Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

किसी भी डीएनए स्रोत से बड़े पैमाने पर gRNA पुस्तकालय उत्पादन के लिए एक सार्वभौमिक प्रोटोकॉल

doi: 10.3791/56264 Published: December 6, 2017

Summary

बड़े पैमाने पर gRNA पुस्तकालयों पैदा करने के लिए तरीके सरल, कुशल और लागत प्रभावी होना चाहिए । हम लक्ष्य डीएनए के एंजाइमी पाचन पर आधारित gRNA पुस्तकालयों के उत्पादन के लिए एक प्रोटोकॉल का वर्णन । इस विधि, CORALINA (नियंत्रित nuclease गतिविधि के माध्यम से व्यापक gRNA पुस्तकालय पीढ़ी) महंगा कस्टम oligonucleotide संश्लेषण के लिए एक विकल्प प्रस्तुत करता है ।

Abstract

जीनोम और epigenome इंजीनियरिंग दोनों के लिए CRISPR/Cas9 प्रणाली की लोकप्रियता अपनी सादगी और अनुकूलन क्षमता से उपजी है । एक प्रभाव (Cas9 nuclease या एक nuclease-मृत dCas9 फ्यूजन प्रोटीन) एक छोटा सा सिंथेटिक गाइड आरएनए, या gRNA के रूप में जाना जाता आरएनए द्वारा जीनोम में एक विशिष्ट साइट के लिए लक्षित है । CRISPR प्रणाली के द्विपक्षीय प्रकृति प्लाज्मिड व्यक्तिगत gRNAs के हजारों की अभिव्यक्ति कैसेट युक्त पुस्तकालयों के बाद से स्क्रीनिंग के दृष्टिकोण में इसके उपयोग में सक्षम बनाता है एक भी प्रयोग में कई विभिंन साइटों पूछताछ किया जा सकता है ।

तारीख करने के लिए, पुस्तकालयों के निर्माण के लिए gRNA दृश्यों लगभग अनंय रूप से oligonucleotide संश्लेषण, जो पुस्तकालय में अनुक्रम की प्राप्त जटिलता को सीमित करता है द्वारा उत्पंन किया गया है और अपेक्षाकृत लागत गहन है । यहाँ, CORALINA के लिए एक विस्तृत प्रोटोकॉल (नियंत्रित nuclease गतिविधि के माध्यम से व्यापक gRNA पुस्तकालय पीढ़ी), इनपुट डीएनए के एंजाइमी पाचन पर आधारित अत्यधिक जटिल gRNA पुस्तकालयों की पीढ़ी के लिए एक सरल और लागत प्रभावी विधि, वर्णित है. चूंकि CORALINA पुस्तकालयों डीएनए के किसी भी स्रोत से उत्पंन किया जा सकता है, अनुकूलन के लिए बहुत सारे विकल्प मौजूद हैं, CRISPR आधारित स्क्रीन की एक बड़ी विविधता को सक्षम करने से ।

Introduction

एक आणविक लक्ष्यीकरण उपकरण के रूप में बैक्टीरियल CRISPR/Cas9 प्रणाली के अनुकूलन आणविक जीवविज्ञान में सबसे हाल ही में क्रांति का कारण बना । पहले कभी नहीं किया गया है इतना आसान परिभाषित जीनोमिक स्थानों पर क्रोमेटिन हेरफेर करने के लिए । CRISPR के आम अनुप्रयोगों के लक्षित जीन उत्परिवर्तनों1, जीनोम इंजीनियरिंग2, epigenome संपादन3, transcriptional सक्रियण और जीन मुंह4शामिल हैं । CRISPR प्रणाली का एक विशेष लाभ यह है कि अपने आवेदन अच्छी तरह से अध्ययन उंमीदवार साइटों तक ही सीमित नहीं हैं, के रूप में gRNA पुस्तकालयों कम पक्षपातपूर्ण स्क्रीन संभव बनाते हैं । ये किसी भी पूर्व प्रयोगात्मक ज्ञान के बिना जीनोम में कार्यात्मक loci की खोज की सुविधा । हालांकि, gRNA पुस्तकालय निर्माण वर्तमान में ज्यादातर oligo-न्यूक्लियोटाइड संश्लेषण पर आधारित है, और वहाँ gRNA पुस्तकालयों है कि मानव या माउस मूल या खुले पढ़ने के फ्रेम के बाहर लक्ष्य क्षेत्रों के नहीं हैं खरीद करने के लिए सीमित विकल्प हैं । इस प्रकार, हालांकि CRISPR स्क्रीन पहले से ही अविश्वसनीय रूप से शक्तिशाली5,6,7,8साबित कर दिया है, उनकी पूरी क्षमता का अभी तक शोषण नहीं किया गया है ।

शास्त्रीय gRNA पीढ़ी के तरीकों की सीमा को दूर करने के लिए दो रणनीतियों हाल ही में विकसित किया गया है । दोनों के बजाय कस्टम oligonucleotide संश्लेषण पर निर्भर लक्ष्य डीएनए के नियंत्रित एंजाइमी पाचन पर आधारित हैं । जबकि CORALINA9 micrococcal nuclease कार्यरत है, केवल वर्तमान में उपलब्ध वैकल्पिक विधि, CRISPR-10खाने, प्रतिबंध एंजाइमों का उपयोग करता है (Hpaद्वितीय, ScrFमैं, Bfaमैं और Mmeमैं) । महत्वपूर्ण बात, दोनों तकनीकों किसी भी इनपुट डीएनए, जो gRNA protospacer दृश्यों के स्रोत के रूप में कार्य करता है के लिए लागू किया जा सकता है । जबकि CRISPR खाने की विधि एक रणनीति क्लोन gRNAs जिनकी लक्ष्यीकरण साइटों आवश्यक एस pyogenes पाम (protospacer आसंन मकसद) द्वारा पीछा नहीं कर रहे है की संख्या कम करने के लिए रोजगार, यह एक के लिए सभी संभव कार्यात्मक gRNAs का एक छोटा सा अंश उत्पंन दी निवडा. CORALINA, दूसरी ओर, के लिए स्रोत अनुक्रम के लिए सभी संभावित gRNAs उत्पंन करने में सक्षम है, लेकिन यह भी गैर के एक उच्च अंश-कार्यात्मक गाइड शामिल हैं । नियंत्रित nuclease गतिविधि के माध्यम से gRNA पुस्तकालय पीढ़ी किसी भी प्रजाति के लिए व्यापक gRNA पुस्तकालयों के उत्पादन में सक्षम बनाता है, किसी भी Cas9-प्रोटीन या-एक सरल और लागत प्रभावी तरीके से प्रभाव प्रणाली । इसके अलावा, CORALINA अनुकूलन करने के लिए अनुकूल है, के रूप में उपयुक्त इनपुट और वेक्टर विकल्प पुस्तकालय प्रकार, आकार और सामग्री को परिभाषित । यहाँ, एक विस्तृत प्रोटोकॉल प्रस्तुत किया गया है कि डीएनए के विविध स्रोतों से व्यापक gRNA पुस्तकालयों की पीढ़ी के लिए इस्तेमाल किया जा सकता है (चित्रा 1), बैक्टीरियल कृत्रिम गुणसूत्रों (BACs) या जीनोमिक डीएनए9सहित. इस प्रोटोकॉल के साथ प्रतिनिधि परिणाम बीएसी डीएनए को CORALINA प्रोटोकॉल लागू करने के द्वारा प्राप्त किए गए थे ।

Protocol

1. Micrococcal Nuclease के साथ डीएनए का पाचन

  1. micrococcal nuclease एंजाइम (MNase) के प्रत्येक नए बैच के लिए एक अनुकूलन प्रतिक्रिया करते हैं ।
    नोट: प्रयुक्त MNase की इकाइयों की संख्या का परीक्षण किया जाना चाहिए (एक धारावाहिक कमजोर पड़ने का उपयोग करना, चित्र 2a) । आमतौर पर, 5-10 यू ऑफ MNase डाइजेस्ट 1 µ जी के शुद्ध जीनोमिक या बीएसी डीएनए नीचे वर्णित शर्तों के साथ 5-100 बीपी की एक सीमा के नीचे ।
  2. प्रति प्रतिक्रिया, 10x MNase बफर के 1 µ एल सेट अप, 1x गोजातीय सीरम एल्ब्युमिन (BSA), लक्ष्य डीएनए के 1 µ जी, µ के 1 MNase एल (0.1-50 इकाइयों) में एक 10 µ l प्रतिक्रिया मात्रा.
  3. 15 मिनट के लिए ३७ ° c पर मशीन ।
  4. ५०० मिमी ईथीलीन ग्लाइकोल-बीआईएस (β-aminoethyl ईथर)-n, n, n, N'-tetraacetic एसिड (EGTA) के 1 µ एल जोड़कर तुरंत एंजाइम को निष्क्रिय ।

2. डीएनए अंशों का पृथक्करण Polyacrylamide Gel ट्रो (PAGE) का प्रयोग

  1. नमूना बफर/जेल लोड करने के लिए डीएनए नमूने और लोड एक 20% पृष्ठ जेल पर डाई जोड़ें । (5 बीपी डीएनए सीढ़ी) नौकरशाही का आकार घटाने के लिए एक उपयुक्त डीएनए सीढ़ी लोड । अधिभार नहीं जेल (1 µ जी डीएनए प्रति अच्छी तरह से) ।
  2. भागो जैल उपयुक्त 1x TRIS-बोराटे-EDTA (TBE) में १५० वी (निरंतर) पर बफ़र के आसपास १.५ ज के लिए या जब तक लोअर डाई सामने (bromophenol नीले, गहरे नीले रंग) है कि लगभग 15 बीपी पर यात्रा, जेल के निचले छोर तक पहुंचता है ।
  3. एक अति संवेदनशील न्यूक्लिक एसिड दाग का उपयोग कर जेल दाग और यूवी प्रकाश के तहत कल्पना ।
  4. जेल छवि से, डीएनए को पचाने के लिए MNase के इष्टतम एकाग्रता का निर्धारण करने के लिए नीचे आकार में 20-30 बीपी ।
  5. 1.2-2.2 कदम दोहराते हुए लक्ष्य डीएनए को पचाने के लिए MNase के अनुकूलित एकाग्रता का प्रयोग करें । आमतौर पर, 10-12 प्रतिक्रियाओं की स्थापना (यानी कुल प्रारंभिक सामग्री के 10-12 µ जी) पर्याप्त पचा डीएनए अगले चरणों के लिए आगे बढ़ने के लिए पृष्ठ जेल निष्कर्षण के बाद निकलेगा ।
  6. एक बाँझ स्केलपेल का प्रयोग, मार्कर लेन के बगल में जेल में कटौती और एक अति संवेदनशील न्यूक्लिक एसिड दाग के 1x युक्त ताजा 1x TBE चल रहे बफर के साथ सीढ़ी युक्त जेल का केवल हिस्सा दाग । एक उस्तरा ब्लेड का उपयोग लगभग 18-30 बीपी के बीच आकार सीमा में डीएनए सीढ़ी और उत्पाद शुल्क MNase पचा डीएनए टुकड़े कल्पना ।
    नोट: यूवी प्रकाश करने के लिए MNase पचा टुकड़े को उजागर करने से बचें. यह एक नीला प्रकाश स्रोत का उपयोग करने के लिए संभव है (के बजाय यूवी) या यूवी के तहत सीढ़ी की एक छवि ले, यह पैमाने के लिए प्रिंट और MNase पचा डीएनए टुकड़े के उत्पाद शुल्क का मार्गदर्शन करने के लिए इस का उपयोग करें). इस कदम के धुंधला और यूवी प्रकाश को डीएनए टुकड़े के जोखिम से बचा जाता है । हमेशा संक्रमण से बचने के लिए इस कदम के लिए एक अप्रयुक्त, बाँझ डिस्पोजेबल स्केलपेल या उस्तरा ब्लेड का उपयोग करें ।
  7. एक microcentrifuge ट्यूब के लिए जेल टुकड़ा स्थानांतरण ।
  8. न्यूक्लिक एसिड के साथ जेल के शेष दाग ऊपर के रूप में दाग, यूवी प्रकाश को बेनकाब और एक छवि रिकॉर्ड जेल उत्पाद शुल्क कदम का एक रिकॉर्ड रखने के लिए ।

3. क्रश और सोख विधि का उपयोग कर पेज-जैल से डीएनए टुकड़े का अलगाव

नोट: यह कदम Sambrook एट अल से अपनाया गया है । 11

  1. पृष्ठ जेल solubilization बफर तैयार (१.८८ मिलीलीटर की 4 एम अमोनियम एसीटेट, १५० µ एल के 1 एम मैग्नीशियम एसीटेट, 30 µ एल के ०.५ मीटर ethylenediaminetetraacetic एसिड (EDTA) (pH 8) में ultrapure H2O में कुल मात्रा 15 मिलीलीटर) ।
  2. एक बाँझ पिपेट टिप का उपयोग माइक्रो-केंद्रापसारक ट्यूब की दीवार के खिलाफ एक्साइज जेल टुकड़ा क्रश ।
  3. पृष्ठ solubilization बफर के 2 जेल संस्करणों जोड़ें और ३७ डिग्री सेल्सियस पर एक घूर्णन मंच पर 16 घंटे के लिए मशीन ।
  4. एक microcentrifuge में अधिकतम गति से 1 मिनट के लिए नमूने केंद्रापसारक । किसी भी कुचल जेल टुकड़े हस्तांतरण करने के लिए ध्यान नहीं ले, एक नया microcentrifuge ट्यूब करने के लिए supernatant स्थानांतरण ।
  5. जेल गोली, भंवर, और दोहराने के लिए पृष्ठ solubilization बफर के ०.५ संस्करणों जोड़ें (३.४ कदम) । supernatants का मिश्रण ।
  6. मानक phenol-क्लोरोफॉर्म निष्कर्षण का उपयोग डीएनए अंशों निकालें ।
    चेतावनी: Phenol विषाक्त है अगर यह त्वचा के साथ संपर्क में आता है या अगर निगल लिया । दस्ताने, सुरक्षात्मक eyewear, एक प्रयोगशाला कोट के रूप में सुरक्षा सावधानियों, और एक धुएं डाकू में काम कर रहे है महत्वपूर्ण हैं । संस्थान के विनियमों के अनुसार सभी phenol-युक्त अपशिष्ट का निपटान ।
    1. phenol का एक खंड जोड़ें: क्लोरोफॉर्म: isoamyl शराब (25:24:1) नमूने और भंवर के लिए अच्छी तरह से ।
    2. अधिकतम गति पर 10 मिनट के लिए केंद्रापसारक (१६,००० x g) कमरे के तापमान पर एक तालिका के ऊपर केंद्रापसारक में । ध्यान से एक ताजा microcentrifuge ट्यूब के लिए ऊपरी जलीय चरण हस्तांतरण । ध्यान रखना नहीं pipetting के दौरान किसी भी phenol पर ले जाने के लिए ।
    3. चरण 3.6.1 और 3.6.2 एक बार दोहराएं ।
    4. ग्लाइकोजन की एक छोटी राशि (०.२ µ एल), 3 एम सोडियम एसीटेट के ०.१ संस्करणों (पीएच ५.२) और १००% इथेनॉल (ेतोः) के 2 संस्करणों में जोड़ें ।
    5. भंवर और कई घंटे या रात भर के लिए-20 डिग्री सेल्सियस पर गर्मी ।
    6. 4 डिग्री सेल्सियस पर अधिकतम गति से 30 मिनट के लिए केंद्रापसारक एक तालिका का उपयोग करना ।
    7. ध्यान से supernatant निकालें और ७०% ेतोः के साथ डीएनए गोली धो लो ।
    8. 4 डिग्री सेल्सियस पर अधिकतम गति से 30 मिनट के लिए केंद्रापसारक एक तालिका का उपयोग करना ।
    9. supernatant और हवा सूखी डीएनए गोली निकालें । सुनिश्चित करें कि सभी ेतोः सुखाया है, लेकिन सावधान नहीं हो पर-गोली सूखी ।
    10. 12 µ एल के एच2ओ में डीएनए गोली को भंग ।
      नोट: पृष्ठ जेल निष्कर्षण बहुत अक्षम है । MNase के साथ पचा डीएनए शुरू करने के हर 10 µ जी के लिए, जेल निष्कर्षण के बाद शुद्ध टुकड़े के 1-20 एनजी ठीक करने की उम्मीद. 1/6th (2 µ l) को लोड करके एक पृष्ठ जेल (चित्रा 2c) पर नियंत्रण राशि और टुकड़े की अखंडता ।

4. MNase के अंत मरंमत-पचा, जेल-शुद्ध टुकड़े

  1. एक डीएनए कुंद किट का उपयोग कर निंनलिखित प्रतिक्रिया सेट करें: चरण 3.6.10 से शुद्ध डीएनए के 10 µ l, १.५ µ एल की 10x कुंदिंग बफर, १.५ µ एल के 1 मिमी dNTP मिश्रण, ०.६ µ एल के कुंद एंजाइम, १.४ µ एल के एच2ओ.
  2. 30 मिनट के लिए 22 डिग्री सेल्सियस पर मशीन, और फिर गर्मी-७० डिग्री सेल्सियस पर 10 मिनट के लिए मशीन द्वारा एंजाइम निष्क्रिय ।
  3. जोड़ें ८५ µ एल एच2O और एक प्रतिक्रिया को क्लीन-अप का उपयोग कर मानक phenol/क्लोरोफॉर्म-निष्कर्षण और ेतोः-वर्षण (के रूप में खंड ३.६ में वर्णित) । लिंकर बंधाव करने के लिए तुरंत आगे बढ़ें ।

5. linker जनरेशन

नोट: linkers धारा 3 के साथ समानांतर में परिवर्धित करने के लिए लिंकर बंधाव के साथ तुरंत आगे बढ़ने में सक्षम होना चाहिए । प्राइमर अनुक्रम नीचे इस्तेमाल चुना gRNA अभिव्यक्ति वेक्टर के लिए उपयुक्त होना चाहिए । उन यहां प्रस्तुत वेक्टर pgRNA-pLKO .1 के लिए डिजाइन किया गया है । 9 pgRNA से 5 ' linker के प्रवर्धन के लिए-pLKO .1, प्राइमरी जुगाड़ 5 '-linker-F (TTGGAATCACACGACCTGGA) और 5 '-linker-R (CGGTGTTTCGTCCTTTCCAC) का उपयोग, एक ६८९ बीपी amplicon उपज । pgRNA-pLKO .1 से 3 ' लिंकर के प्रवर्धन के लिए, ' 3 प्राइमरों-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) और 3 '-linker-R: (ACTCGGTCATGGTAAGCTCC), जो एक ८४८ बीपी amplicon उपज का उपयोग करें ।

  1. पीसीआर-gRNA अभिव्यक्ति वेक्टर से एडाप्टर अनुक्रम बढ़ाना (पसंद और कस्टम प्राइमरी दृश्यों के रिएजेंट का उपयोग कर, यदि आवश्यक हो) । pgRNA के लिए-pLKO .1 सेट अप निम्नलिखित ५० µ l पीसीआर प्रतिक्रिया: पीसीआर मास्टर मिक्स के 25 µ एल, प्राइमरी एफ के २.५ µ एल (10 µ मीटर), प्राइमरी आर के २.५ µ एल (10 µ मीटर), ०.१ gRNA अभिव्यक्ति वेक्टर के एनजी (pgRNA-pLKO .1) में एच2ओ ।
  2. निंनलिखित शर्तों का उपयोग कर एक thermocycler पर मशीन प्रतिक्रियाओं: 1 चक्र ९८ ° c 30 s, ३२ चक्र के लिए ९८ ° c 10 एस के लिए, ५९ ° c के लिए 10 s, ७२ ° c 30 s के लिए, 1 चक्र ७२ ° c 10 मिनट के लिए.
  3. निर्माता के निर्देशों के अनुसार ठोस चरण प्रतिवर्ती स्थिरीकरण मोतियों का उपयोग कर पीसीआर प्रतिक्रियाओं को शुद्ध । Elute के 30 µ l म H2हे ।
  4. अंत करने के लिए लिंकर के दिशात्मक बंधाव को लागू करने के लिए मरंमत, MNase-पचा डीएनए टुकड़े, उपयुक्त प्रतिबंध एंजाइमों के साथ (यहां हिंदIII और सैकद्वितीय) डाइजेस्ट लिंकर्स । निंन प्रतिक्रियाओं को सेट करें:
    1. हिंदIII के साथ 5 ' linker के पाचन के लिए, का प्रयोग 30 µ l की शुद्धि 5 ' linker amplicon से चरण ५.३., 5 µ l के बफर, 3 µ l के हिंदIII (20U/µ l), और 12 µ l के H2हे.
    2. सैकद्वितीय के साथ 3 ' लिंकर के पाचन के लिए, का उपयोग 30 µ l ' शुद्ध 3 ' linker amplicon से चरण ५.३., 5 µ l के बफर, 3 µ l के सैकII (20 यू/µ l), और 12 µ l के H2हे.
  5. 3 एच के लिए ३७ डिग्री सेल्सियस पर पचाने वाली मशीन ।
  6. डीएनए जेल लोड हो रहा है डाई जोड़ें और एक 1% agarose जेल पर प्रतिबंध एंजाइम पचा चला । ६३७ बीपी (5 ' linker डाइजेस्ट) और २९५ बीपी (3 ' लिंकर डाइजेस्ट) पर बैंड एक्साइज ।
  7. जेल निष्कर्षण किट का उपयोग करके एक्साइज जेल के टुकड़ों से डीएनए को शुद्ध कर लें ।

6. linker बंधाव और प्रवर्धन का सम्मिलन

  1. MNase के equimolar मात्रा का उपयोग कर एक 14 µ एल बंधाव प्रतिक्रिया सेट-पच, अंत मरंमत टुकड़े और linker अनुक्रम ।
    नोट: टुकड़ा अनुपात के लिए लिंक अनुकूलित किया जा सकता है । यह कोई-टुकड़ा नियंत्रण (NFC) प्रतिक्रिया को शामिल करने के लिए अनुशंसित है ।
    1. का प्रयोग करें 5 MNase के एनजी-पचा टुकड़े (अंत की मरंमत और शुद्ध), १२० एनजी के 5 ' लिंकर (हिंदIII डाइजेस्ट, शुद्ध), 3 ' लिंकर के ५५ एनजी (सैकद्वितीय डाइजेस्ट, शुद्ध), टी-4 ligase बफर के १.४ µ एल, और १.४ µ एल टी-4 डीएनए ligase में एच2ओ का l
  2. 16 एच के लिए 16 डिग्री सेल्सियस पर बंधाव प्रतिक्रियाओं मशीन । गर्मी नहीं है, एंजाइम निष्क्रिय । तुरंत निक-अनुवाद करने के लिए आगे बढ़ें ।
    नोट: अंत में मरंमत MNase-पचा टुकड़े 5 ' के लिंकर्स के बंधाव के लिए आवश्यक फॉस्फेट प्रदान करते हैं, के रूप में लिंक खुद संयुक्त राष्ट्र के phosphorylated हैं ।
  3. बंधाव प्रतिक्रिया करने के लिए (और एनएफसी प्रतिक्रिया) निम्न जोड़ें: Taq 2x मास्टर मिश्रण के 25 µ एल (निक अनुवाद करने में सक्षम), प्राइमरी लिंकर के २.५ µ एल-Minus450-एफ (10 µ एम, GGGCAAGTTTGTGGAATTGG), प्राइमरी केटेगरी के २.५ µ एल-Plus275-आर (10 µ एम, AAGTGGATCTCTGCTGTCCC) और 6 µ l के एचओ.
  4. कोई टेंपलेट नियंत्रण (एनटीसी) शामिल हैं । निम्नलिखित स्थितियों का उपयोग कर एक thermocycler पर मशीन प्रतिक्रियाओं: 1 चक्र (निक अनुवाद): ७२ ° c के लिए 20 मिनट, 1 चक्र: ९५ ° c के लिए 5 मिनट, 3-4 चक्र: ९५ ° c के लिए 15 एस, ५८ ° c के लिए 15 s, ७२ ° c 30 s, 1 चक्र के लिए: ७२ ° c for 5 min.
  5. एक प्रतिक्रिया 1:1 के अनुपात मनका करने के लिए एक नमूना के साथ ठोस चरण प्रतिवर्ती स्थिरीकरण मोतियों का उपयोग करते हुए सफाई करते हैं । Elute में ४० µ l के H2हे.
  6. इसके अलावा वांछित टुकड़ा बढ़ाना (5 ' linker + MNase टुकड़ा + 3 ' लिंकर) उपयुक्त पीसीआर रिएजेंट और निंनलिखित प्राइमरों का उपयोग:
    1. पीसीआर मास्टर मिक्स का १२.५ µ l का उपयोग करें, १.२५-प्राइमरी लिंकर के µ एल-Minus450-एफ (10 µ एम, GGGCAAGTTTGTGGAATTGG), प्राइमरी लिंकर के १.२५ µ एल-Plus275-आर (10 µ एम, AAGTGGATCTCTGCTGTCCC), २.५ µ शुद्ध निक अनुवाद उत्पाद के एल से कदम ६.४ । और ७.५ µ l के ज2O. निंन स्थितियों का उपयोग करें: 1 चक्र: ९८ ° c 30 एस, 10-16 चक्र के लिए: ९८ ° c 10 एस के लिए, ६३ डिग्री सेल्सियस के लिए 10 s, ७२ डिग्री सेल्सियस के लिए 15 s, 1 साइकिल: के लिए ७२ ° c 10 min.
      नोट: यदि आवश्यक हो, कई प्रतिक्रियाओं समानांतर में स्थापित किया जा सकता है सुनिश्चित करने के लिए पर्याप्त बाद में कदम के लिए पीसीआर उत्पाद है । एक agarose जेल पर पीसीआर उत्पाद की छोटी मात्रा कल्पना करने के लिए, चरण ६.५ में के रूप में अतिरिक्त प्रतिक्रियाओं की स्थापना की और 15 से ३२ चक्र संख्या में वृद्धि । यह प्रतिक्रिया गुणवत्ता नियंत्रण के रूप में इस्तेमाल किया जा सकता है, अगर amplicons 15 चक्र के बाद दिखाई नहीं दे रहे हैं । भी कोई टेंपलेट नियंत्रण (एनटीसी) शामिल हैं ।

7. आकार चयन

नोट: यह चरण MNase-अंशों को सही से अनुलग्न 5 ' और 3 ' linker के साथ टुकड़ों से अलग करता है जो आकार के आधार पर दो 5 ' या दो 3 ' linkers के साथ होता है ।

  1. सभी 15-चक्र पीसीआर प्रतिक्रियाओं ६.५ कदम से जुडा है, डीएनए लोड हो रहा है डाई जोड़ने और एक ०.८% agarose जेल पर चलाते हैं । ८६९ बीपी पर प्रमुख बैंड एक्साइज और एक जेल निष्कर्षण किट का उपयोग कर डीएनए शुद्ध ।
  2. डीएनए की मात्रा को बढ़ाता है (उदा spectrophotometer का उपयोग करना) ।

8. पीसीआर के क्लोनिंग gRNA अभिव्यक्ति वेक्टर में गिब्सन विधानसभा द्वारा परिवर्धित टुकड़े

  1. इस प्रकार के रूप में असेंबली मास्टर मिक्स तैयार:
    नोट: निंनलिखित कदम गिब्सन एट अल से अनुकूलित कर रहे हैं । 12.
    1. 1 एम Tris (hydroxymethyl) aminomethane (Tris) के 3 मिलीलीटर के संयोजन से 6 मिलीलीटर इज़ोटेर्माल प्रतिक्रिया बफर बनाएँ-एचसीएल पीएच ७.५, ३०० µ l के 1 M MgCl, ६० µ l के १०० mm deoxyguanosine ट्राइफॉस्फेट (dGTP), ६० µ l के १०० mm deoxyadenosine ट्राइफॉस्फेट (dATP), ६० µ l के १०० mm deoxythymidine ट्राइफॉस्फेट (dTTP), ६० µ l के १०० मिमी deoxycytidine ट्राइफॉस्फेट (dCTP), ३०० µ एल के 1 एम dithiothreitol (डीटीटी), १.५ ग्राम पॉलीथीन के ग्लाइकोल (खूंटी)-८०००, ३०० µ एल के १०० मिमी nicotinamide adenine dinucleotide (णड) में ultrapure एच2ओ.
      नोट: इस बफर aliquoted और-20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है ।
    2. १.२ एमएल विधानसभा मास्टर मिक्स के संयोजन के द्वारा बनाएं 5x इज़ोटेर्माल प्रतिक्रिया बफर के ३२० µ एल, 3 µ l के 10 u/µ l T5 exonuclease, 20 µ l के 2 u/µ l डीएनए पोलीमरेज़, १६० µ l के ४० u/µ l dna ligase in ultrapure H2O. का उपयोग 15 µ l के 5 µ l के साथ असेंबली मास्टर मिश्रण का संमिलित.
      नोट: विधानसभा मास्टर मिश्रण aliquoted और में संग्रहित किया जा सकता है-20 ° c, जहां यह एक वर्ष से अधिक के लिए स्थिर है और कई फ्रीज-गल चक्र को सहन कर सकते हैं । T5 exonuclease की चुनी हुई राशि लंबे समय से लटकी के साथ उपयोग के लिए आदर्श है ।
  2. वेक्टर रीढ़ पाचन
    नोट: चरण ८.३ में असेंबली प्रतिक्रियाओं की इच्छित संख्या के लिए इनपुट के रूप में वेक्टर की पर्याप्त मात्रा को पचाने के लिए सुनिश्चित करें ।
    1. प्रति प्रतिक्रिया, निम्न जोड़ें: १.५ µ जी की gRNA अभिव्यक्ति वेक्टर (pgRNA-pLKO .1), 5 µ एल ऑफ बफर, १.५ µ एल ऑफ एजI (5U/µ एल), और ३८.५ µ एल ऑफ एच2ओ. के लिए ३७ डिग्री सेल्सियस पर 2 एच.
  3. Dephosphorylation के रैखिक सदिश ।
    नोट: इस कदम की सलाह दी जाती है, लेकिन सख्ती जरूरी नहीं । मास्टर मिक्स में T5 exonuclease ज्यादातर उम्रनिकाल देंगे मैं Taq डीएनए ligase से पहले ही भांप लिया है एक को अभिनय का मौका मिला है । इसलिए, अत्यधिक re-बंधाव वेक्टर की अपेक्षा नहीं है ।
    1. जोड़ें २.५ चिंराट alkaline फॉस्फेट एंजाइम के µ एल (रसप, 1 U/µ एल) ।
    2. 30 मिनट के लिए ३७ डिग्री सेल्सियस पर मशीन, और फिर 5 मिनट के लिए ६५ डिग्री सेल्सियस पर मशीन द्वारा एंजाइम निष्क्रिय ।
  4. डीएनए शुद्धिकरण करें
    नोट: यह एक agarose जेल निष्कर्षण कदम करने के लिए सिफारिश की है । वैकल्पिक रूप से, कॉलम-या मनका शोधन किया जा सकता है । यह जांच करने के लिए महत्वपूर्ण है कि वेक्टर पाचन पूरा हो गया है, agarose जेल ट्रो द्वारा उदा । तुलना के लिए, अपच वेक्टर समानांतर में चलाया जाना चाहिए ।
  5. नमूने में शुद्ध पचा वेक्टर की मात्रा बढ़ाता है ।
  6. 2-गुना दाढ़ के साथ विधानसभा सेट करने के लिए वेक्टर आवेषण के अतिरिक्त । प्रति 20 µ l reaction उपयोग १०० वेक्टर के एनजी (आयुमैं पचा चरण ८.५ से), १२.२ डालने के एनजी (७.१ कदम से.), 15 µ चरण 8.1.2 से विधानसभा मास्टर मिक्स के एल । में एच2ओ.
  7. 1 एच के लिए ५० ° c पर मशीन ।
  8. स्तंभ शुद्धि का उपयोग कर प्रतिक्रियाओं को शुद्ध । (या उचित मात्रा electroporation के पैमाने पर निर्भर करता है) एच2O के ७५ µ एल में डीएनए reसस्पेंड ।
    नोट: परिवर्तन दक्षता बहुत डीएनए शुद्धता पर निर्भर है । अतिरिक्त शुद्धिकरण चरण (उदा. phenol/क्लोरोफॉर्म निष्कर्षण) दक्षता में सुधार हो सकता है ।

9. इलेक्ट्रो-सक्षम TG1 ई. कोलाई कोशिकाओं की तैयारी

  1. सुनिश्चित करें कि सभी केंद्रापसारक बोतलें और कुप्पी धोने और बाद autoclaving से पहले आसुत पानी के साथ भरने के द्वारा डिटर्जेंट से मुक्त कर रहे हैं ।
    नोट: यह चरण परिवर्तन दक्षता को प्रभावित कर सकते हैं जो किसी भी अशुद्धियों को निकालने के लिए मदद करता है. पानी का उपयोग करने से पहले तुरंत छोड़ देना चाहिए । वैकल्पिक रूप से, प्रयोज्य केंद्रापसारक बोतलों का उपयोग उचित हो सकता है ।
  2. सुनिश्चित करें कि केंद्रापसारक बोतलें, ट्यूबों और समाधान electrocompetent कोशिकाओं की तैयारी के लिए इस्तेमाल करने से पहले बर्फ पर ठंडा कर रहे हैं । यह सबसे अच्छा है एक ठंडे कमरे में निम्न चरणों का संचालन करने के लिए तापमान उतार चढ़ाव जो परिवर्तन दक्षता को प्रभावित कर सकते हैं कम करने के लिए.
  3. 2TY माध्यम तैयार करें । bacto tryptone के 16 जी, खमीर निकालने के 10 ग्राम, और NaCl के 5 ग्राम, 1 एल, मिश्रण और आटोक्लेव के लिए आसुत जल जोड़ें । कमरे के तापमान पर मध्यम स्टोर ।
  4. तैयार 2TY-आगार परख बर्तन लेपित और 10 सेमी पेट्री उपयुक्त एंटीबायोटिक युक्त व्यंजन । 4 डिग्री सेल्सियस पर प्लेट्स स्टोर ।
    नोट: एंटीबायोटिक का चुनाव gRNA अभिव्यक्ति वेक्टर की प्रकृति पर निर्भर करता है, pgRNA-pLKO .1 के लिए १०० µ g/mL एम्पीसिलीन का उपयोग करें ।
  5. TG1 कोशिकाओं के एक ग्लिसरॉल स्टॉक से स्क्रैप 2TY मध्यम (एंटीबायोटिक दवाओं के बिना) के 10 मिलीलीटर लगाना करने के लिए ।
  6. ३७ डिग्री सेल्सियस पर रात भर संस्कृति (~ 16 एच) २२५ rpm पर मिलाते के साथ ।
  7. लगाना 1 एल 2TY मध्यम (एंटीबायोटिक दवाओं के बिना) रातोंरात संस्कृति के 10 मिलीलीटर (1/100 कमजोर पड़ने) के साथ और यह दो 2 एल कुप्पी के बीच समान रूप से विभाजित (चकरा) युक्त ।
  8. ३७ ° c, २२५ rpm पर संस्कृति की एक OD600 एनएम ०.५५ तक की मशीन (लगभग १.५-2 घंटे के बाद) तक पहुंच गया है । नियमित रूप से OD600 एनएम की जांच करने के लिए एक spectrophotometer का प्रयोग करें ।
  9. बर्फ पर चिल संस्कृतियों के लिए 30 मिनट ।
  10. ४ ५०० मिलीलीटर केंद्रापसारक बोतलों के बीच समान रूप से संस्कृति भाजित (बर्फ पर पूर्व ठंडा) ।
  11. ४,००० x g पर 15 मिनट के लिए एक पूर्व ठंडा केंद्रापसारक में 4 डिग्री सेल्सियस पर के लिए केंद्रापसारक ।
  12. खिचड़ी भाषा supernatants और 1 मात्रा जोड़ें (यानी २५० एमएल) पूर्व ठंडा बर्फ ठंडा बाँझ आसुत एच2हे के केंद्रापसारक बोतलों में से प्रत्येक के लिए । घूमता या बोतल पलटने से बैक्टीरियल गोली reसस्पेंड (या कोमल pipetting द्वारा, यदि आवश्यक हो) ।
    नोट: यह सबसे पहले पानी की एक छोटी मात्रा जोड़ने के द्वारा गोली reसस्पेंड करने के लिए आसान है । सुनिश्चित करें कि गोली पूरी तरह से अंततः reसस्पैंड है ।
  13. 4 डिग्री सेल्सियस पर ४,००० x g पर 15 मिनट के लिए केंद्रापसारक ।
  14. धो दो बार दोहराएं (चरण ९.१२. and ९.१३) । supernatant निकालें । सावधान रहना जब बैक्टीरियल गोली के रूप में खिचड़ी भाषा धोने के बाद तेजी से ढीला हो जाता है ।
  15. बाँझ, बर्फ ठंड 10% ग्लिसरॉल के ५० मिलीलीटर में गोली reसस्पेंड और यह एक पूर्व ठंडा ५० एमएल केंद्रापसारक ट्यूब करने के लिए स्थानांतरण ।
  16. 15 मिनट के लिए 4 डिग्री सेल्सियस पर ~ ४,००० x g पर कोशिकाओं के केंद्रापसारक । supernatant को सावधानीपूर्वक निकालें ।
  17. धीरे बर्फ के 2 मिलीलीटर ठंड बाँझ 10% ग्लिसरॉल में बैक्टीरिया reसस्पेंड ।
  18. बर्फ पर रखें अगर कोशिकाओं को electroporation के लिए तुरंत इस्तेमाल किया जा रहे हैं ।
    नोट: कोशिकाओं को एक सूखी बर्फ इथेनॉल स्नान में ०.५ मिलीलीटर ट्यूबों में ५० µ एल के aliquots में जमे हुए किया जा सकता है और पर संग्रहित-८० ° c, लेकिन यह अनुशंसित नहीं है ।

10. TG1 Electrocompetent ई. कोलाई कोशिकाओं के Electroporation

नोट: Electroporation व्यापक पुस्तकालय पीढ़ी में अड़चनों में से एक है । पुस्तकालय प्रतिनिधित्व को संरक्षित करने के लिए, यह आवश्यक के रूप में कई व्यक्तिगत electroporation प्रतिक्रियाओं के रूप में आचरण करने के लिए और (१०.६. और १०.८.) नीचे वर्णित गुणवत्ता नियंत्रण चरणों का पालन करने के लिए सिफारिश की है ।

  1. Aliquot (कदम ८.८ से) बाँझ और पूर्व ठंडा पीसीआर ट्यूबों में और उन्हें बर्फ पर रखने के लिए (1 µ एल प्रति ट्यूब) शुद्ध प्रतिक्रियाओं को दूर करता है । चिल 1 मिमी गैप बर्फ पर electroporation cuvettes ।
  2. डीएनए के एक aliquot के लिए हौसले से तैयार TG1 कोशिकाओं के 25 µ एल जोड़ें और तुरंत एक electroporation cuvette में मिश्रण हस्तांतरण । cuvette कक्ष/डीएनए मिश्रण cuvette चैंबर की लंबाई (किसी भी फंस हवा या बुलबुले के बिना) के साथ वितरित किया जाता है सुनिश्चित करने के लिए झटका या नल ।
  3. cuvette को स्लाइड चैम्बर में रखें और उपयुक्त electroporation प्रोग्राम (जैसे १.८ केवी (EC1) की 1 पल्स) प्रारंभ करें ।
    नोट: समय लगातार ५.७ और ६.० के बीच झूठ बोलना चाहिए ms. मामले में electroporator आर्क्स, cuvette झटका, यह सुनिश्चित करने के चैंबर में कोई हवाई बुलबुले रहे है और फिर से प्रयास करें ।
  4. तुरंत cuvette करने के लिए कमरे के तापमान 2TY माध्यम के ९७५ µ एल जोड़ें ।
  5. एक स्थानांतरण पिपेट का उपयोग करना, electroporated बैक्टीरिया एक ५० मिलीलीटर ट्यूब के लिए कदम । चरण १०.२ से दोहराएँ । और १ ५० मिलीलीटर ट्यूब में एक पुस्तकालय के साथ बदल सभी कोशिकाओं को इकट्ठा ।
  6. कुल वॉल्यूम का दस्तावेज़ ।
  7. गुणवत्ता नियंत्रण कदम
    1. के लिए हौसले से उत्पंन इलेक्ट्रो सक्षम कोशिकाओं की क्षमता यों तो, एक अलग electroporation बिना खतना प्लाज्मिड डीएनए (उदा 10 स्नातकोत्तर pUC19 नियंत्रण प्लाज्मिड) की एक परिभाषित मात्रा का उपयोग कर प्रतिक्रिया करते हैं । यह एक १.५ मिलीलीटर microfuge ट्यूब करने के लिए स्थानांतरण ।
      नोट: योग्यता में कम-से-µ g डीएनए के अनुसार 1010 कॉलोनी बनाने वाली इकाइयों (cfu) होना चाहिए । हौसले से तैयार कोशिकाओं को आमतौर पर इस से बेहतर प्रदर्शन करते हैं ।
  8. ३७ ° c में ६० मिनट के लिए २२५ आरपीएम पर मिलाते हुए बैक्टीरिया तब्दील करने की मशीन ।
  9. गुणवत्ता नियंत्रण कदम:
    1. प्लेट एक परिभाषित बैक्टीरिया की छोटी राशि पुस्तकालय के साथ बदल दिया (उदा 10 µ एल एक 10-100 गुना कमजोर पड़ने के) पर एक 10 सेमी आगर प्लेट उपयुक्त एंटीबायोटिक चयन के साथ.
      नोट: कुल संस्कृति खंड (चरण १०.६ से) जानने के लिए, प्राप्त कॉलोनी संख्या पूरी लाइब्रेरी के लिए कालोनियों की कुल संख्या का अनुमान लगाने के लिए इस्तेमाल किया जा सकता है । 20-30 पुस्तकालय के गुना प्रतिनिधित्व आदर्श बनाए रखा जाना चाहिए ।
  10. 2TY पर जीवाणुओं के शेष बिखरना आगर उपयुक्त एंटीबायोटिक चयन युक्त परख बर्तन लेपित ।
    ध्यान दें: संस्कृति की मात्रा पर केंद्रापसारक द्वारा कम किया जा सकता है ~ ४,००० 10 मिनट के लिए एक्स जी (या जब तक एक दृश्य गोली का गठन और supernatant स्पष्ट प्रतीत होता है) । इस समय प्लेटों को कम करने के लिए संस्कृति के प्रसार के बाद शुष्क की जरूरत है । प्लेटों का उपयोग करने के बजाय तरल संस्कृति व्यक्तिगत कालोनियों की आय से अधिक वृद्धि को कम करता है । 13
  11. उचित एंटीबायोटिक चयन के साथ एक अतिरिक्त 10 सेमी आगर डिश पर pUC19 नियंत्रण electroporation प्रतिक्रिया का एक उचित मात्रा में फैल गया ।
  12. मशीन ३७ डिग्री सेल्सियस पर रात भर (16 घंटे) प्लेटें आगर ।
  13. नियंत्रण प्लेटों (pUC19 और नियंत्रण लाइब्रेरी प्लेट) पर प्राप्त कालोनियों की गणना करने के लिए CFU/µ जी डीएनए के साथ ही पुस्तकालय जटिलता के लिए अनुमान है ।

11. प्लाज्मिड डीएनए का निष्कर्षण

  1. रात भर प्लेटों के लिए 2 TY मीडिया के 10 मिलीलीटर जोड़ें, थाली से बैक्टीरियल परत परिमार्जन एक डिस्पोजेबल प्रसारकर्ता का उपयोग कर और यह एक ५० मिलीलीटर ट्यूब में इकट्ठा । सभी प्लेट साफ दिखाई देता है जब तक कुछ समय दोहराएं ।
  2. एक प्लाज्मिड मैक्सी किट का उपयोग कर डीएनए निकालें (2-3 कॉलम जैव के प्रति आवश्यक-परख प्लेट) ।

Representative Results

हाथ में प्रोटोकॉल का प्रयोग, CORALINA gRNA पुस्तकालयों मानव और माउस जीनोमिक डीएनए9 और बीएसी डीएनए (चित्रा 1) से उत्पंन किया गया है । gRNA अभिव्यक्ति वैक्टर में क्लोनिंग के लिए उपयुक्त इनपुट डीएनए के टुकड़े का उत्पादन करने के लिए, नियंत्रित nuclease पाचन के लिए इष्टतम स्थिति निर्धारित किया जाना है । micrococcal nuclease पाचन के अनुकूलन के लिए एक विशिष्ट परिणाम चित्रा 2aमें दर्शाया गया है । nuclease की अपर्याप्त मात्रा (०.१, 2, 3, 4, ४.५ या 5 इकाइयों) आवश्यक आकार रेंज (10-100 बीपी) में कोई ध्यान देने योग्य उत्पादों का उत्पादन और 5.5-7.5 इकाइयों अभी भी टुकड़े कि औसत पर भी लंबे समय से उत्पादित कर रहे हैं । एंजाइम की बड़ी मात्रा (५० इकाइयों) 10 मिनट के बाद इनपुट डीएनए की अत्यधिक गिरावट के लिए सीसा । नतीजतन, एक मध्यवर्ती राशि (10 इकाइयों) चुना गया था । डाइजेस्ट को बाद की शुद्धि और क्लोनिंग (चित्र b) के लिए पर्याप्त पचाने वाले अंशों का उत्पादन करने के लिए स्केल किया गया था । हालांकि यह आंख बंद आकार से डीएनए टुकड़े का चयन करने के लिए सिफारिश की है और केवल यूवी प्रकाश को डीएनए टुकड़े के जोखिम को कम करने के लिए अभिविन्यास के लिए डीएनए सीढ़ी पर भरोसा करते हैं, जैल पाचन और काटने की गुणवत्ता नियंत्रण के लिए बाद में दाग किया जा सकता है । आरेख b एक पृष्ठ जेल का एक प्रतिनिधि उदाहरण दिखाता है जिसमें से 20 और 30 bp के बीच डीएनए अंशों को उत्पाद किया गया है । जेल शुद्ध MNase टुकड़े एक 20% पृष्ठ पर लोड किए गए सफल आकार चयन और MNase-पच टुकड़े (चित्रा 2c) के शुद्धिकरण की जांच करने के लिए जेल । हाथ में प्रोटोकॉल अनुकूलित linker दृश्यों के उपयोग के साथ संगत है, MNase क्लोन पसंद की gRNA अभिव्यक्ति वैक्टर में टुकड़े पचा अनुमति देता है । यहां, gRNA-PLKO9 रीढ़ के रूप में इस्तेमाल किया गया था । लिंकर्स gRNA अभिव्यक्ति मानक पीसीआर का उपयोग वेक्टर से परिवर्धित कर रहे हैं । चित्रा 2 डी का एक प्रतिनिधि उदाहरण प्रवर्धित linker अतिरिक्त, गलत या कोई टेम्पलेट amplicons के विहीन दृश्यों का चित्रण है. अगले, linker amplicons प्रतिबंध एंजाइमों को सुनिश्चित करने के साथ पचा रहे है लिंक सही अभिविंयास में MNase-पचा टुकड़े पर ligated हैं । चित्रा 2d 5 ' और 3 ' लिंकर्स के agarose जैल से पहले और हिंदIII और सैकद्वितीय क्रमशः के साथ पाचन से पता चलता है, ६३७ भविष्यवाणी की है और २९५ बीपी के लिए लिंकर्स के पूर्ण पाचन का संकेत । दाएँ हाथ के जेल छवि के भाग के दस्तावेजों को पचा linker टुकड़े के उत्पाद । जेल निष्कर्षण के बाद पच लिंकर्स, प्रोटोकॉल में अगले कदम के लिए बंधाव है MNase-मरंमत के अंत के लिए लिंक के टुकड़े पचा । क्योंकि लिंकर अनुक्रम unphosphorylated प्राइमरों का उपयोग कर पीसीआर द्वारा उत्पंन कर रहे हैं, स्वयं लिंकर्स के बंधाव नहीं होने चाहिए । केवल अंत मरंमत MNase-पचा डीएनए टुकड़े फॉस्फेट बंधाव के लिए आवश्यक समूहों प्रदान करते हैं । निक अनुवाद के बाद, बंधाव उत्पाद पीसीआर द्वारा परिलक्षित होता है । आदेश में अत्यधिक पीसीआर प्रवर्धन पूर्वाग्रह है कि पुस्तकालय में gRNA दृश्यों का प्रतिनिधित्व विषम सकता से बचने के लिए, प्रवर्धन कुल में से कम 20 चक्र तक सीमित है । पीसीआर के बाद, प्रवर्धन उत्पादों agarose जैल पर कल्पना करने के लिए मुश्किल है । ३२ चक्र के साथ अलग नियंत्रण पीसीआर इसलिए उत्पादों का पता लगाने के लिए प्रदर्शन कर रहे हैं (लेकिन पुस्तकालय की तैयारी के लिए इस्तेमाल नहीं कर रहे हैं). इस नियंत्रण पीसीआर से परिणाम चित्रा 2Eमें दिखाया गया है । यह बंधाव प्रतिक्रियाओं का अनुकूलन करने के लिए और प्रतिक्रियाओं पीसीआर कलाकृतियों से रहित हैं सुनिश्चित करने के लिए अनुमति देता है, जो कभी "कोई टुकड़े नियंत्रण" (NFC) में होते हैं । चित्रा 2E वांछित amplicon से पता चलता है (5 ' linker + डीएनए टुकड़ा + 3 ' linker, लंबाई: ८६९ bp) equimolar (1:1) टुकड़ों और linker अनुक्रम के बीच अनुपात का उपयोग बंधाव प्रतिक्रियाओं के प्रवर्धन निंनलिखित ।

Figure 1
चित्र 1 : एक gRNA लाइब्रेरी तैयार करने के लिए सुझाए गए टाइमलाइन. CORALINA किसी भी जीव से अलग डीएनए स्रोतों की एक बहुतायत से व्यापक gRNA पुस्तकालयों की पीढ़ी के लिए एक सरल और लागत कुशल रणनीति प्रदान करता है । हाथ में प्रोटोकॉल एक कार्य सप्ताह के दौरान पूरा करने के लिए लाया जा सकता है । लिंकर पीढ़ी डीएनए अंत की मरंमत के साथ समानांतर में प्रदर्शन किया जा सकता है । electrocompetent बैक्टीरिया की तैयारी दो दिन लगते है और एक रात वृद्धि कदम भी शामिल है और इसलिए विधानसभा प्रतिक्रियाओं की स्थापना से पहले शुरू किया जाना चाहिए । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2 : प्रोटोकॉल के दौरान महत्वपूर्ण चरण. ( ) बीएसी डीएनए के नियंत्रित पाचन विभिंन आकारों के टुकड़ों के उत्पादन में सक्षम बनाता है । यहां दिखाया MNase पाचन का अनुकूलन है । शुद्ध बीएसी डीएनए 10 मिनट के लिए MNase के विभिंन मात्रा के साथ इलाज किया गया था 10 MNase के यू वांछित लंबाई (20-30 बीपी) के डीएनए टुकड़े उत्पंन करते हैं । (B) polyacrylamide जैल से उत् पाद शुल् क का उपयोग करके 20 और 30 bp के बीच के टुकड़ों का आकार चयन । शुद्ध बीएसी डीएनए 10 मिनट के लिए MNase के 10 यू के साथ इलाज किया गया था । छवि के बाद उत्पाद दर्ज की गई । () जेल-शुद्धि अंशों का गुणवत्ता नियंत्रण । जेल के बाद शुद्धि, 1/शुद्ध MNase टुकड़ों में से एक 20% पृष्ठ पर लोड किया गया था सफल आकार चयन और शुद्धि की जांच जेल । () विधानसभा और लिंकर्स के प्रतिबंध एंजाइम पाचन के लिए linker अनुक्रम के प्रवर्धन दिशात्मक क्लोनिंग सुनिश्चित करने के लिए । 5 ' और 3 ' linkers परिलक्षित और HindIII और SacII, क्रमशः के साथ काट रहे थे । कोई टेम्पलेट नियंत्रण (एनटीसी) पीसीआर कलाकृतियों और डीएनए संदूषण के लिए नियंत्रण करने के लिए शामिल थे । वाम: विश्लेषणात्मक नमूना आवेदन; सही: preparative नमूना आवेदन । जेल उत्पाद शुल्क के बाद छवि दर्ज की गई । () डीएनए अंशों को लिंक करने वालों की सफल बंधाव पीसीआर साइकिल (३२) की संख्या में वृद्धि के साथ पीसीआर का उपयोग कर विश्लेषण किया जा सकता है और एच2ओ (एनटीसी) के साथ कोई टेम्पलेट नियंत्रण प्रदर्शन या पिछले निक अनुवाद कदम से एनटीसी का उपयोग करके नियंत्रित इनपुट के रूप में (एनटीसी NT)) । यह एक कोई टुकड़ा नियंत्रण (NFC), जो एक बंधाव से एक प्रवर्धन और निक अनुवाद प्रतिक्रिया जिसमें से MNase टुकड़े लोप हो गया है शामिल करने के लिए महत्वपूर्ण है । केवल नमूने जिसमें MNase टुकड़े linker डीएनए के साथ संयुक्त किया गया है अपेक्षित amplicon (८६९ बीपी) का उत्पादन । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Discussion

CORALINA लक्ष्य डीएनए के नियंत्रित nuclease पाचन और परिणामस्वरूप डबल असहाय टुकड़े के थोक क्लोनिंग द्वारा बड़े पैमाने पर gRNA पुस्तकालयों उत्पंन करने के लिए इस्तेमाल किया जा सकता है । सांख्यिकीय निष्कर्ष इंगित करता है कि कई 10 से अधिक7 व्यक्तिगत gRNA दृश्यों पहले से ही सफलतापूर्वक किया गया है हाथ में प्रोटोकॉल का उपयोग कर9क्लोन । CORALINA कई मायनों में अनुकूलित किया जा सकता है । टेंपलेट डीएनए के चुनाव लक्ष्य क्षेत्र और उत्पंन पुस्तकालय की अधिक से अधिक जटिलता को परिभाषित करता है । इस प्रोटोकॉल का प्रयोग, CORALINA पुस्तकालयों पहले मानव और माउस जीनोमिक डीएनए9से उत्पंन किया गया है । प्रतिनिधि यहां प्रस्तुत परिणाम शुद्ध बीएसी डीएनए से एक CORALINA पुस्तकालय की पीढ़ी को दर्शाते हैं । आगे अनुकूलन gRNA अभिव्यक्ति वेक्टर और linker दृश्यों के विकल्प से प्राप्त किया जा सकता है । हम पहले गिब्सन विधानसभा के लिए 3 दक्षता में थोड़ा बदलाव के साथ linker लंबाई के तीन अलग जोड़े परीक्षण किया है9

थोक पचा डीएनए से उनके मूल के कारण, CORALINA gRNAs के protospacer आमतौर पर लंबाई में ठीक 20 बीपी नहीं कर रहे हैं, लेकिन एक मतलब है कि दोनों MNase पाचन के मापदंडों पर निर्भर करता है के साथ एक लंबाई वितरण दिखाने के साथ ही पृष्ठ जेल से बनाया उत्पाद का आकार एस चित्रा बी 1 और सीमें दिखाया प्रतिनिधि उदाहरण, 19 और 27 बीपी के बीच एक औसत लंबाई के साथ टुकड़े को दर्शाया गया है । हमारे अनुभव में, टुकड़ों की लंबाई ईमानदारी से उत्पंन gRNA protospacer द्वारा संरक्षित है9। जबकि टुकड़े से कम 20 बीपी उच्च बंद होने के कारण बचा जाना चाहिए gRNAs परिणामस्वरूप के लक्ष्य दर, अब टुकड़े की संभावना बहुत बहाव अनुप्रयोगों के लिए एक समस्या के कम कर रहे हैं, क्योंकि यह प्रदर्शन किया गया है कि protospacers के साथ gRNAs के रूप में लंबे समय के रूप में ४५ बीपी अभी भी कर रहे है कार्यात्मक9.

CORALINA प्रोटोकॉल में दो सबसे महत्वपूर्ण चरणों MNase-पचा टुकड़े और क्लोनिंग कदम का आकार चयन कर रहे हैं । टुकड़े की पीढ़ी है कि बहुत कम कर रहे है (18 बीपी नीचे औसतउदा ) या बहुत सारे खाली gRNA अभिव्यक्ति वैक्टर के शामिल करने के पुस्तकालय बेकार प्रदान करेगा । इस प्रकार, यह महत्वपूर्ण है MNase पाचन कदम (चित्रा 2a) का अनुकूलन करने के लिए, (चित्रा बी सी, सी), gRNA वेक्टर रीढ़ की पूरी पाचन के लिए जांच और प्रोटोकॉल भर में कोई टुकड़ा नियंत्रण सहित उत्पाद की निगरानी करने के लिए । gRNA पुस्तकालय के प्रतिनिधित्व को संरक्षित करने के लिए भी विशेष ध्यान रखा जाना है । सामांय में पुस्तकालय पीढ़ी के एक आम अड़चन plasmids के प्रवर्धन के लिए बैक्टीरिया में कुशल हस्तांतरण है । इस प्रकार, महान दक्षता और व्यक्तिगत electroporation घटनाओं की एक बड़ी संख्या के साथ बैक्टीरिया की बड़ी मात्रा में gRNA क्लोन की एक उच्च संख्या को प्राप्त करने के लिए आवश्यक हैं ।

gRNA पुस्तकालय उत्पादन के लिए नई रणनीतियों के लिए अगले दशकों में CRISPR आधारित स्क्रीनिंग दृष्टिकोण की पूरी क्षमता फसल के लिए आवश्यक हो जाएगा । वहां लागत के लिए एक महत्वपूर्ण मांग प्रभावी, सरल और अनुकूलन के लिए बड़े पैमाने पर पुस्तकालयों, एक पूर्व आवश्यक स्क्रीनिंग मॉडल प्रणालियों और विभिंन CRISPR आधारित इंजीनियरिंग दृष्टिकोण की एक बड़ी संख्या के लिए उत्तरदायी बनाने के लिए उत्पंन है । CORALINA इस ओर पहला कदम प्रदान कर रहा है । संभावित उपयोग कई गुना, विशेष रूप से जीनोम के व्यापक पुस्तकालयों का उत्पादन कर रहे हैं, सीडीएनए कम आम मॉडल प्रणालियों के व्युत्पंन पुस्तकालयों, अत्यधिक ध्यान केंद्रित पुस्तकालयों और प्रयोगात्मक सेट अप जिसमें अलग CRISPR प्रोटीन (अलग पाम के साथ आवश्यकताओं) संयोजन में उपयोग किया जाता है ।

अंय तरीकों के विपरीत, CORALINA इनपुट डीएनए से सभी संभव gRNAs उत्पंन करता है । हालांकि, विधि का एक दोष यह है कि gRNAs आवश्यक पाम अनुक्रम कमी भी पुस्तकालय में शामिल हैं, एक विशेषता यह है कि gRNA पुस्तकालय पीढ़ी के लिए एक दूसरे एंजाइमी विधि के साथ शेयर, CRISPR खाने (तालिका 1) । gRNA पुस्तकालय पीढ़ी के लिए आदर्श विधि के चुनाव की योजना बनाई स्क्रीनिंग प्रयोग के विनिर्देशों पर निर्भर करता है, विशेष रूप से प्रकृति (genic, विनियामक, intergenic) और लक्ष्य क्षेत्र के आकार (एकल लोकस, कई क्षेत्रों, जीनोम चौड़ा) । हम CORALINA का उपयोग करने में एक विशेष उल्टा जब गैर की एक बड़ी संख्या कोडिंग या विनियामक क्षेत्रों का विश्लेषण किया जा रहे है देखते हैं, अगर वहां अधूरा या अविश्वसनीय अनुक्रम जानकारी (विदेशी मॉडल सिस्टम, प्रजातियों के मिश्रण (उदा microbiomes) या प्रयोग इनपुट प्राप्त), अगर विभिंन CRISPR endonucleases संयुक्त या यदि संतृप्त विश्लेषण एक छोटी और परिभाषित लोकस पर किया जाता है (उदा BACs द्वारा प्रतिनिधित्व) ।

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

लेखक प्रो dr. स्टीफ़न बेक और प्रो dr. Magdalena Goetz उनके इनपुट के लिए, मदद और समर्थन CORALINA विधि, मैक्सीमिलियन Wiessbeck और वैलेंटिन Baumann उपयोगी टिप्पणियों के लिए विकसित करने में शुक्रिया अदा करना चाहूंगा । काम DFG (STR 1385/1-1) द्वारा समर्थित किया गया है ।

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
किसी भी डीएनए स्रोत से बड़े पैमाने पर gRNA पुस्तकालय उत्पादन के लिए एक सार्वभौमिक प्रोटोकॉल
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter