמציה היא תלויה רבות DNA טוהר. שלבי טיהור נוסף (למשל מיצוי פנול/כלורופורם) עשויה לשפר את היעילות.

9. הכנת התאים e. coli TG1 אלקטרו-כשיר

  1. ודא כי כל צנטריפוגה בקבוקים, צלוחיות חופשיים חומרי ניקוי על-ידי שטיפה הבאים מתמלא מים מזוקקים לפני autoclaving.
    הערה: שלב זה מסייע בהסרת כל הטומאות העשויים להשפיע על יעילות טרנספורמציה. המים צריכים להיות מושלך מיד לפני השימוש. לחלופין, ייתכן השימוש צנטריפוגה חד פעמיות בקבוקים רצוי.
  2. ודא כי צנטריפוגה בקבוקים, צינורות ופתרונות המשמש להכנת electrocompetent תאים מקוררות על הקרח לפני השימוש. מומלץ לבצע את הפעולות הבאות בחדר קר כדי למזער את תנודות הטמפרטורה העשויים להשפיע על יעילות טרנספורמציה.
  3. להכין 2TY בינונית. כדי 16 גרם של מה נשארתי טריפטון, 10 גר' תמצית שמרים, וכ 5 גר' NaCl, להוסיף מים מזוקקים 1 ליטר, תערובת של החיטוי. חנות בינונית בטמפרטורת החדר.
  4. להכין מנות bioassay 2TY-אגר מצופה 10 ס מ פטרי המכילות אנטיביוטיקה מתאימה. חנות צלחות ב 4 º C.
    הערה: הבחירה של אנטיביוטיקה תלוי באופי של וקטור ביטוי gRNA, שימוש 100 אמפיצילין µg/mL עבור pgRNA-pLKO.1.
  5. לגרד מן מלאי גליצרול של תאים TG1 לחסן 10 מ"ל 2TY בינוני (ללא אנטיביוטיקה).
  6. דגירה תרבות ב 37 מעלות צלזיוס למשך הלילה (~ 16 h) ברעידות-225 סל ד.
  7. לחסן 1 ליטר של 2TY בינונית (ללא אנטיביוטיקה) עם 10 מ"ל של תרבות לילה (דילול 1/100), ומחלקים באופן שווה בין שתי המבחנות 2 ל' (מכיל שובל הזרימה).
  8. דגירה תרבות ב 37 מעלות צלזיוס, 225 סל ד עד nm OD600 של 0.55 (בערך אחרי h-1.5-2). להשתמש ספקטרופוטומטרים כדי לבדוק OD600 ננומטר באופן קבוע.
  9. מקררים תרבויות על קרח למשך 30 דקות.
  10. לפצל את התרבות באופן שווה בין ארבעה בקבוקים צנטריפוגה 500 מ"ל (טרום מקורר על הקרח).
  11. צנטריפוגה למשך 15 דקות ב g x 4,000 ב 4 ° C ומפרידה מראש צוננת.
  12. Decant supernatants, להוסיף נפח 1 (כלומר 250 מ ל) של טרום מקורר כקרח סטרילי מזוקקים H2O לכל אחד הבקבוקים צנטריפוגה. Resuspend בגדר חיידקים על ידי מתערבל או היפוך הבקבוק (או pipetting עדין, במידת הצורך).
    הערה: קל resuspend בגדר על-ידי הראשון הוספת נפח קטן של מים. ודא שבגדר לחלוטין resuspended בסופו של דבר.
  13. צנטריפוגה למשך 15 דקות ב g x 4,000-4 מעלות צלזיוס.
  14. חזור על לשטוף את פעמיים (צעדים 9.12. ואת 9.13). הסר את תגובת שיקוע. היה זהיר בעת decanting בגדר חיידקי הופך יותר ויותר משוחרר לאחר הרחצה.
  15. Resuspend בגדר ב 50 מ של גליצרול 10% סטרילי, קר כקרח, להעביר אותו שפופרת צנטרפוגה טרום מקורר 50 מ.
  16. צנטריפוגה תאים למשך 15 דקות ב ~ 4,000 g x-4 מעלות צלזיוס. הסר בזהירות את תגובת שיקוע.
  17. Resuspend בעדינות את החיידקים ב 2 מ"ל של גליצרול 10% סטרילי קר כקרח.
  18. לשמור על קרח אם התאים נמצאים לשמש מיד אלקטרופורציה.
    הערה: התאים יכולים להיות קפוא aliquots של µL 50 צינורות 0.5 mL באמבט קרח יבש אתנול ומאוחסנים ב-80 מעלות צלזיוס, אך זה לא מומלץ.

10. אלקטרופורציה התאים e. coli Electrocompetent TG1

הערה: אלקטרופורציה היא לאחד צווארי בקבוק בדור ספרייה מקיפה. כדי לשמר את הייצוג ספריה, מומלץ לערוך תגובות אלקטרופורציה בודדים רבים כמו הצורך/מעשית, כדי לבצע את השלבים בקרת איכות המתוארים להלן (10.6. ואת 10.8.).

  1. צינורות התגובות מטוהרים (מתוך שלב 8.8) לתוך וסטרילי, טרום מקורר PCR aliquot ולשמור אותם על קרח (1 µL למחזור). מקררים 1 מ"מ הפער אלקטרופורציה וואקום על קרח.
  2. להוסיף 25 µL של תאים TG1 הטרי ישירות אל aliquot אחת של DNA, להעביר מיד את התערובת לתוך cuvette אלקטרופורציה. קפיצי או הקש את cuvette על מנת להבטיח שהתמהיל תאים/DNA מופץ לאורכו של החדר cuvette (ללא אוויר לכוד או בועות).
  3. למקם את cuvette בבית הבליעה שקופיות, הפעלת התוכנית אלקטרופורציה המתאים (למשל 1 הדופק של 1.8 kV (EC1)).
    הערה: קבוע הזמן צריכה לשקר בין 5.7 ו- 6.0 גב' למקרה הקשתות electroporator, קפיצי את cuvette, להבטיח ישנם אין בועות אוויר בתא ולאחר מכן נסה שנית.
  4. מיד להוסיף µL 975 בטמפרטורת החדר 2TY בינוני cuvette.
  5. באמצעות פיפטה העברה, להעביר את החיידקים electroporated צינור 50 מ. חזור מ שלב 10.2. ולאסוף את כל התאים טרנספורמציה עם ספריה אחת בצינור 50 מ ל אחד.
  6. המסמך לנפח הכללי.
  7. שלב בקרת איכות
    1. כדי לכמת בדונו של תאים אלקטרו-המוסמכת טרי שנוצר, לבצע תגובה אלקטרופורציה נפרד באמצעות כמות מוגדרת של נימולים פלסמיד דנ א (למשל 10 pg pUC19 שליטה פלסמיד). להעביר את זה צינור microfuge 1.5 mL.
      הערה: כשירות צריך להיות לפחות 1010 המושבה יוצרי יחידות (cfu) µg ה-DNA. שזה עתה הוכנו תאים בדרך כלל לבצע טוב יותר.
  8. דגירה חיידקים טרנספורמציה ב 37 מעלות צלזיוס למשך 60 דקות רועדת-225 סל ד.
  9. שלב בקרת איכות:
    1. צלחת מוגדר כמות קטנה של חיידקים טרנספורמציה עם הספריה (למשל 10 µL של 10-100 עם קיפול לדילול) על צלחת אגר 10 ס מ עם הבחירה אנטיביוטי מתאים.
      הערה: בידיעה האחסון הכולל תרבות (מתוך שלב 10.6.), המספר המושבה שהושג ניתן להעריך את המספר הכולל של מושבות עבור הספריה כולה. 20-30 קיפול ייצוג הספרייה צריכה אידיאלי להישמר.
  10. לפזר את השארית של החיידקים לתוך מנות bioassay של אגר מצופה 2TY הכולל את הבחירה אנטיביוטי מתאים.
    הערה: ניתן להפחית את עוצמת הקול של התרבות על ידי צנטריפוגה ב g x ~ 4,000 10 דקות (או עד גלולה גלוי הקימה תגובת שיקוע מופיע ברור). זה מפחית את הזמן צלחות צריך להתייבש לאחר המריחה של התרבות. השימוש צלחות ולא תרבית נוזלית ממזער צמיחה מידתית של מושבות בודדות. 13
  11. להפיץ אמצעי אחסון המתאים התגובה אלקטרופורציה pUC19 שליטה על צלחת אגר 10 ס מ נוספים עם הבחירה אנטיביוטי המתאים.
  12. דגירה אגר צלחות בן לילה (16 ג) ב 37 º C.
  13. לספור מושבות שהושג על לוחות הבקרה (צלחת pUC19 ושליטה ספריה) כדי להעריך CFU/µg DNA של החיידק כמו ספריית המורכבות.

11. החילוץ של פלסמיד דנ א

  1. להוסיף 10 מ של מדיה 2-טיי הלוחות לילה, לגרד את השכבה חיידקים מהצלחת באמצעות מפזר חד פעמיות של ולאסוף אותו בצינור 50 מ. חזור על כמה פעמים עד כל צלחת נראה נקי.
  2. תמצית ה-DNA באמצעות ערכת פלסמיד מקסי (2-3 עמודות הדרושים לכל ביו-assay לוח).

Representative Results

באמצעות הפרוטוקול בהישג יד, CORALINA gRNA ספריות נוצרו האדם ואת העכבר דנ א גנומי9 BAC דנ א (איור 1). כדי לייצר שברי DNA קלט מתאים שיבוט לתוך gRNA ביטוי וקטורים, תנאים אופטימליים לעיכול נוקלאז מבוקרת צריך להיקבע. תוצאה אופיינית עבור אופטימיזציה של נוקלאז micrococcal עיכול מתוארת באיור2 א. כמות מספקת של נוקלאז (0.1, 2, 3, 4, 4.5 או 5 יחידות) מייצרת מוצרים מורגש בטווח גודל הנדרש (10-100 bp) ויחידות 5.5-7.5 עדיין מיוצר שברי כי הם בממוצע יותר מדי זמן. כמויות גדולות יותר של אנזים (50 יחידות) להוביל השפלה מוגזמת של קלט דנ א לאחר 10 דקות. כתוצאה מכך, סכום ביניים נבחר (10 יחידות). התקציר היה יורה כדי לייצר מספיק מתעכל רסיסים עוקבות וטיהור שיבוט (איור 2B). בזמן זה מומלץ כדי לבחור בצורה עיוורת שברי DNA לפי גודל להסתמך רק על הסולם DNA לאוריינטציה למזער את החשיפה של קטעי DNA אור UV, ג'לים יכול להיות מוכתם לאחר מכן לבקרת איכות של חיתוך והעיכול. איור 2B מראה דוגמה מייצגת של ג'ל דף מ- DNA אשר יש כבר חתכתם קטעים בין 20 ל 30 bp. ג'ל טהור MNase קטעים היו מועמסים על 20% ג'ל דף כדי לבדוק את גודל מוצלחת הבחירה וטיהור של קטעים MNase-מעוכלים (איור 2C). פרוטוקול בהישג יד הוא תואם השימוש רצפים מקשר מותאם אישית, המאפשר לשבט את השברים מתעכל MNase לתוך gRNA ביטוי וקטורים של הבחירה. . הנה, gRNA-PLKO9 שימש את עמוד השדרה. Linkers הם מוגבר של הווקטור ביטוי gRNA באמצעות תקן ה-PCR. איור דו-ממדי מתארת דוגמה ייצוגית של רצפי מקשר מוגבר נטול נוספים, שגוי או לא amplicons תבנית. בשלב הבא, amplicons מקשר מתעכלים עם אנזימי הגבלה על מנת להבטיח linkers מאתרים על גבי שברי מתעכל MNase לכיוון הנכון. איור דו-ממדי מראה agarose ג'לים של 5' ו 3' linkers לפני ואחרי עיכול הינדהשלישי, שקהשני בהתאמה, המציין עיכול להשלים linkers 637 החזוי, 295 bp. החלק הימני של התמונה ג'ל מסמכים הכריתה של השברים מקשר מעוכל. להלן ג'ל החילוץ של linkers מעוכל, השלב הבא בפרוטוקול מצדו של linkers כדי שברי תוקן קצה MNase-מעוכלים. כי מקשר רצפים מופקים על ידי ה-PCR באמצעות תחל unphosphorylated, מצדו עצמית של linkers לא צריך לקרות. רק שברי DNA MNase-מעוכלים תוקן קצה לספק את קבוצות פוספט הדרושות מצדו. בעקבות תרגום ניק, המוצר מצדו מוגבר על-ידי ה-PCR. כדי למנוע הטיה הגברה PCR מופרז יכול להטות את הייצוג של רצפים gRNA בספריה, הגברה מוגבל פחות מ- 20 מחזורים בסך הכל. בעקבות PCR, המוצרים הגברה הם קשה לדמיין על agarose ג'לים. שליטה נפרדת מותני עם מחזורים 32 ולכן יש לבצע כדי לזהות את המוצרים (אך לא משמשים להכנת ספריה). תוצאות של פקד זה PCR מוצגים באיור 2E. פעולה זו מאפשרת לייעל את תגובות מצדו, כדי להבטיח תגובות נטולי PCR חפצי אמנות, אשר מתרחשים לפעמים "אין פקדים שברי" (NFC). איור 2E מציגה את אמפליקון הרצוי (5' מקשר + קטע DNA + 3' לינקר, אורך: 869 bp) בעקבות הגברה של שימוש equimolar (1:1) היחס בין שברי מקשר רצפי תגובות מצדו.

Figure 1
איור 1 : הציע ציר הזמן עבור הכנת ספריה gRNA. CORALINA מציע אסטרטגיה פשוטה וחסכונית עבור הדור של הספריות gRNA מקיפים מתוך שפע של מקורות שונים DNA מכל יצור. פרוטוקול בהישג יד ניתן להביא לסיום במהלך שבוע עבודה אחד. דור מקשר יכולה להתבצע במקביל סוף ה-DNA לתקן. הכנה של חיידקים electrocompetent לוקח יומיים כולל שלב הצמיחה לילה, ולכן אמורה להתחיל לפני הרכבה תגובות מוגדרים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2 : שלבים קריטיים במהלך הפרוטוקול. עיכול (A) מבוקר BAC DNA מאפשר יצירה של שברי בגדלים שונים. המוצגת כאן היא אופטימיזציה של מערכת העיכול MNase. DNA BAC מטוהרים טופלה עם כמויות שונות של MNase במשך 10 דקות 10 U של MNase להפיק DNA שברי לאורך הרצוי (20-30 bp). (B) גודל מבחר קטעים בין 20 ל 30 bp באמצעות כריתה של ג'לים לזיהוי. DNA BAC מטוהרים טופלה עם 10 U של MNase 10 דקות. התמונה הוקלט בעקבות כריתה. (ג) בקרת איכות של קטעים ג'ל טהור. לאחר ג'ל-טיהור, 1/ו' של MNase מטוהרים שברי נטען על גבי 20% ג'ל דף כדי לבדוק את גודל מוצלחת הבחירה וטיהור. (ד) הגברה של רצפי מקשר לעיכול הרכבה, אנזים הגבלה של linkers כדי להבטיח שיבוט כיוונית. linkers 5' ו 3' היו מוגבר, לחתוך עם HindIII ו- SacII, בהתאמה. לא-התבנית פקדים (NTC) נכללו לפקד עבור חפצים PCR וזיהום ה-DNA. משמאל: יישום מדגם אנליטי; נכון: מפוח מדגם היישום. התמונה נרשם לאחר כריתה ג'ל. (E) מצדו מוצלחת של linkers כדי שברי DNA ניתן לנתח באמצעות PCR עם עלייה במספר מחזורים PCR (32), נשלט על-ידי ביצוע אין פקדים בתבנית עם H2O (NTC) או באמצעות המעבר הלאומית מן השלב הקודם של תרגום ניק קלט (NTC NT)). חשוב לכלול אין שבר פקד (NFC), אשר הוא הגברה מצדו, ניק תרגום התגובה שממנו הושמטו השברים MNase. רק דוגמאות ב MNase אילו קטעים כבר בשילוב עם מקשר DNA לייצר את אמפליקון הצפוי (869 bp). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Discussion

CORALINA יכול לשמש כדי ליצור ספריות gRNA בקנה מידה גדול על ידי עיכול נוקלאז מבוקרת של יעד ה-DNA פרירים שיבוט של קטעים נטושים כפול וכתוצאה מכך. הסקה סטטיסטית מציין כי רבים יותר מ- 107 רצפים בודדים gRNA כבר בהצלחה שיבוט באמצעות הפרוטוקול יד9. יכול להיות מותאם אישית CORALINA במספר דרכים שונות. הבחירה של תבנית ה-DNA מגדירה את אזור היעד ואת המורכבות מקסימלי של הספרייה שנוצר. באמצעות פרוטוקול זה, ספריות CORALINA בעבר נוצרו מן האדם ועכבר הדנ א9. נציג התוצאות המובאות כאן מתארים את הדור של ספרייה CORALINA מ- DNA BAC מטוהרים. התאמה אישית נוספת יכולה להיות מושגת על ידי הבחירה של רצפים וקטוריים וגם מקשר של ביטוי gRNA. קודם לכן בדקנו שלושה זוגות שונים באורכים מקשר להרכבה גיבסון עם וריאציות קטן יעילות9.

בשל מוצאם מ- DNA בצובר מתעכל, protospacer של CORALINA gRNAs הם בדרך כלל לא בדיוק 20 bp אורך, אך הצג התפלגות אורך עם ממוצע זה תלוי שניהם את הפרמטרים של עיכול MNase, כמו גם את הגודל של הכריתה עשוי הג'ל דף ס נציג בדוגמה המוצגת באיור 2B ו- C, מתאר קטעים באורך החציוני בין bp 19, 27. מניסיוננו, האורך של השברים נשמר בנאמנות על ידי שנוצר gRNA protospacer9. כל עוד קטעים קצרים יותר מאשר 20 bp להמנע בשל שיעור גבוה יותר את המטרה של gRNAs וכתוצאה מכך, קטעים ארוכים יותר סביר הרבה פחות בעיה עבור יישומים במורד הזרם, מאז עברו הפגינו את gRNAs עם protospacers ארוך כמו 45 bp נמצאים עדיין פונקציונלי9.

שני השלבים הקריטיים ביותר בפרוטוקול CORALINA הן גודל מבחר קטעים MNase-מעוכלים והשלבים שיבוט. דור של שברי כי קצרות מדי (למשל ממוצע מתחת 18 bp) או התאגדות של וקטורים ביטוי gRNA ריק מדי יעבד את ספריית חסר תועלת. לכן, חשוב למטב את הצעד עיכול MNase (איור 2 א), כדי לנטר כריתה (איור 2B, C), לבדוק לעיכול מלאה של עמוד השדרה וקטור gRNA, כולל פקדי מקטע אין לאורך כל הפרוטוקול. טיפול מיוחד יש גם לשמר את הייצוג של ספריית gRNA. באופן כללי, אחד משותף צוואר בקבוק של ספריית הדור הוא העברה יעילה של פלסמידים לתוך החיידקים עבור הגברה. לפיכך, כמויות גדולות של חיידקים עם כשירות מעולה ומספר רב של אירועים בודדים אלקטרופורציה נחוצים להשיג מספר גבוה של שיבוטים gRNA.

אסטרטגיות חדשות לייצור ספריה gRNA יהיה צורך לאסוף את מלוא הפוטנציאל של סינון שמבוסס CRISPR גישות במשך העשורים הבאים. יש ביקוש משמעותי עבור שיטות חסכוני וקל להתאמה אישית ליצור ספריות בקנה מידה גדול, מהווה דרישה מוקדמת כדי להפוך ההקרנה לבצע מספר גדול יותר של גישות שונות מבוססות-CRISPR הנדסה ומערכות מודל. CORALINA מספקת צעד ראשון לקראת זה. השימושים הפוטנציאליים הן מגוונות, במיוחד כדי לייצר ספריות מקיף של הגנום, cDNA נגזר ספריות של מערכות מודל נפוץ פחות, ספריות מאוד ממוקד ו- set-ups ניסיוני ב אילו חלבונים CRISPR שונים (עם פאם שונות דרישות) משמשים בשילוב.

בניגוד לשיטות אחרות, CORALINA יוצר כל gRNAs אפשרי של הקלט הדנ א. אולם, חסרון אחד של השיטה היא כי gRNAs חסר את רצף פאם הנדרשת נכללים גם בספריה, תכונה היא חולקת עם שיטה אנזימטי השני לדור ספריית gRNA, אוכלי CRISPR (טבלה 1). הבחירה של השיטה האידיאלית עבור הדור ספריית gRNA תלוי על המפרט של ההקרנה המתוכנן ניסוי, במיוחד את הטבע (genic, רגולציה, intergenic) והגודל של אזור היעד (לוקוס בודד, מרובות אזורים, הגנום כולו). אנו רואים יתרון מיוחד באמצעות CORALINA כאשר מספר גדול של לא קידוד או אזורים רגולטוריות נועדו להיות מנותח, אם קיים מידע רצף שלם או לא אמין (מערכות מודל אקזוטיים, תערובות של מינים (למשל microbiomes) או להשיג השפעול קלט), אם endonucleases CRISPR שונים משולבים או אם קולח ניתוח מתבצע על לוקוס קצר ומוגדר (למשל המיוצג על-ידי BACs).

Disclosures

המחברים אין לחשוף.

Acknowledgments

המחברים רוצה תודה פרופ ' ד ר סטפן בק ו פרופסור ד ר מגדלנה גץ לקבל את התשומה שלהם, לעזור ולתמוך בפיתוח השיטה CORALINA, מקסימיליאן Wiessbeck ולנטין באומן להערות מועיל. העבודה היא נתמכה על ידי DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
פרוטוקול אוניברסלי עבור gRNA בקנה מידה גדול ספריית הפקה מכל מקור ה-DNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter