Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Un protocollo universale per gRNA su larga scala produzione di libreria da qualsiasi fonte di DNA

doi: 10.3791/56264 Published: December 6, 2017

Summary

Metodi per la generazione di librerie di gRNA su larga scala dovrebbero essere semplice, efficiente e conveniente. Descriviamo un protocollo per la produzione di gRNA librerie basate su digestione enzimatica del DNA bersaglio. Questo metodo, CORALINA (generazione della libreria completa gRNA attraverso attività controllata nucleasi) presenta un'alternativa alla sintesi del oligonucleotide personalizzato costosi.

Abstract

La popolarità del sistema CRISPR/Cas9 per genoma sia epigenome ingegneria deriva dalla sua semplicità e adattabilità. Un effettore (le nucleasi Cas9 o una proteina di fusione di nucleasi-morti dCas9) è mirato a un sito specifico nel genoma di un piccolo RNA sintetico noto come guida RNA, o gRNA. La natura bilaterale del sistema CRISPR consente l'utilizzo di approcci di screening poiché librerie plasmide contenente cassette di espressione di migliaia di singoli gRNAs possono essere utilizzati per interrogare molti siti diversi in un singolo esperimento.

Ad oggi, gRNA sequenze per la costruzione di librerie sono state generate quasi esclusivamente di sintesi del oligonucleotide, che limita la complessità realizzabile delle sequenze nella libreria ed è relativamente costosa. Qui, un dettagliato protocollo per CORALINA (generazione della libreria completa gRNA attraverso attività controllata nucleasi), un semplice e conveniente metodo per la generazione di librerie di gRNA altamente complessi basati sulla digestione enzimatica di input del DNA, è descritto. Poiché le librerie CORALINA possono essere generate da qualsiasi fonte di DNA, un sacco di opzioni di personalizzazione esiste, permettendo una grande varietà di schermi basati su CRISPR.

Introduction

L'adattamento del sistema CRISPR/Cas9 batterico come un strumento per il targeting molecolare ha causato la più recente rivoluzione nella biologia molecolare. Mai è stato così facile da manipolare cromatina alle posizioni definite genomici. Applicazioni comuni di CRISPR includono genica mirata mutazioni1, genoma ingegneria2epigenome modifica3, attivazione trascrizionale e4il silenziamento genico. Un particolare vantaggio del sistema CRISPR è che le sue applicazioni non sono limitate a siti candidati ben studiato, come librerie di gRNA rendono meno prevenuti schermi possibile. Questi facilitano la scoperta di loci funzionali del genoma senza alcuna conoscenza sperimentale. Tuttavia, la costruzione della libreria gRNA è attualmente principalmente basata sulla sintesi di oligo-nucleotidi e ci sono opzioni limitate per l'acquisto di gRNA librerie che non sono di essere umano o regioni di origine o destinazione del mouse di fuori aprire lettura cornici. Così, anche se CRISPR schermi hanno già dimostrato incredibilmente potente5,6,7,8, appieno il loro potenziale non è ancora stato sfruttato.

Per superare la limitazione delle due strategie di gRNA classica generazione metodi sono stati recentemente sviluppati. Entrambi sono basati sulla digestione enzimatica controllata del DNA bersaglio, piuttosto che basarsi su sintesi del oligonucleotide personalizzato. Mentre CORALINA9 impiega nucleasi di micrococcal, il metodo alternativo solo attualmente disponibile, mangia-CRISPR10, fa uso degli enzimi di restrizione (HpaII, ScrFI, Bfaio e Mmeho). Cosa importante, entrambe le tecniche possono essere applicate a qualsiasi ingresso del DNA, che serve come fonte di gRNA protospacer sequenze. Mentre il metodo mangia-CRISPR utilizza una strategia per ridurre il numero di clonato gRNAs cui targeting siti non vengono seguite da PAM s. pyogenes richiesto (protospacer motivo adiacenti), che genera solo una piccola frazione di tutte le possibili gRNAs funzionale per una determinata regione. CORALINA, d'altra parte, è in grado di generare tutti i potenziali gRNAs per la sequenza di origine, ma incorpora anche un' più alta frazione di guide non funzionali. generazione della libreria gRNA attraverso l'attività della nucleasi controllata consente la produzione di librerie gRNA completa per tutte le specie, qualsiasi sistema Cas9-proteina o - effector in modo semplice ed economico. Inoltre, CORALINA è adattabile alla personalizzazione, come scelte appropriate di ingresso e il vettore di definiscono il tipo di libreria, la dimensione e il contenuto. Qui, un protocollo dettagliato è presentato che può essere utilizzato per la generazione di librerie complete gRNA provenienti da fonti diverse di DNA (Figura 1), tra cui cromosomi artificiali batterici (BACs) o genomic DNA9. I risultati rappresentativi che accompagna questo protocollo sono stati derivati applicando il protocollo CORALINA al DNA di BAC.

Protocol

1. digestione del DNA con nucleasi di Micrococcal

  1. Eseguire una reazione di ottimizzazione per ogni nuovo lotto di enzima nucleasi di micrococcal (MNase).
    Nota: Il numero di unità di MNase utilizzati deve essere verificato (utilizzando una diluizione seriale, Figura 2A). Di solito, 5-10 U di MNase digerire 1 µ g di purificato genomico o DNA di BAC a un intervallo di 5-100 bp con le condizioni descritte di seguito.
  2. Per reazione, impostare 1 µ l di tampone MNase 10x, albumina di siero bovino (BSA), 1 µ g di DNA, 1 µ l di MNase bersaglio: 1x (0,1-50 unità) in un volume di reazione di 10 µ l.
  3. Incubare a 37 ° C per 15 min.
  4. Immediatamente inattivare l'enzima aggiungendo 1 µ l di 500mm glicole etilenico-bis(β-aminoethyl ether)-N, N, N', N'-acido etilendiamminotetraacetico (EGTA).

2. separazione del DNA frammenti mediante elettroforesi in Gel di poliacrilamide (pagina)

  1. Aggiungere tampone campione/tintura di campioni di DNA di caricamento del gel e caricare su un 20% gel PAGE. Caricare una scaletta di DNA appropriata per dimensionamento (5 bp DNA Ladder). Non sovraccaricare il gel (1 µ g del DNA per pozzetto).
  2. Eseguire gel appropriato 1x TRIS-Borato-EDTA (TBE) in esecuzione nel buffer in corrispondenza 150 V (costante) per circa 1,5 h o fino alla parte anteriore inferiore della tintura (bromofenolo, blu scuro di colore blu) che viaggia intorno alle 15 bp, raggiunge l'estremità inferiore del gel.
  3. Macchia il gel usando una macchia di ultra-sensibile dell'acido nucleico e visualizzare sotto luce UV.
  4. Dall'immagine gel, determinare la concentrazione ottimale di MNase per la digestione del DNA fino a 20-30 bp in dimensione.
  5. Utilizzare la concentrazione ottimizzata di MNase per digerire il DNA bersaglio ripetendo i passaggi 1.2-2.2. Di solito, configurazione 10-12 reazioni (cioè 10-12 µ g del materiale di partenza totale) produrrà abbastanza digerito DNA estrazione gel pagina seguente per procedere ai passaggi successivi.
  6. Usando un bisturi sterile, tagliare il gel adiacente alla corsia di marcatore e macchia solo la parte del gel che contiene la scala con fresco 1 x TBE in esecuzione tampone contenente 1 X di una macchia di ultra-sensibile dell'acido nucleico. Visualizzare il DNA ladder e asportare frammenti di DNA digerito MNase nell'intervallo di dimensioni tra circa 18-30 bp usando una lama di rasoio.
    Nota: Evitare di esporre i frammenti digeriti MNase ai raggi UV. È possibile utilizzare una sorgente di luce blu (invece di UV) o prendere un'immagine della scala sotto UV, stamparlo per ridimensionare e utilizzare questo per guidare l'asportazione dei frammenti del DNA digerito di MNase). Questo passaggio evita la macchiatura e l'esposizione di frammenti di DNA a luce UV. Utilizzare sempre un bisturi monouso sterili, inutilizzati o lama di rasoio per questo passo per evitare la contaminazione.
  7. Trasferire la fetta di gel a un tubo del microcentrifuge.
  8. Macchiare il resto del gel con acido nucleico macchia come sopra, esporre ai raggi UV e registrare un'immagine per tenere traccia del passaggio di asportazione del gel.

3. isolamento dei frammenti di DNA dai gel di pagina utilizzando il metodo di ammollo e Crush

Nota: Questo passaggio è stato adottato da Sambrook et al. 11

  1. Preparare la pagina gel tampone di solubilizzazione (1,88 mL di acetato di ammonio 4 M, 150 µ l di acetato di magnesio 1 M, 30 µ l di 0,5 M acido etilendiamminotetraacetico (EDTA) (pH 8) in ultrapura H2O a un volume totale di 15 mL).
  2. Schiacciare la fetta asportato gel contro la parete del tubo micro-centrifuga utilizzando una pipetta sterile.
  3. Aggiungere 2 volumi di tampone di solubilizzazione pagina del gel e incubare a 37 ° C per 16 ore su una piattaforma rotante.
  4. Centrifugare i campioni per 1 min alla massima velocità in una microcentrifuga. Trasferire il surnatante ad un nuovo tubo del microcentrifuge, facendo attenzione a non per trasferire eventuali pezzi gel schiacciato.
  5. Aggiungere 0,5 volumi di tampone di solubilizzazione di pagina al gel a pellet, vortice, quindi ripetere la centrifugazione (punto 3.4). Combinare i sovranatante.
  6. Estrarre i frammenti di DNA mediante estrazione del fenolo-cloroformio standard.
    Attenzione: Fenolo è tossico se viene a contatto con la pelle e per ingestione. Precauzioni di sicurezza come guanti, occhiali protettivi, camice da laboratorio e lavorando in una cappa sono critici. Smaltire tutti i rifiuti contenenti fenolo secondo le normative dell'Istituto.
    1. Aggiungere un volume del fenolo: cloroformio: alcool isoamilico (25:24:1) per il campione e il vortice accuratamente.
    2. Centrifugare per 10 minuti alla massima velocità (16.000 x g) in una centrifuga da tavolo a temperatura ambiente. Trasferire con cautela la fase acquosa superiore ad un tubo del microcentrifuge fresco. Fare attenzione a non per portare sopra qualsiasi fenolo durante il pipettaggio.
    3. Ripetere i passaggi 3.6.1 e 3.6.2 una volta.
    4. Aggiungere una piccola quantità (0,2 µ l) di glicogeno, 0,1 volumi di acetato di sodio 3 M (pH 5.2) e 2 volumi di 100% etanolo (EtOH).
    5. Vortex e incubare a-20 ° C per diverse ore o durante la notte.
    6. Centrifuga per 30 min a velocità massima a 4 ° C, utilizzando una centrifuga da tavolo.
    7. Con attenzione rimuovere il surnatante e lavare la pallina di DNA con 70% EtOH.
    8. Centrifuga per 30 min a velocità massima a 4 ° C, utilizzando una centrifuga da tavolo.
    9. Rimuovere il supernatante e asciugare all'aria il pellet di DNA. Assicurarsi che tutti l'EtOH evaporato, ma fare attenzione a non asciugare troppo il pellet.
    10. Sciogliere i pellet di DNA in 12 µ l di H2O.
      Nota: Estrazione del gel di pagina è molto inefficiente. Per ogni 10 µ g di DNA digerito con MNase di avviamento, si aspettano di recuperare ng 1-20 di frammenti purificati dopo estrazione del gel. Controllare la quantità e l'integrità dei frammenti di caricamento 1/6th (2 µ l) su un gel di pagina (Figura 2).

4. fine riparazione dei frammenti MNase-digerito, Gel-purificato

  1. Impostare la seguente reazione utilizzando un DNA smussamento kit: 10 µ l di DNA purificato dal passaggio 3.6.10, 1,5 µ l di 10 X smussamento buffer, 1,5 µ l di miscela del dNTP 1 mM, 0,6 µ l di enzima smussamento, 1,4 µ l di H2O.
  2. Incubare a 22 ° C per 30 minuti e poi calore-inattivare l'enzima mediante incubazione a 70 ° C per 10 min.
  3. Aggiungere 85 µ l di H2O ed eseguire un reazione clean-up usando fenolo/cloroformio-estrazione standard ed EtOH-precipitazione (come descritto nella sezione 3.6). Procedere immediatamente alla legatura del linker.

5. linker generazione

Nota: Linkers necessario essere amplificato in parallelo con la sezione 3 per essere in grado di procedere immediatamente con la legatura del linker. Sequenze dell'iniettore utilizzati di seguito devono essere appropriati per il vettore di espressione gRNA selezionate. Quelle qui presentate sono state progettate per il vettore pgRNA-pLKO.1. 9 per l'amplificazione del linker 5' da pgRNA-pLKO.1, utilizzare il primer sequenze 5'-linker-F (TTGGAATCACACGACCTGGA) e 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), producendo un amplicone bp 689. Per l'amplificazione del linker 3' da pgRNA-pLKO.1, utilizzare il primer 3'-linker-f: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) e 3'-linker-r: (ACTCGGTCATGGTAAGCTCC), che producono un amplicone bp 848.

  1. PCR-amplificare l'adattatore sequenze dal vettore di espressione di gRNA (utilizzando reagenti di scelta e sequenze dell'iniettore personalizzati, se necessario). Per impostare la seguente reazione di PCR di 50 µ l di pgRNA-pLKO.1: 25 µ l di mix master PCR, 2,5 µ l di primer F (10 µM), 2,5 µ l di primer R (10 µM), 0,1 ng di vettore di espressione gRNA (pgRNA-pLKO.1) in H2O.
  2. Incubare le reazioni in un termociclatore usando le seguenti condizioni: 1 ciclo di 98 ° C per 30 s, 32 cicli 98 ° C per 10 s, 59 ° C per 10 s, 72 ° C per 30 s, 1 ciclo di 72 ° C per 10 min.
  3. Purificare le reazioni di PCR usando i branelli reversibile immobilizzazione in fase solida secondo le istruzioni del produttore. Eluire in 30 µ l di H2O.
  4. Per applicare la legatura direzionale del linker per i frammenti di DNA fine-riparato, MNase-digerito, linker digest con enzimi di restrizione appropriati (qui HindIII e SacII). Impostare le seguenti reazioni:
    1. Per la digestione del 5' linker con HindIII, utilizzare 30 µ l di 5' purificata del linker amplicon dal punto 5.3., 5 µ l di tampone, 3 µ l di HindIII (20U / µ l) e 12 µ l di H2O.
    2. Per la digestione del 3' linker con SacII, utilizzare 30 µ l di 3' purificata del linker amplicon dal punto 5.3., 5 µ l di tampone, 3 µ l di SacII (20 U / µ l) e 12 µ l di H2O.
  5. Incubare digest a 37 ° C per 3 h.
  6. Aggiungere tintura di caricamento del gel del DNA ed eseguire il digest di enzima di restrizione su un gel di agarosio 1%. Asportare le bande a 637 bp (digest del linker 5') e 295 bp (3' digest del linker).
  7. Purificare il DNA dai pezzi gel asportato utilizzando un kit di estrazione del gel.

6. linker legatura e amplificazione degli inserti

  1. Impostare una reazione di legatura 14 µ l utilizzando quantità equimolari di frammenti MNase-digerito, fine-riparato e sequenze del linker.
    Nota: Il Linker di rapporti di frammento potrebbe essere ottimizzato. Si consiglia di includere una reazione di controllo no-frammento (NFC).
    1. Uso 5 ng di MNase-digerito frammenti (fine-riparato e purificato), 120 ng del 5' linker (HindIII digest, purificato), 55 ng di 3' linker (Sacdigest II, purificato), 1,4 µ l della ligasi T4 Buffer e 1,4 µ l di concentrato T4 DNA ligasi in H2O.
  2. Incubare le reazioni di legatura a 16 ° C per 16 h. Fare non calore-inattivare l'enzima. Procedere immediatamente alla scalfittura-traduzione.
    Nota: I frammenti digeriti MNase fine-riparato forniscono i 5' fosfati necessari per la legatura di linkers, come il linker stessi sono ONU-fosforilati.
  3. Per la legatura reazione (e la reazione di NFC) aggiungere la seguente: 25 µ l di Taq 2 X mix master (capace di traduzione di nick), 2,5 µ l di primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µ l di primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) e 6 µ l di H2O.
  4. Includere un controllo di modello di no (NTC). Incubare le reazioni in un termociclatore usando le seguenti condizioni: 1 ciclo (traduzione di scalfittura): 72 ° C per 20 min, 1 ciclo: 95 ° C per 5 min, 3-4 cicli: 95 ° C per 15 s, 58 ° C per 15 s, 72 ° C per 30 s, 1 ciclo: 72 ° C per 5 min.
  5. Eseguire un reazione clean-up usando le perle di immobilizzazione reversibile in fase solida con un campione di rapporto perlina di 1:1. Eluire in 40 µ l di H2O.
  6. Amplificare ulteriormente il frammento desiderato (5' linker + MNase + 3 del frammento ' linker) utilizzando i reagenti PCR appropriati e i seguenti primer:
    1. Utilizzare 12,5 µ l di master mix PCR, 1.25 µ l di primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1.25 µ l di primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µ l di prodotto di traduzione di nick purificata dal punto 6.4. e 7,5 µ l di H2O. utilizzare le seguenti condizioni: 1 ciclo: 98 ° C per 30 s, 10-16 cicli: 98 ° C per 10 s, 63 ° C per 10 s, 72 ° C per 15 s, 1 ciclo: 72 ° C per 10 min.
      Nota: Se necessario, parecchie reazioni possono essere impostare in parallelo per garantire che c'è abbastanza prodotto di PCR per i passaggi successivi. Per visualizzare piccole quantità di prodotto di PCR su un gel di agarosio, impostare ulteriori reazioni come descritto al punto 6.5 e aumentare il numero di cicli da 15 a 32. Questa reazione può essere utilizzata come controllo di qualità, se ampliconi non sono visibili dopo 15 cicli. Includono anche un controllo privo di templato (NTC).

7. formato selezione

Nota: Questo passaggio separa MNase-frammenti con il linker di 5' e 3' montato correttamente da frammenti con due 5' o i due 3' linker basato sulla dimensione.

  1. Combinare tutte le reazioni di PCR 15-ciclo dal punto 6.5., aggiungere DNA della tintura di caricamento e correre su un gel di agarosio 0.8%. Asportare la fascia prominente a 869 bp e purificare il DNA utilizzando un kit di estrazione del gel.
  2. Quantificare la quantità di DNA (ad esempio utilizzando uno spettrofotometro).

8. clonazione di frammenti di PCR-amplificato in gRNA vettore di espressione dall'Assemblea di Gibson

  1. Preparare Assemblea master mix come segue:
    Nota: I seguenti passaggi sono adattati da Gibson et al. 12.
    1. Creare 6 mL di tampone di reazione isotermica combinando 3 mL di 1 M Tris (idrossimetil) amminometano (Tris)-HCl pH 7.5, 300 µ l di 1 M MgCl, 60 µ l di trifosfato di 100mm deossiguanosina (dGTP), 60 µ l di trifosfato di deossiadenosina 100mm (dATP) 60 µ l di 100 mM deossitimidina trifosfato (dTTP), 60 µ l di deoxycytidine trifosfato di 100mm (dCTP), 300 µ l di 1 M ditiotreitolo (DTT), 1,5 g di polietilenglicole (PEG) -8000, 300 µ l di 100 mM di nicotinamide adenindinucleotide (NAD) in ultrapura H2O.
      Nota: Questo buffer può essere aliquotati e conservati a-20 ° C.
    2. Creare mix master di 1,2 mL Assemblea combinando 320 µ l di tampone di reazione isotermica: 5x, 3 µ l di 10 esonucleasi T5 U / µ l, 20 µ l di 2 U / µ l DNA polimerasi, 160 µ l di 40 U / µ l DNA ligasi in H ultrapura2O. uso 15 µ l di mix master Assemblea con 5 µ l di inserire.
      Nota: Il mix master di montaggio può essere aliquotati e conservati a-20 ° C, dove è stabile per più di un anno e può tollerare più cicli di gelo-disgelo. La quantità di exonuclease T5 è ideale per l'utilizzo con lunghe sporgenze.
  2. Digestione di spina dorsale di vettore
    Nota: Assicurarsi di digerire una quantità sufficiente di vettore come input per il numero desiderato di reazioni di montaggio al punto 8.3.
    1. Per reazione, aggiungere quanto segue: 1,5 µ g di vettore di espressione gRNA (pgRNA-pLKO.1), 5 µ l di tampone, 1,5 µ l di etàdigerire il mi (5 u / µ l) e 38,5 µ l di H2O. Incubare a 37 ° C per 2 h.
  3. Defosforilazione del vettore linearizzato.
    Nota: Questo passaggio è consigliato, ma non strettamente necessario. T5 esonucleasi nel mix master rimuoverà principalmente l' etàsovrasta prima la Taq DNA ligasi ha avuto la possibilità di agire. Di conseguenza, non è previsto eccessiva ri-legatura del vettore.
    1. Aggiungere 2,5 µ l di enzima fosfatasi alcalina di gamberetti (rSAP, 1 U / µ l).
    2. Incubare a 37 ° C per 30 min e quindi inattivare l'enzima incubando a 65 ° C per 5 min.
  4. Eseguire la purificazione del DNA
    Nota: Si consiglia di eseguire una fase di estrazione del gel dell'agarosi. In alternativa, purificazione colonna - o tallone può essere utilizzato. È importante controllare che la digestione di vettore è completa, ad esempio mediante elettroforesi su gel di agarosio. Per il confronto, non digerito vettore deve essere eseguito in parallelo.
  5. Quantificare l'importo del vettore digerito purificato nel campione.
  6. Impostare l'assembly con 2 volte eccesso molare di inserti per vector. A 20 µ l reazione uso 100 ng di vettore (etàio digerisco dal punto 8.5), 12,2 ng di inserire (dal punto 7.1.), 15 µ l di mix master di montaggio dal punto 8.1.2. in H2O.
  7. Incubare a 50 ° C per 1 h.
  8. Purificare le reazioni usando purificazione colonna. Risospendere il DNA in 75 µ l di H2O (o volume a seconda della scala dell'elettroporazione del caso).
    Nota: L'efficienza di trasformazione dipende notevolmente dalla purezza del DNA. Fasi di purificazione supplementare (ad es. estrazione del fenolo/cloroformio) potrebbero migliorare l'efficienza.

9. preparazione delle cellule di e. coli TG1 Electro-competente

  1. Assicurarsi che tutti centrifugare bottiglie e boccette sono liberi dai detergenti sciacquando e successivo riempimento con acqua distillata prima di sterilizzazione in autoclave.
    Nota: Questo passaggio consente di eliminare eventuali impurità che possano pregiudicare l'efficienza di trasformazione. Acqua deve essere eliminato immediatamente prima dell'uso. In alternativa, uso di bottiglie monouso centrifugazione potrebbe essere consigliabile.
  2. Garantire che centrifuga flaconi e soluzioni utilizzate per la preparazione delle celle electrocompetent sono refrigerati il priore di ghiaccio da utilizzare. Si consiglia di eseguire la procedura seguente in una cella frigorifera per ridurre al minimo le fluttuazioni di temperatura che possono influenzare l'efficienza di trasformazione.
  3. Preparare il supporto di 2TY. 16 g di bacto triptone, 10 g di Estratto di lievito e 5 g di NaCl, aggiungere acqua distillata 1 L, mix e autoclave. Conservare il medium a temperatura ambiente.
  4. Preparare piatti di analisi biologica 2TY-agar rivestito e 10cm Petri che contengono l'antibiotico adatto. Conservare le piastre a 4 ° C.
    Nota: La scelta dell'antibiotico dipende dalla natura del vettore di espressione gRNA, uso 100 µ g/mL ampicillina per pgRNA-pLKO.1.
  5. Raschiare da uno stock di glicerolo di TG1 celle per inoculare 10 mL di medium 2TY (senza antibiotici).
  6. Incubare la coltura a 37 ° C durante la notte (~ 16 h) con agitazione a 225 giri/min.
  7. Inoculare 1 L di 2TY medio (senza antibiotici) con 10 mL di coltura durante la notte (diluizione 1/100) e dividere in parti uguali tra due boccette di 2L (contenente i deflettori).
  8. Incubare la coltura a 37 ° C, 225 giri/min fino a raggiungere un OD600 nm di 0,55 (dopo circa 1,5-2 h). Utilizzare uno spettrofotometro per controllare regolarmente OD600 nm.
  9. Chill culture in ghiaccio per 30 min.
  10. Dividere la cultura ugualmente fra quattro bottiglie da 500 mL centrifuga (pre-refrigerati sul ghiaccio).
  11. Centrifuga per 15 min a 4.000 x g a 4 ° C in una centrifuga pre-refrigerata.
  12. Decantare surnatanti e aggiungere 1 volume (ovvero 250 mL) di pre-refrigerati ghiacciata sterile distillata H2O a ciascuna delle bottiglie della centrifuga. Risospendere il pellet batterico agitando o invertendo la bottiglia (o pipettando delicato, se necessario).
    Nota: È più facile risospendere il pellet aggiungendo prima un piccolo volume di acqua. Assicurarsi che il pellet è completamente in sospensione alla fine.
  13. Centrifuga per 15 min a 4.000 x g a 4 ° C.
  14. Ripetere il lavaggio due volte (passi 9.12. e 9,13). Eliminare il surnatante. Prestare attenzione quando decantazione come il pellet batterico diventa sempre più sciolto dopo il lavaggio.
  15. Risospendere il pellet in 50 mL di glicerolo al 10% sterile, ghiacciata e trasferirlo in una provetta da centrifuga refrigerata pre-50 mL.
  16. Centrifugare le cellule per 15 min a ~ 4.000 x g a 4 ° C. Rimuovere con cautela il supernatante.
  17. Risospendere delicatamente i batteri in 2 mL di glicerolo 10% sterile ghiacciata.
  18. Tenere il ghiaccio se le cellule devono essere utilizzati immediatamente per elettroporazione.
    Nota: Le cellule possono essere congelate in aliquote di 50 µ l in provette da 0,5 mL in un bagno di ghiaccio secco etanolo e conservate a-80 ° C, ma questo non è consigliato.

10. elettroporazione delle cellule di e. coli TG1 Electrocompetent

Nota: L'elettroporazione è uno dei colli di bottiglia nella generazione della libreria completa. Per preservare la rappresentazione di libreria, si consiglia di condurre reazioni individuali elettroporazione come molti come necessario/praticabile e di eseguire le operazioni di controllo di qualità descritte di seguito (10.6. e 10.8.).

  1. Aliquotare le reazioni purificate (dal passaggio 8,8) in PCR sterili e pre-refrigerati tubi e tenerli su ghiaccio (1 µ l per provetta). Raffreddare le provette di elettroporazione gap di 1 mm sul ghiaccio.
  2. Aggiungere 25 µ l di cellule TG1 preparate direttamente ad un'aliquota del DNA e trasferire immediatamente la miscela in una cuvetta di elettroporazione. Scorri o tocca la cuvetta per garantire che il mix di cellule/DNA è distribuito lungo la lunghezza della cuvetta camera (senza aria intrappolata o bolle).
  3. Disponga la provetta nella camera di diapositiva e avviare il programma di elettroporazione appropriato (ad esempio: 1 impulso di 1,8 kV (EC1)).
    Nota: La costante di tempo dovrebbe essere compresa tra 5,7 e 6,0 ms. nel caso in cui gli archi electroporator, scorri la cuvetta, garantire non ci sono senza bolle d'aria nella camera e riprovare.
  4. Aggiungere immediatamente 975 µ l di temperatura 2TY medio per la cuvetta.
  5. Utilizzando una pipetta di trasferimento, spostare i batteri individulamente in una provetta da 50 mL. Ripetere dal punto 10.2. e raccogliere tutte le cellule trasformate con una libreria in una provetta da 50 mL.
  6. Il volume totale del documento.
  7. Passaggio di controllo di qualità
    1. Per quantificare la competenza delle cellule electro-competenti appena generate, eseguire una reazione di elettroporazione separati usando una quantità definita di uncut plasmide DNA (ad es. 10 pg pUC19 controllo plasmide). Trasferire questo in una provetta di microfuge 1,5 mL.
      Nota: La competenza dovrebbe essere almeno 1010 unità formanti colonie (cfu) per µ g di DNA. Preparate le cellule solitamente eseguire meglio di questo.
  8. Incubare i batteri trasformati a 37 ° C per 60 min agitazione a 225 giri/min.
  9. Passaggio di controllo di qualità:
    1. Piastra di una piccola quantità definita di batteri trasformati con la libreria (ad es. 10 µ l di una diluizione di 10-100 volte) su una piastra di agar di 10 cm con la selezione antibiotica appropriata.
      Nota: Conoscendo il volume totale della cultura (dal punto 10.6.), il numero di Colonia ottenuta consente di stimare il numero totale di colonie per l'intera libreria. 20-30 volte rappresentazione della libreria idealmente dovrebbe essere mantenuta.
  10. Disperdere il resto dei batteri sulla 2TY agar rivestito analisi biologica piatti contenenti la selezione antibiotica appropriata.
    Nota: Il volume della cultura può essere ridotto mediante centrifugazione a ~ 4.000 x g per 10 minuti (o fino a quando si è formata una pallina visibile e il surnatante appare chiaro). Questo riduce il tempo piastre bisogno di asciugare dopo la diffusione della cultura. Utilizzo di piastre anziché coltura liquida riduce al minimo la crescita sproporzionata di diverse colonie. 13
  11. Diffondere un appropriato volume della reazione di elettroporazione del pUC19 controllo su un piatto di agar ulteriori 10cm con selezione antibiotica appropriata.
  12. Incubare le piastre di agar durante la notte (16h) a 37 ° C.
  13. Conteggio colonie ottenute sulle piastre di controllo (piastra di libreria pUC19 e controllo) per stimare CFU / µ g di DNA per i batteri così come complessità di biblioteca.

11. estrazione del DNA del plasmide

  1. Aggiungere 10 mL di media 2-TY per le piastre durante la notte, raschiare il livello batterico fuori la piastra utilizzando una spatola monouso e raccoglierlo in una provetta da 50 mL. Ripetere un paio di volte finché non appare pulito tutto il piatto.
  2. Estrazione del DNA utilizzando un kit di plasmide Maxi (2-3 colonne necessarie al saggio biologico piastra).

Representative Results

Utilizzando il protocollo a portata di mano, librerie gRNA CORALINA sono state generate da umani e mouse genomic DNA9 e BAC del DNA (Figura 1). Per produrre frammenti di DNA ingresso adatto per clonaggio in vettori di espressione gRNA, condizioni ottimali per digestione controllata nuclease devono essere determinati. Un risultato tipico per l'ottimizzazione della digestione della nucleasi di micrococcal è raffigurato nella Figura 2A. Una quantità insufficiente di nucleasi (0,1, 2, 3, 4, 4.5 o 5 unità) produce nessun evidenti prodotti della gamma taglia desiderata (10-100 bp) e 5.5-7.5 unità prodotto ancora frammenti che sono in media troppo a lungo. Maggiori quantità di enzima (50 unità) portare a eccessiva degradazione dell'input del DNA dopo 10 min. Di conseguenza, un importo intermedio è stato scelto (10 unità). Il digest è stato scalato per produrre abbastanza digerito frammenti per purificazione successiva e la clonazione (Figura 2B). Mentre si raccomanda di selezionare ciecamente frammenti di DNA di dimensioni e fare affidamento solo sulla scaletta del DNA per l'orientamento per ridurre al minimo l'esposizione dei frammenti del DNA a luce UV, gel può essere macchiato in seguito per il controllo di qualità di taglio e di digestione. Figura 2B Mostra un esempio rappresentativo di un gel di pagina da cui DNA frammenti tra 20 e 30 bp sono stati asportati. Gel purificato MNase frammenti sono stati caricati su un 20% di gel di PAGE per controllare la selezione della dimensione successo e purificazione dei frammenti MNase-digerito (Figura 2). Il protocollo a portata di mano è compatibile con l'uso di sequenze personalizzate del linker, che permette di clonare i frammenti MNase-digerito in vettori di espressione gRNA di scelta. Qui, gRNA-PLKO9 è stato usato come spina dorsale. Il linker è amplificato dal vettore di espressione gRNA utilizzando standard di PCR. Figura 2D raffigura un esempio rappresentativo di sequenze amplificate del linker privo di ulteriori, non corretto o nessun ampliconi di modello. Successivamente, del linker ampliconi sono digeriti con enzimi di restrizione per garantire linker sono legati sui frammenti MNase-digerito con l'orientamento corretto. Figura 2D Mostra gel di agarosio di linkers 5' e 3' prima e dopo digestione con HindIII e SacII rispettivamente, che indica la digestione completa del linker per il predetto 637 e 295 bp. La parte destra dell'immagine gel documenta l'asportazione dei frammenti digeriti del linker. Segue gel estrazione di linkers digerito, il passo successivo nel protocollo è la legatura di linkers ai frammenti digeriti MNase fine-riparato. Poiché sequenze del linker vengono generati mediante PCR utilizzando primers unphosphorylated, auto-legatura di linkers non dovrebbe verificarsi. Solo i frammenti di DNA digerito MNase fine-riparate forniscono i gruppi fosfato necessari per la legatura. A seguito di traduzione di nick, il prodotto di legatura è amplificato dalla PCR. Al fine di evitare un'eccessiva polarizzazione di amplificazione PCR che poteva deformare la rappresentazione delle sequenze gRNA nella libreria, l'amplificazione è limitata a meno di 20 cicli in totale. A seguito di PCR, i prodotti di amplificazione sono difficili da visualizzare sui gel dell'agarosi. Controllo separato PCRs con 32 cicli vengono pertanto eseguite per rilevare i prodotti (ma non vengono utilizzati per la preparazione di biblioteca). Risultati da questo controllo PCR sono mostrati in Figura 2E. Questo consente di ottimizzare le reazioni di legatura e di garantire reazioni sono privi di manufatti PCR, che a volte si verificano in "nessun controllo di frammenti" (NFC). Figura 2E dimostra l'amplicone desiderata (5' linker + frammento di DNA + 3' linker, lunghezza: 869 bp) seguendo l'amplificazione delle reazioni di legatura utilizzando equimolari (1:1) rapporti tra frammenti e sequenze del linker.

Figure 1
Figura 1 : Suggerito timeline per la preparazione di una libreria di gRNA. CORALINA offre una strategia semplice e conveniente per la generazione di librerie di gRNA completa da una pletora di diverse fonti di DNA da alcun organismo. Il protocollo a portata di mano può essere portato a compimento nel corso di una settimana lavorativa. Generazione del linker possa essere eseguite in parallelo con fine-riparazione del DNA. Preparazione di electrocompetent batteri prende due giorni e comprende una fase di crescita durante la notte e pertanto deve essere avviato prima del montaggio le reazioni sono impostate. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Fasi critiche durante il protocollo. (A) Controlled digestione del DNA di BAC consente la generazione di frammenti di dimensioni diverse. Qui è illustrata l'ottimizzazione della digestione MNase. DNA di BAC purificato è stata trattata con diverse quantità di MNase per 10 min. 10 U di MNase generare frammenti di DNA della lunghezza desiderata (20-30 bp). (B) taglia selezione di frammenti tra 20 e 30 bp usando l'asportazione dal gel di poliacrilammide. DNA di BAC purificato è stata trattata con 10 U di MNase per 10 min. L'immagine è stata registrata a seguito dell'asportazione. (C) controllo di qualità dei frammenti purificati di gel. Dopo purificazione del gel, 1/6th della MNase purificata frammenti è stato caricato su un 20% di gel di PAGE per controllare la selezione della dimensione successo e purificazione. (D) amplificazione delle sequenze del linker per assemblaggio e degli enzimi di limitazione nella digestione del linker affinché la clonazione direzionale. 5' e 3' linker sono stati amplificati e tagliare con HindIII e Silvio, rispettivamente. Controlli del modello di no (NTC) sono stati inclusi per controllo per manufatti PCR e contaminazione da DNA. Sinistra: applicazione di esempio analitico; destra: applicazione di esempio preparativa. Immagine è stata registrata dopo l'asportazione del gel. (E) legatura successo di linkers di frammenti di DNA possa essere analizzata usando la PCR con un aumento del numero di cicli di PCR (32) e controllato da non eseguire controlli del modello con H2O (NTC) o utilizzando le NTC dal passaggio precedente nick traduzione come input (NTC NT)). È importante includere un nessun frammento controllo (NFC), che è un'amplificazione da una legatura e la reazione di traduzione di nick da cui sono stati omessi i frammenti di MNase. Solo i campioni in cui MNase frammenti sono stati combinati con linker DNA producono l'amplicone previsto (869 bp). Clicca qui per visualizzare una versione più grande di questa figura.

Discussion

CORALINA può essere utilizzato per generare librerie gRNA su larga scala tramite digestione controllata nucleasi del DNA bersaglio e clonazione di frammenti incagliati doppi risultanti in massa. Inferenza statistica indica che molti più di 107 gRNA singole sequenze hanno già stati clonati con successo utilizzando il protocollo a mano9. CORALINA può essere personalizzato in vari modi. La scelta del modello del DNA definisce la regione di destinazione e la massima complessità della biblioteca generata. Usando questo protocollo, CORALINA librerie precedentemente sono state generate dall'essere umano e del mouse di DNA genomic9. Risultati rappresentativi presentati qui raffigurano la generazione di una libreria CORALINA da DNA purificato di BAC. Ulteriore personalizzazione può essere raggiunto dalla scelta delle sequenze di vettore e del linker espressione gRNA. In precedenza abbiamo testato tre diverse paia di lunghezze del linker per assembly Gibson con piccole variazioni in efficienza9.

Dovuto la loro origine dal DNA digerito alla rinfusa, protospacer di CORALINA gRNAs non sono solitamente esattamente 20 bp in lunghezza, ma Visualizza una distribuzione di lunghezza con una media che dipende da entrambi i parametri della digestione MNase nonché la dimensione dell'asportazione effettuata dal gel pagina s. l'esempio rappresentativo, mostrato in Figura 2B e C, raffigura frammenti con una lunghezza mediana tra 19 e 27 bp. Nella nostra esperienza, la lunghezza dei frammenti è conservata fedelmente dalla gRNA generato protospacer9. Mentre frammenti più breve di 20 bp dovrebbe essere evitato a causa di più alto tasso di fuori bersaglio di gRNAs risultante, frammenti più lunghi sono probabilmente molto meno di un problema per le applicazioni a valle, poiché è stato dimostrato che gRNAs con protospacers fintanto che 45 bp sono ancora funzionale9.

I due passaggi più critici nel protocollo CORALINA sono la selezione della dimensione dei frammenti MNase-digerito e procedura di clonazione. Generazione di frammenti che sono troppo brevi (ad es. media inferiore a 18 bp) o incorporazione di vettori di espressione vuota gRNA troppi renderà la libreria inutile. Pertanto, è importante ottimizzare la fase di digestione di MNase (Figura 2A), per monitorare l'asportazione (Figura 2B, C), controllare per digestione completa del backbone gRNA vettoriale e non compresi controlli di frammento in tutto il protocollo. Speciale cura deve anche essere adottate per preservare la rappresentazione della libreria gRNA. Un collo di bottiglia comune di generazione della libreria è in generale il trasferimento efficiente di plasmidi in batteri per l'amplificazione. Così, grandi quantità di batteri con eccellente competenza e un gran numero di eventi singoli elettroporazione sono necessari per il raggiungimento di un elevato numero di cloni gRNA.

Nuove strategie per la produzione di gRNA biblioteca sarà necessarie raccogliere tutte le potenzialità di approcci di screening basato su CRISPR per i prossimi decenni. C'è una forte domanda di metodi conveniente, semplice e personalizzabile per generare librerie su larga scala, un pre-requisito per fare lo screening favorevoli a un maggior numero di sistemi modello e differenti approcci di ingegneria basati su CRISPR. CORALINA sta fornendo un primo passo verso questo. Le possibilità di utilizzo sono molteplici, soprattutto per la produzione di librerie complete di genomi, cDNA derivati librerie di meno comuni sistemi modello, biblioteche altamente focalizzate e set-up sperimentale nel quale diverse proteine CRISPR (con differenti PAM requisiti) sono usati in combinazione.

A differenza di altri metodi, CORALINA genera tutte le possibili gRNAs dall'ingresso del DNA. Tuttavia, uno svantaggio del metodo è che gRNAs manca la sequenza desiderata di PAM sono anche inclusi nella libreria, una caratteristica che condivide con un secondo metodo enzimatico per la generazione della libreria gRNA, CRISPR-mangiare (tabella 1). La scelta del metodo ideale per la generazione della libreria gRNA dipende dalle specifiche dello screening programmato sperimentare, soprattutto la natura (genica, regolamentazione, intergenica) e dimensione dell'area di destinazione (singolo locus, più regioni, genoma). Vediamo un rialzo speciale utilizzando CORALINA quando un gran numero di non-codificazione o regioni regolatorie devono essere analizzati, se c'è informazioni di sequenza incompleta o inaffidabile (sistemi di modello esotico, miscugli di specie (ad es. microbiomi) o ottenuti sperimentalmente l'input), se si combinano diverse endonucleasi CRISPR o saturando l'analisi viene eseguita su un locus breve e definito (ad esempio rappresentato da BACs).

Disclosures

Gli autori non hanno nulla a rivelare.

Acknowledgments

Gli autori piacerebbe ringraziare Dr. Stephan Beck e Prof. Dr. Magdalena Goetz per il loro contributo, guida e supporto nello sviluppo del metodo CORALINA, Maximilian Wiessbeck e Valentin Baumann per utili commenti. L'opera è stata sostenuta da DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Un protocollo universale per gRNA su larga scala produzione di libreria da qualsiasi fonte di DNA
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter