Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Ett universellt protokoll för storskaliga gärna biblioteket produktion från någon DNA-källa

doi: 10.3791/56264 Published: December 6, 2017

Summary

Metoder för att skapa storskaliga gärna bibliotek bör vara enkel, effektiv och kostnadseffektiv. Vi beskriver ett protokoll för produktion av gärna bibliotek baserat på enzymatisk nedbrytning av mål-DNA. Denna metod, CORALINA (omfattande gärna biblioteket generationen genom kontrollerad nuclease aktivitet) presenterar ett alternativ till kostsamma anpassade oligonukleotiden syntes.

Abstract

Populariteten av CRISPR/Cas9 systemet för både genomet och epigenomet teknik härrör från dess enkelhet och anpassningsförmåga. En effektor (den Cas9 nuclease eller ett nuclease-döda dCas9 fusionsprotein) riktas till en specifik plats i genomet av en liten syntetisk RNA kallas för guide RNA, eller gärna. Bipartit beskaffenhet CRISPR systemet gör det möjligt för dess användning i screening metoder sedan plasmid bibliotek innehållande uttryck kassetter av tusentals enskilda gRNAs kan användas för att förhöra många olika webbplatser i ett enda experiment.

Hittills har har gärna sekvenser för byggandet av biblioteken genererats nästan uteslutande av oligonukleotiden syntes, som begränsar genomförbara komplexiteten i sekvenser i biblioteket och är förhållandevis kostnadsintensiv. Här ett detaljerat protokoll för CORALINA (omfattande gärna biblioteket generationen genom kontrollerad nuclease aktivitet), en enkel och kostnadseffektiv metod för generering av mycket komplexa gärna bibliotek baserat på enzymatisk nedbrytning av tillförda DNA, beskrivs. Eftersom CORALINA bibliotek kan genereras från någon källa av DNA, finns gott om alternativ för anpassning, möjliggör ett stort utbud av CRISPR-baserade skärmar.

Introduction

Anpassning av det bakteriella CRISPR/Cas9-systemet som en molekylär inriktning verktyg orsakade den senaste revolutionen i molekylärbiologi. Aldrig tidigare har det varit så lätt att manipulera kromatin på definierade genomisk platser. Vanliga tillämpningar av CRISPR inkluderar riktade genen mutationer1, genomet engineering2, epigenomet redigera3, transkriptionell aktivering och nedtystning4. En särskild fördel med CRISPR systemet är att dess tillämpningar inte är begränsat till väl studerat kandidat platser, som gärna bibliotek gör mindre partisk skärmar möjligt. Dessa underlättar upptäckten av funktionella loci i genomet utan några experimentella förkunskaper. Dock gärna biblioteket konstruktion är för närvarande mestadels baserad på oligo-nukleotid syntes, och det finns begränsade alternativ att köpa gärna bibliotek som inte är av mänskliga eller mus ursprung eller mål regioner utanför öppna läsning ramar. Således, även om CRISPR skärmar har redan visat sig otroligt potent5,6,7,8, sin fulla potential har ännu inte har utnyttjats.

För att övervinna begränsning av klassiskt gärna generation metoder två strategier har nyligen utvecklats. Båda är baserade på kontrollerade enzymatisk nedbrytning av målet DNA i stället för att förlita sig på anpassade oligonukleotiden syntes. Medan CORALINA9 sysselsätter micrococcal nuclease, endast tillgängliga alternativa metoden, CRISPR-äta10, använder sig av restriktionsenzym (HpaII, ScrFI, Bfajag och Mmejag). Ännu viktigare, kan båda teknikerna tillämpas på alla ingående DNA, som fungerar som källa av gärna protospacer sekvenser. Medan metoden CRISPR-ätande sysselsätter en strategi för att minska antalet klonade gRNAs vars inriktning platser inte följs av krävs S.pyogenes PAM (protospacer angränsande motiv), det genererar bara en bråkdel av alla möjliga funktionell gRNAs för en viss region. CORALINA, däremot, kan generera alla potentiella gRNAs för sekvensen källa, men innehåller också en högre andel av icke-funktionella guider. Gärna biblioteket generation genom kontrollerad nuclease aktivitet möjliggör produktion av omfattande gärna bibliotek för alla arter, alla Cas9-protein eller -effektor system på ett enkelt och kostnadseffektivt sätt. Dessutom är CORALINA anpassningsbar till anpassning, som lämpliga indata och vektor val definiera bibliotek typ, storlek och innehåll. Här presenteras ett detaljerat protokoll som kan användas för generering av omfattande gärna bibliotek från olika källor av DNA (figur 1), inklusive bakteriella artificiella kromosomer (BACs) eller genomisk DNA9. De representativa resultat som åtföljer detta protokoll härleddes genom att tillämpa protokollet CORALINA BAC DNA.

Protocol

1. nedbrytning av DNA med Micrococcal Nuclease

  1. Utföra en optimering reaktion för varje ny omgång micrococcal nuclease enzym (MNase).
    Anmärkning: Antalet enheter av MNase används bör testas (med en seriell utspädning, figur 2A). Vanligtvis 5-10 U av MNase smälta 1 µg av renat genomisk eller BAC DNA ner till en rad 5-100 bp med villkor som beskrivs nedan.
  2. Per reaktion, ställa in 1 µL 10 x MNase buffert, 1 x bovint serumalbumin (BSA), 1 µg av mål-DNA, 1 µL MNase (0,1-50 enheter) i en 10 µL reaktionsvolym.
  3. Inkubera vid 37 ° C i 15 min.
  4. Omedelbart inaktivera enzymet genom att lägga till 1 µL 500 mM etylenglykol-bis(β-aminoethyl ether)-N, N, N', N'-tetraacetic acid (EGTA).

2. separation av DNA fragment med polyakrylamid gelelektrofores (sidan)

  1. Lägg provet buffert/gel lastning dye till DNA-prover och lasta på en 20% sida gel. Läsa in en lämplig DNA-stege för dimensionering (5 bp DNA stege). Överbelasta inte gelen (1 µg DNA per brunn).
  2. Köra geler i lämpliga 1 x TRIS-Borat-EDTA (TBE) kör buffert på 150 V (konstant) för runt 1,5 h eller tills lägre färgämne (bromophenol blå, mörk blå färg) som färdas på runt 15 bp, når den nedre änden av gelen.
  3. Fläcken gelen med en ytterst känsliga nukleinsyra fläcken och visualisera i UV-belysning.
  4. Gel bilden, för att bestämma den optimala koncentrationen av MNase för smälta DNA ner till 20-30 bp i storlek.
  5. Använda optimerad koncentrationen av MNase för att smälta mål-DNA genom att upprepa steg 1.2-2.2. Vanligtvis, rötas ställa in 10-12 reaktioner (dvs. 10-12 µg totalt utgångsmaterial) kommer att ge tillräckligt DNA efter sida gel extraktion för att fortsätta till efterföljande steg.
  6. Med en steril skalpell, klipp gelen bredvid markör körfältet och fläcken endast del av gel som innehåller stegen med färsk 1 x TBE rinnande buffert innehållande 1 X av en ytterst känsliga nukleinsyra fläcken. Visualisera DNA stege och punktskatt MNase-rötas DNA-fragment i storleksintervallet mellan cirka 18-30 bp med hjälp av ett rakblad.
    Obs: Undvik att utsätta MNase rötas fragment för UV-ljus. ”Det är möjligt att använda en blå ljuskälla (i stället för UV) eller ta en bild av stegen i UV-belysning, skriva ut den för att skala och använda detta för att vägleda excision av MNase-rötas DNA-fragment). Detta steg undviker färgning och DNA-fragment exponering för UV-ljus. Använd alltid en oanvänd, sterila disponibla skalpell eller rakblad för det här steget för att undvika kontaminering.
  7. Överföra gel segmentet i en mikrocentrifug rör.
  8. Färga resten av gelen med nukleinsyra fläck som ovan, utsätta för UV-ljus och spela in en bild för att föra ett register över steget gel excision.

3. isolering av DNA-fragment från sida-geler med Crush och blöt metod

Obs: Detta steg har antagits från Sambrook et al. 11

  1. Förbereda sidan gel lösbarhet buffert (1,88 mL 4 M ammoniumacetat, 150 µL av 1 M magnesium acetat, 30 µL 0,5 M etylendiamintetraättiksyrans dinatriumsalt (EDTA) (pH 8) i ultrarena H2O till en total volym på 15 mL).
  2. Krossa exciderad gel skiva mot väggen mikro-centrifugröret med hjälp av en steril pipettspetsen.
  3. Lägg till 2 gel volymer av lösbarhet sidbufferten och inkubera vid 37 ° C i 16 h på en roterande plattform.
  4. Centrifugera proverna för 1 min på högsta hastighet i en mikrocentrifug. Överför supernatanten till en ny mikrocentrifug rör, noga med att inte överföra någon krossade gel bitar.
  5. Lägg till 0,5 volymer sida lösbarhet buffert till gelen pellet, vortex, och upprepa centrifugeringen (steg 3,4). Kombinera supernatanterna.
  6. Extrahera DNA fragmenten använder standard fenol-kloroform extraktion.
    FÖRSIKTIGHET: Fenol är giftigt om det kommer i kontakt med hud eller förtäring. Säkerhetsåtgärder såsom handskar, skyddsglasögon, en labbrock och arbeta i dragskåp är kritiska. Bortskaffa alla fenol-innehållande avfall enligt institutets regler.
    1. Lägga till en volym av fenol: kloroform: isopentanol (25:24:1) i provet och vortex grundligt.
    2. Centrifugera i 10 min vid högsta hastighet (16 000 x g) i en bordsskiva Centrifugera vid rumstemperatur. Noggrant överföra övre vattenfasen till en färsk mikrocentrifug rör. Se till att inte föra över eventuella fenol under pipettering.
    3. Upprepa steg 3.6.1 och 3.6.2 en gång.
    4. Lägga till en liten mängd (0.2 µL) av glykogen, 0.1 volymer 3 M natriumacetat (pH 5.2) och 2 volymer av 100% etanol (EtOH).
    5. Vortex och inkubera vid-20 ° C under flera timmar eller över natten.
    6. Centrifugera under 30 minuter på högsta hastighet vid 4 ° C med en bordsskiva centrifug.
    7. Ta försiktigt bort supernatanten och tvätta DNA pelleten med 70% EtOH.
    8. Centrifugera under 30 minuter på högsta hastighet vid 4 ° C med en bordsskiva centrifug.
    9. Avlägsna supernatanten och lufttorka DNA pelleten. Se till att alla EtOH har avdunstat men var noga med att inte alltför torr pelleten.
    10. Lös upp DNA pelleten i 12 µL av H2O.
      Obs: Sidan gel utvinning är mycket ineffektiv. För varje 10 µg av börjar DNA smältas med MNase, räkna med att återställa 1-20 ng av renat fragment efter gel extraktion. Kontrollera beloppet och integritet av fragment av laddar 1/6th (2 µL) på en sida gel (figur 2 c).

4. avsluta reparation av MNase-smält, Gel-renat fragment

  1. Ställ in följande reaktion med hjälp av ett DNA avtrubbning kit: 10 µL av renade DNA från steg 3.6.10, 1,5 µL 10 X avtrubbning buffert, 1,5 µL av 1 mM dNTP mix, 0.6 µL av avtrubbning enzym, 1,4 µL av H2O.
  2. Inkubera vid 22 ° C i 30 min och sedan värme-inaktivera enzymet genom inkubation vid 70 ° C i 10 min.
  3. Lägga till 85 µL av H2O och utföra en reaktion sanering med hjälp av standard fenol/kloroform-extraktion och EtOH-nederbörd (som beskrivs i avsnitt 3.6). Gå omedelbart till länkaren ligering.

5. linker Generation

Obs: Linkers behöver förstärkas parallellt med avsnitt 3 för att kunna fortsätta omedelbart med linker ligering. Primer-sekvenser som används nedan måste vara lämplig för den valda gärna uttryck vektorn. De presenteras här har utformats för den vektor pgRNA-pLKO.1. 9 för förstärkning av 5' länkaren från pgRNA-pLKO.1, använda primer sekvenser 5'-linker-F (TTGGAATCACACGACCTGGA) och 5'-linker-R (CGGTGTTTCGTCCTTTCCAC), vilket ger en 689 bp-amplikon. För förstärkning av 3' länkaren från pgRNA-pLKO.1, använda primers 3'-linker-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) och 3'-linker-R: (ACTCGGTCATGGTAAGCTCC), som ger en 848 bp-amplikon.

  1. PCR-Förstärk adaptern sekvenser från gärna uttryck vektorn (med reagenser av val och anpassade primer sekvenser, om det behövs). För pgRNA-pLKO.1 ställa in följande 50 μl PCR-reaktion: 25 µL av PCR-master mix, 2,5 µL av primer F (10 µM), 2,5 µL av primer R (10 µM), 0,1 ng av gärna uttryck vektor (pgRNA-pLKO.1) i H2O.
  2. Inkubera reaktioner på en termocykler med följande villkor: 1 cykel 98 ° C i 30 s, 32 cykler 98 ° C för 10 s, 59 ° C för 10 s, 72 ° C under 30 s, 1 cykel 72 ° C i 10 min.
  3. Rena PCR-reaktioner med fasta fasen reversibel immobilisering pärlor enligt tillverkarens anvisningar. Eluera i 30 µL H2O.
  4. Att genomdriva riktad ligering av länkaren till slutet-repareras, MNase-rötas DNA fragmenten, digest linkers med lämpliga restriktionsenzym (här HindIII och SacII). Ställ in följande reaktioner:
    1. För matsmältningen för 5' linker med HindIII, Använd 30 µL av renat 5' linker amplikon från steg 5.3., 5 µL buffert, 3 µL av HindIII (20U/µL) och 12 µL av H2O.
    2. För rötning av 3' länkare med SacII, använda 30 µL av renat 3' linker amplikon från steg 5.3., 5 µL buffert, 3 µL av SacII (20 U/µL), och 12 µL av H2O.
  5. Inkubera smälter vid 37 ° C i 3 h.
  6. Lägg till DNA gel lastning färgämne och kör de restriktionsenzym smälter på en 1% agarosgel. Punktskatt banden på 637 bp (linker digest 5') och 295 bp (linker digest 3').
  7. Rena DNA från exciderad gel bitarna med en gel utvinning kit.

6. linker ligering och förstärkning av skär

  1. Ställa in en 14 µL ligering reaktion med equimolar mängder MNase-smält, slutet-repareras fragment och länkare sekvenser.
    Obs: Linker till fragment nyckeltal kan optimeras. Det rekommenderas att inkludera en no-fragment kontroll (NFC) reaktion.
    1. Använd 5 ng MNase-rötas fragment (slutet-repareras och renad), 120 ng för 5' linker (HindIII digest, renat), 55 ng 3' länkare (SacII digest, renat), 1,4 µL av T4 ligase buffert och 1.4 µL av koncentrerad T4 DNA-ligase i H2O.
  2. Inkubera ligering reaktionerna vid 16 ° C i 16 h. Gör inte värme-inaktivera enzymet. Gå omedelbart till nick-översättning.
    Obs: Slut reparerade MNase-rötas fragmenten ger 5' fosfater behövs för ligering av linkers, som länkaren är själva un-fosforyleras.
  3. Till ligering reaktion (och NFC reaktionen) Lägg till följande: 25 µL av Taq 2 X master mix (kan nick översättning), 2,5 µL av primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µL av primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) och 6 µL H2O.
  4. Inkludera en no-mall kontroll (NTC). Inkubera reaktioner på en termocykler med följande villkor: 1 cykel (nick översättning): 72 ° C i 20 min, 1 cykel: 95 ° C i 5 min, 3-4 cykler: 95 ° C under 15 s, 58 ° C för 15 s, 72 ° C under 30 s, 1 cykel: 72 ° C i 5 min.
  5. Utföra en reaktion sanering med fasta fasen reversibel immobilisering pärlor med ett prov till bead förhållandet 1:1. Eluera i 40 µL H2O.
  6. Ytterligare förstärka önskade fragmentet (5' linker + MNase fragment + 3 ' linker) använda lämpliga PCR reagens och följande grundfärger:
    1. Använd 12,5 µL av PCR-master mix, 1,25 µL av primer Linker-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 1.25 µL av primer Linker-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), 2,5 µL av renat nick översättning produkt från steg 6,4. och 7,5 µL av H2O. använda följande villkor: 1 cykel: 98 ° C i 30 s, 10-16 cykler: 98 ° C för 10 s, 63 ° C för 10 s, 72 ° C under 15 s, 1 cykel: 72 ° C i 10 min.
      Obs: Om det behövs flera reaktioner kan ställas in parallellt till att det finns tillräckligt PCR-produkten för efterföljande steg. För att visualisera små mängder av PCR-produkten på en agarosgel, ställa in ytterligare reaktioner som i steg 6,5 och öka antalet cykel från 15 till 32. Denna reaktion kan användas som kvalitetskontroll, om amplikoner inte syns efter 15 cykler. Inkludera också en ingen mall kontroll (NTC).

7. storlek urval

Obs: Detta steg skiljer MNase-fragment med korrekt bifogade 5' och 3' länkaren från fragment med två 5' eller två 3' linkers baserat på storlek.

  1. Kombinera alla 15-cykla PCR reaktioner från steg 6.5., lägga till DNA lastning färgämne och köra på en 0,8% agarosgel. Punktskatt framstående bandet på 869 bp och rena DNA med en gel utvinning kit.
  2. Kvantifiera mängden DNA (t.ex. med en spektrofotometer).

8. kloning av PCR-förstärkta fragment i gärna uttryck vektor av Gibson församling

  1. Förbered montering master mix enligt följande:
    Obs: Följande är anpassade från Gibson et al. 12.
    1. Skapa 6 mL isotermiska reaktion buffert genom att kombinera 3 mL 1 M Tris (hydroxymetyl) aminometan (Tris)-HCl pH 7.5, 300 µL av 1 M MgCl, 60 µL av 100 mM deoxyguanosine trifosfat (dGTP), 60 µL av 100 mM deoxyadenosin adenosintrifosfat (dATP), 60 µL av 100 mM deoxythymidine adenosintrifosfat (dTTP), 60 µL av 100 mM deoxycytidine trifosfat (dCTP), 300 µL av 1 M Ditiotreitol (DTT), 1,5 g polyetylenglykol (PEG)-8000, 300 µL av 100 mM nikotinamid-adenin-dinukleotid (NAD) i ultrarena H2O.
      Obs: Denna buffert kan vara aliquoted och lagras vid-20 ° C.
    2. Skapa 1,2 mL församlingen huvudmixen genom att kombinera 320 µL av 5 X isotermiska reaktion buffert, 3 µL av 10 U/µL T5 exonuclease, 20 µL av 2 U/µL DNA-polymeras, 160 µL av 40 U/µL DNA-ligase i ultrarena H2O. användning 15 µL av församlingen master mix med 5 µL sätt.
      Obs: Församlingen huvudmixen kan vara aliquoted och lagras vid-20 ° C, där det är stabil för mer än ett år och kan tolerera flera frysning-tining cykler. Mängden valda T5 exonuclease är idealisk för användning med långa överhäng.
  2. Vector ryggraden matsmältningen
    Obs: Kontrollera att smälta en tillräcklig mängd vektor som indata för önskat antal församlingen reaktioner i steg 8,3.
    1. Per reaktion, Lägg till följande: 1,5 µg gärna uttryck vektor (pgRNA-pLKO.1), 5 µL buffert, 1,5 µL ålderjag (5U/µL), och 38,5 µL av H2O. Inkubera smälta vid 37 ° C i 2 h.
  3. Defosforylering av linearized vektor.
    Obs: Detta steg är klokt, men inte strikt nödvändigt. T5 exonuclease i huvudmixen kommer mestadels att ta bort den åldernjag överhäng innan den Taq-DNA-ligase har haft en chans att agera. Därför förväntas inte överdriven re ligering av vektorn.
    1. Tillsätt 2,5 µL av räkor alkaliskt fosfatas enzym (åtgärdsprogrammet, 1 U/µL).
    2. Inkubera vid 37 ° C i 30 min och sedan inaktivera enzymet genom inkubation vid 65 ° C i 5 min.
  4. Utföra DNA rening
    Obs: Det rekommenderas att utföra en agaros gel utvinning steg. Alternativt, kolumn- eller pärla rening kan användas. Det är viktigt att kontrollera att vector matsmältningen är komplett, e.g. av agaros gelelektrofores. För jämförelse, osmält vektor bör köras parallellt.
  5. Kvantifiera mängden renat smält vektor i provet.
  6. Ställ in församlingen med 2-faldig molar överskott av skär till vektor. Per 20 µL reaktion använda 100 ng av vektor (ålderjag smälta från steg 8,5), 12,2 ng av Infoga (från steg 7.1.), 15 µL av församlingen master mix från steg 8.1.2. i H2O.
  7. Inkubera vid 50 ° C för 1 h.
  8. Rena de reaktioner som använder kolumnen rening. Återsuspendera DNA i 75 µL av H2O (eller lämplig volym beroende på omfattning av elektroporation).
    Obs: Förvandling effektivitet är kraftigt beroende av DNA renhet. Ytterligare reningssteg (t.ex. fenol/kloroform extraktion) kan förbättra effektiviteten.

9. beredning av Electro-behöriga TG1 E. coli celler

  1. Säkerställa att alla Centrifugera flaskor och kolvar är fria från rengöringsmedel av sköljning och efterföljande fyllning med destillerat vatten före autoklavering.
    Obs: Detta steg hjälper till att avlägsna eventuella föroreningar som kan påverka förvandling effektivitet. Vatten ska kasseras omedelbart före användning. Användning av disponibel centrifugering flaskor kan alternativt vara tillrådligt.
  2. Säkerställa att centrifug flaskor, rör och lösningar som används för beredning av electrocompetent celler är kyld på is före användning. Det är bäst att genomföra följande steg i ett kallt rum att minimera temperaturvariationer som kan påverka förvandling effektivitet.
  3. Förbereda 2TY medium. 16 g bacto trypton lägga 10 g av jästextrakt och 5 g NaCl, destillerat vatten till 1 L, mix och autoklav. Store medium vid rumstemperatur.
  4. Förbereda 2TY-agar belagda bioassay rätter och 10 cm petriskålar som innehåller anslåantibiotikummen. Lagra plattor vid 4 ° C.
    Obs: Valet av antibiotika beror på arten av gärna uttryck vektorn, användning 100 µg/mL ampicillin för pgRNA-pLKO.1.
  5. Skrapa en lagervara glycerol TG1 celler att Inokulera 10 mL 2TY medium (utan antibiotika).
  6. Inkubera kultur vid 37 ° C över natten (~ 16 h) med skakningar vid 225 rpm.
  7. Inokulera 1 L 2TY medium (utan antibiotika) med övernattning kultur (1/100 utspädning) 10 mL och dela det lika mellan två 2 L kolvar (innehållande bafflar).
  8. Inkubera kultur vid 37 ° C, 225 rpm tills en OD600 nm 0,55 uppnås (ungefärligt efter 1,5-2 h). Använd en spektrofotometer för att regelbundet kontrollera OD600 nm.
  9. Chill kulturer på is i 30 min.
  10. Dela kultur lika mellan 4 500 mL centrifug flaskor (pre kyld på is).
  11. Centrifugera i 15 min vid 4000 x g vid 4 ° C i en pre kyld centrifug.
  12. Dekantera supernatanterna och Lägg till 1 volym (dvs. 250 mL) av pre kylda iskall sterilt destillerat H2O varje centrifug flaskor. Återsuspendera pelleten bakteriell genom virvlande eller invertera flaskan (eller genom skonsam pipettering, om det behövs).
    Obs: Det är lättare att återsuspendera pelleten genom att först lägga en liten mängd vatten. Säkerställa pelleten är helt resuspended så småningom.
  13. Centrifugera under 15 minuter vid 4000 x g vid 4 ° C.
  14. Upprepa tvätten två gånger (steg 9.12. och 9.13). Ta bort supernatanten. Var försiktig när dekantering som bakteriell pelleten blir alltmer löst efter tvätt.
  15. Återsuspendera pelleten i 50 mL steril, iskall 10% glycerol och överföra det till ett pre kylda 50 mL centrifugrör.
  16. Centrifugera celler för 15 min vid ~ 4000 x g vid 4 ° C. Ta försiktigt bort supernatanten.
  17. Försiktigt resuspendera bakterierna i 2 mL iskallt steril 10% glycerol.
  18. Hålla på is om cellerna ska användas omedelbart för elektroporation.
    Obs: Cellerna kan frysas i alikvoter av 50 µL i 0,5 mL rör i badkar torris etanol och lagras vid-80 ° C, men detta rekommenderas inte.

10. elektroporation TG1 Electrocompetent E. coli celler

Obs: Elektroporation är en av flaskhalsarna i omfattande bibliotek generation. För att bevara bibliotek representation, det rekommenderas att utföra lika många enskilda elektroporation reaktioner som nödvändigt/möjligt och att utföra kvalitetskontroll stegen som beskrivs nedan (10.6. och 10.8.).

  1. Alikvotens renat reaktionerna (från steg 8,8) in i sterila och pre kylda PCR-rör och hålla dem på isen (1 µL per rör). Chill 1 mm gap elektroporation kyvetter på is.
  2. Tillsätt 25 µL av nylagade TG1 celler direkt till en alikvot av DNA och omedelbart överför blandningen till en elektroporation kyvetten. Svep eller tryck den kyvetten för att säkerställa celler/DNA mixen är fördelade längs längden av kyvetten kammaren (utan någon instängd luft eller bubblor).
  3. Placera kyvetten i bild kammaren och starta programmet lämpliga elektroporation (t.ex. 1 puls 1,8 kV (EC1)).
    Obs: Tidskonstanten ska ligga mellan 5,7 och 6.0 ms. Ifall electroporator bågarna, svepa kyvetten, kontrollera det inte finns några luftbubblor i kammaren och försök igen.
  4. Tillsätt omedelbart 975 µL av rumstemperatur 2TY medium i kyvetten.
  5. Med överföring pipett flytta electroporated bakterier till en 50 mL tub. Upprepa från steg 10.2. och samla alla celler förvandlas med ett bibliotek i en 50 mL tub.
  6. Dokumentera den totala volymen.
  7. Kvalitetskontroll steg
    1. För att kvantifiera behörighetsområde nyligen genererade electro-behöriga cellerna, utföra en separat elektroporation reaktion med en definierad mängd uncut plasmid DNA (t.ex. 10 pg pUC19 kontrollplasmid). Överför detta till ett 1,5 mL mikrofugrör.
      Obs: Kompetensen ska vara minst 1010 kolonibildande enheter (cfu) per µg DNA. Nylagade celler utför vanligen bättre än detta.
  8. Inkubera transformerad bakterier vid 37 ° C i 60 min skakar vid 225 rpm.
  9. Kvalitetskontroll steg:
    1. Plåt en definierad liten mängd bakterier omvandlas med biblioteket (t.ex. 10 µL av en 10-100 faldig utspädning) på en 10 cm agarplatta med lämpligt antibiotikum urval.
      Obs: Att känna total kultur volymen (från steg 10,6.), kan antalet erhållna koloni användas för att uppskatta det totala antalet kolonier för hela biblioteket. 20-30 gånger representation av biblioteket bör helst bibehållas.
  10. Skingra återstoden av bakterier på 2TY agar belagda bioassay rätter som innehåller lämpliga antibiotika markeringen.
    Obs: Volymen av kultur kan minskas genom centrifugering vid ~ 4000 x g i 10 minuter (eller tills en synlig pellet har bildats och supernatanten visas tydligt). Detta minskar den tid som tallrikar behöver torka efter spridning av kultur. Användning av plattor i stället för flytande kultur minimerar oproportionerlig tillväxt av enskilda kolonier. 13
  11. Sprida en lämplig volym av pUC19 kontroll elektroporation reaktionen på en ytterligare 10 cm agar maträtt med lämpligt antibiotikum urval.
  12. Inkubera agarplattor över natten (16 h) vid 37 ° C.
  13. Räkna erhållna kolonier på kontroll plattorna (pUC19 och kontroll bibliotek plattan) att uppskatta CFU/µg DNA för bakterier samt bibliotek komplexitet.

11. utvinning av Plasmid DNA

  1. Tillsätt 10 mL 2-TY media till övernattning plattorna, skrapa bakteriell lagret av plattan med en disponibel spridare och samla det i en 50 mL tub. Upprepa ett par gånger tills all plattan visas ren.
  2. Extrahera DNA med hjälp av en Plasmid Maxi kit (2-3 kolumner behövs per Bio-assay tallrik).

Representative Results

Använder protokollet till hands, har CORALINA gärna bibliotek genererats från människa och mus genomisk DNA9 och BAC DNA (figur 1). För att producera fragment av ingående DNA lämplig för kloning i gärna uttryck vektorer, har optimala förutsättningar för kontrollerad nuclease-nedbrytning skall fastställas. Ett typiskt resultat för optimering av micrococcal nuclease-nedbrytning avbildas i figur 2A. Otillräcklig mängd nuclease (0,1, 2, 3, 4, 4,5 eller 5 enheter) producerar ingen märkbar produkter i intervallet krävs storlek (10-100 bp) och 5,5-7,5 enheter produceras fortfarande fragment som är i genomsnitt för lång. Större mängder enzym (50 enheter) leda till kraftig försämring av input DNA efter 10 min. Därför valdes ett mellanliggande belopp (10 enheter). Digest var skalas upp för att producera tillräckligt rötas fragment för efterföljande rening och kloning (figur 2B). Även om det rekommenderas att blint välja DNA-fragment av storlek och bara lita på DNA stege för läggning att minimera exponering av DNA-fragment för UV-ljus, kan geler färgas efteråt för kvalitetskontroll av matsmältningen och skärning. Figur 2B visar ett representativt exempel på en sida gel från vilka DNA fragment mellan 20 och 30 bp har blivit censurerade. Gel renat MNase fragment lastades på en 20% sida gel för att kontrollera framgångsrika storlek urval och rening av MNase-rötas fragment (figur 2 c). Protokollet till hands är förenlig med användningen av anpassade linker sekvenser, gör det möjligt för att klona MNase-rötas fragment i gärna uttryck vektorer av val. Här användes gärna-PLKO9 som ryggrad. Linkers förstärks från gärna uttryck vektorn med standard PCR. Figur 2D skildrar ett representativt exempel på förstärkta linker sekvenser saknar ytterligare, felaktig eller ingen mall amplikoner. Nästa, länkare amplikoner smälts med restriktionsenzym att säkerställa linkers är sammanskrivna på MNase-rötas fragment i rätt riktning. Figur 2D visar agaros gel av 5' och 3' linkers före och efter rötning med HindIII och SacII respektive anger fullständig nedbrytning av linkers till de förutspådda 637 och 295 bp. Den högra delen av bilden gel dokumenterar excision av smält linker fragment. Följande gel utvinning av smält linkers, nästa steg i protokollet är ligering av linkers till slutet reparerade MNase-rötas fragment. Eftersom linker sekvenser genereras av PCR använder unphosphorylated primers, bör själv ligering av linkers inte uppstå. Endast slutet reparerade MNase-rötas DNA fragmenten ger de nödvändiga för ligering fosfatgrupper. Efter nick översättning, ligatur produkten är förökas med PCR. För att undvika överdriven PCR-amplifiering partiskhet som kunde skeva representationen av gärna sekvenser i biblioteket, är förstärkning begränsad till mindre än 20 cykler totalt. Efter PCR är förstärkning produkter svårt att visualisera på agaros gel. Separat kontroll primärvården med 32 cykler utförs därför för att identifiera produkterna (men används inte för bibliotek förberedelse). Resultaten från denna kontroll PCR visas i figur 2E. Detta tillåter att optimera ligering reaktionerna och säkerställa reaktioner saknar PCR artefakter, som ibland förekommer i ”inga fragment kontroller” (NFC). Figur 2E visar den önskat Amplikonen (5' linker + DNA-fragment + 3' länkare, längd: 869 bp) efter amplifiering av ligering reaktioner med equimolar (1:1) förhållandet mellan fragment och länkare sekvenser.

Figure 1
Figur 1 : Föreslog tidslinje för att förbereda ett gärna bibliotek. CORALINA erbjuder en enkel och kostnadseffektiv strategi för generering av omfattande gärna bibliotek från en uppsjö av olika DNA källor från någon organism. Protokollet till hands kan föras till färdigställande under en arbetsvecka. Linker generation kan utföras parallellt med DNA-slutet-reparation. Beredning av electrocompetent bakterier tar två dagar och inkluderar en övernattning tillväxt steg och bör därför inledas innan montering reaktioner ställs in. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Kritiska moment under protokollet. (A) kontrollerade rötning av BAC DNA möjliggör generering av fragment av olika storlekar. Här visas optimering av MNase matsmältningen. Renat BAC DNA behandlades med olika mängder av MNase för 10 min. 10 U MNase generera DNA fragment av önskad längd (20-30 bp). (B) storlek urval av skärvor som är mellan 20 och 30 bp använder excision från polyakrylamidgeler. Renat BAC DNA behandlades med 10 U av MNase i 10 min. Bilden spelades efter excision. (C) kvalitetskontroll av gel-renat fragment. Efter gel-rening, 1/6th av den renade MNase fragment var lastas en 20% sida gel att kontrollera framgångsrika storlek urval och rening. (D) förstärkning av linker sekvenser för montering och restriktionsenzym rötning av linkers att säkerställa riktad kloning. 5' och 3' linkers var förstärkt och skär med HindIII och SacII, respektive. Nr-mall kontroller (NTC) ingick att kontrollera för PCR-artefakter och DNA kontaminering. Vänster: analytisk Exempelprogrammet; höger: preparativ exempelprogrammet. Bild spelades efter gel excision. (E) framgångsrika ligering av linkers till DNA-fragment kan analyseras med PCR med ett ökat antal PCR-cykler (32) och kontrolleras av utför ingen mall kontroller med H2O (NTC) eller med hjälp av NTC från föregående nick översättning steg som indata (NTC NT)). Det är viktigt att inkludera en ingen fragment kontroll (NFC), som är en förstärkning från en ligatur och nick översättning reaktion som MNase fragment utelämnades. Bara prover i vilka MNase fragment har kombinerats med linker DNA producera den förväntade kopian (869 bp). Klicka här för att se en större version av denna siffra.

Discussion

CORALINA kan användas för att generera stor skala gärna bibliotek genom kontrollerad nuclease-nedbrytning av mål-DNA och bulk kloning av resulterande dubbel strandsatta fragment. Statistisk inferens indikerar att många fler än 107 individuella gärna sekvenser har redan varit framgångsrikt klonat använder protokollet vid hand9. CORALINA kan anpassas på flera sätt. Valet av DNA-templat definierar målregionen och maximal komplexiteten i det genererade biblioteket. Användning av detta protokoll, CORALINA bibliotek tidigare har genererats från människa och mus genomiskt DNA9. Representativa resultat presenteras här skildrar generering av ett CORALINA bibliotek från renat BAC DNA. Ytterligare anpassning kan uppnås genom valet av gärna uttryck vektor och linker sekvenser. Vi har tidigare testat tre olika par linker längder för Gibson montering med små variationer i effektivitet9.

På grund av deras ursprung från bulk rötas DNA, protospacer av CORALINA gRNAs är oftast inte exakt 20 bp i längd, men Visa en längd fördelning med ett medelvärde som beror både på parametrarna för MNase matsmältningen samt storleken på excision görs från sidan gelen s. representativa exemplet i figur 2B och C, skildrar fragment med en median längd mellan 19 och 27 bp. Vår erfarenhet bevaras troget längden av fragment av den genererade gärna protospacer9. Medan fragment kortare än 20 bp bör undvikas på grund av högre off-target resulterande gRNAs, längre fragment är sannolikt mycket mindre av ett problem för nedströms tillämpningar, eftersom det har visat att gRNAs med protospacers så länge som 45 bp är fortfarande funktionella9.

De två mest kritiska steg i protokollet CORALINA är storlek val av MNase-rötas fragment och kloning steg. Generation av fragment som är för korta (e.g. genomsnittet under 18 bp) eller införlivandet av alltför många tomma gärna uttryck vektorer kommer att göra biblioteket värdelös. Därför är det viktigt att optimera steget MNase matsmältning (figur 2A), att övervaka excision (figur 2B, C), kontrollera för fullständig nedbrytning av gärna vektor ryggraden och inklusive inga fragment kontroller i hela protokollet. Särskild omsorg måste också vidtas för att bevara framställningen av gärna biblioteket. En gemensam flaskhalsen i biblioteket generation är i allmänhet effektiv överföring av plasmider in bakterier för förstärkning. Således, stora mängder bakterier med utmärkt kompetens och ett stort antal enskilda elektroporation händelser är nödvändigt för att uppnå ett högt antal gärna kloner.

Nya strategier för gärna biblioteket produktion kommer att vara nödvändigt att skörda den fulla potentialen av CRISPR-baserad screening metoder under de kommande decennierna. Det finns en betydande efterfrågan på kostnadseffektiva, enkla och anpassningsbara metoder att generera storskalig bibliotek, en förutsättning att göra screening kan bli föremål för ett större antal modellsystem och olika CRISPR-baserade engineering tillvägagångssätt. CORALINA tillhandahåller ett första steg mot detta. De potentiella användningsområdena är många, särskilt för att producera omfattande bibliotek av genomen, cDNA härrör bibliotek av mindre vanliga modellsystem, mycket fokuserad bibliotek och experimentella uppställningar i vilka olika CRISPR-proteiner (med olika PAM krav) används i kombination.

Till skillnad från andra metoder genererar CORALINA alla möjliga gRNAs från ingången DNA. En nackdel med metoden är dock att gRNAs saknar sekvensen som behövs PAM ingår också i biblioteket, en funktion som den delar med en andra enzymatisk metod för gärna biblioteket generation, CRISPR-ätande (tabell 1). Valet av den idealiska metoden för gärna biblioteket generation beror på specifikationerna för planerade screeningen experimentera, särskilt natur (genic, tillsyn, intergenic) och storlek av målregionen (single locus, flera regioner, genome-wide). Vi ser en särskild upp i använda CORALINA när ett stort antal icke-kodande eller regulatoriska regioner skall analyseras, om det finns ofullständiga eller otillförlitliga sekvensinformation (exotiska modellsystem, blandningar av arter (t.ex. microbiomes) eller experimentellt erhållna ingång), om olika CRISPR endonucleases kombineras eller om mättar analys utförs på ett kort och definierade locus (e.g. representeras av BACs).

Disclosures

Författarna har något att avslöja.

Acknowledgments

Författarna vill tacka Prof. Dr. Stephan Beck och Prof. Dr Magdalena Goetz för deras insats, hjälp och stöd i att utveckla metoden CORALINA, Maximilian Wiessbeck och Valentin Baumann för hjälpsamma kommentarer. Arbetet har stötts av DFG (STR 1385/1-1).

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Ett universellt protokoll för storskaliga gärna biblioteket produktion från någon DNA-källa
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter