Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Büyük ölçekli gRNA Kütüphane üretim herhangi bir DNA kaynaktan için evrensel bir iletişim kuralı

doi: 10.3791/56264 Published: December 6, 2017

Summary

Büyük ölçekli gRNA kitaplıkları oluşturmak için yöntemleri basit, verimli ve maliyet-etkin olmalıdır. Biz gRNA kütüphaneler hedef DNA Enzimatik sindirim üzerinde dayalı üretim için bir iletişim kuralı tanımlamak. Bu yöntem CORALINA (kapsamlı gRNA Kütüphane üretimi kontrollü nükleaz faaliyetleri ile) pahalı özel Oligonükleotid sentezi için bir alternatif sunuyor.

Abstract

Genom ve epigenome mühendisliği için CRISPR/Cas9 sistemi popülerlik onun sadelik ve adaptasyon kaynaklanıyor. Bir efektör (Cas9 nükleaz veya nükleaz ölü dCas9 füzyon proteini) tarafından Kılavuzu RNA veya gRNA olarak bilinen küçük bir sentetik RNA genomu belirli bir sitedeki hedeflenmektedir. CRISPR sistem önerebilirim doğası plazmid kitaplıkları içeren ifade kaset binlerce bireysel gRNAs tek bir deney birçok farklı sitelerdeki sorgulamak için kullanılabilir beri yaklaşımlar eleme içinde kullanımı sağlar.

Bugüne kadar gRNA dizileri kitaplıkları inşası için neredeyse sadece kütüphane serilerinde ulaşılabilir karmaşıklığı sınırlar ve görece maliyet yoğun Oligonükleotid sentezi tarafından üretilmedi. Burada, ayrıntılı bir protokol CORALINA (kapsamlı gRNA Kütüphane üretimi kontrollü nükleaz faaliyetleri ile), basit ve son derece karmaşık gRNA kütüphaneler nesil için düşük maliyetli yöntemi, giriş DNA Enzimatik sindirim üzerinde temel açıklanan. DNA'ın herhangi bir kaynaktan CORALINA kütüphaneleri oluşturulabilir beri pek çok seçenek özelleştirme için çok çeşitli ekranlar CRISPR tabanlı etkinleştirme mevcuttur.

Introduction

Bakteriyel CRISPR/Cas9 sistem adaptasyonu moleküler hedefleme aracı olarak Moleküler biyolojide en son devrim neden oldu. Daha önce hiç Kromatin tanımlanmış genomik yerlerde işlemek çok kolay. CRISPR ortak uygulamalar arasında hedeflenen gen mutasyonlar1, genom mühendislik2,3, transkripsiyon harekete geçirmek ve4susturmak gen düzenleme epigenome. GRNA kütüphaneler daha az önyargılı ekranlar mümkün kılmak gibi bir belirli CRISPR sistem uygulamaları iyi okudu aday sitelere sınırlı değildir avantajdır. Bunlar olmadan herhangi bir ön deneysel bilgi genom içinde işlevsel loci keşfi kolaylaştırmak. Ancak, gRNA Kütüphane inşaat şu anda çoğunlukla oligo-nükleotit sentezi dayanır ve insan değildir gRNA kütüphaneler satın almak için sınırlı seçenekler ya da fare kaynak veya hedef bölgeleri dışında çerçeveler okuma açık. CRISPR ekranlar zaten inanılmaz güçlü5,6,7,8, kanıtlanmış ancak böylece, kendi potansiyellerini henüz istismar değil.

Üstesinden gelmek için klasik gRNA nesil yöntemleri iki stratejileri sınırlandırılması son zamanlarda geliştirilmiştir. Her ikisi de hedef DNA üzerinde özel Oligonükleotid sentez güvenerek daha kontrollü Enzimatik sindirim temel alır. İken CORALINA9 micrococcal nükleaz, sadece mevcut alternatif yöntem10CRISPR yiyen, geçici kullanma-enzimleri (HpaII, ScrFben Bfaben ve Mmeben). Önemlisi, her iki teknik gRNA protospacer dizileri kaynağı olarak hizmet veren giriş DNA var mı, uygulanabilir. CRISPR yiyen yöntemi klonlanmış gRNAs gerekli S.pyogenes PAM (protospacer bitişik güdü) hedefleme olan siteleri takip sayısını azaltmak için bir strateji iken, tüm olası fonksiyonel gRNAs için sadece küçük bir kısmını oluşturur bir belirli bölge. CORALINA, öte yandan, kaynak sırası için tüm olası gRNAs oluşturmak yapabiliyor ama aynı zamanda işlevsel olmayan kılavuzları daha yüksek bir kısmını içermektedir. gRNA Kütüphane üretimi kontrollü nükleaz faaliyetleri ile sağlar kapsamlı gRNA kütüphaneleri herhangi bir tür için üretim herhangi bir Cas9-protein veya - efektör sistemi basit ve maliyet-etkin bir şekilde. Ayrıca, kitaplık türü, boyutu ve içerik uygun giriş ve vektör seçenekleri tanımlamak gibi CORALINA özelleştirme için uyarlanabilir. Burada ayrıntılı bir protokol bu anlatılan bakteriyel yapay kromozomu (BACs) veya genomik DNA9dahil olmak üzere nesil DNA (şekil 1), farklı kaynaklardan gelen kapsamlı gRNA kitaplıkları için kullanılabilir. Bu iletişim kuralı eşlik eden temsilcisi sonuçları BAC DNA'yı CORALINA Protokolü uygulayarak elde edilmiştir.

Protocol

1. sindirim Micrococcal nükleaz ile DNA'ın

  1. Bir en iyi duruma getirme reaksiyon micrococcal nükleaz enzim (MNase) yeni her toplu işlem için gerçekleştirin.
    Not: MNase kullanılan birim sayısını ( şekil 2Abir seri dilüsyonu kullanılarak) test edilmelidir. Genellikle, 5-10 MNase U sindirmek, 1 µg genomik saf veya BAC DNA 5-100 bp koşulları ile bir dizi aşağı aşağıda açıklanmıştır.
  2. Reaksiyon 10 MNase arabellek x, 1 sığır serum albumin (BSA), DNA, MNase 1 µL hedefinin 1 µg x 1 µL ayarlayın (0,1-50 adet) 10 µL tepki birimindeki.
  3. 15 dakika 37 ° C'de kuluçkaya.
  4. Hemen enzim 500 mm etilen glikol-bis(β-aminoethyl ether)-N, N, N 1 µL ekleyerek devre dışı bırakın ', N'-tetraacetic asit (EGTA).

2. DNA ayrılması Polyacrylamide Jel Elektroforez (sayfa) kullanarak parçaları

  1. Örnek arabellek/jel boya DNA örnekleri için yükleme ekleyin ve % 20 sayfa jel yük. Boyutlandırma için uygun bir DNA merdiveni yük (5 bp DNA merdiven). Jel (1 µg DNA iyi başına) aşırı değil.
  2. Bp, 1,5 s çevresinde veya 15 civarında seyahat alt boya açık (bromophenol mavi, koyu mavi renk) kadar ulaştığı için jel alt sonuna jelleri uygun 1 x TRIS-Bor-EDTA (TBE) çalışan arabellekte 150 V (Sabit) çalıştırın.
  3. Bir ultra-duyarlı nükleik asit leke kullanarak jel leke ve UV ışığı altında görselleştirin.
  4. Jel görüntüden MNase optimum konsantrasyonu boyutu 20-30 kan basıncı aşağı sindirim DNA'ın belirlemek.
  5. MNase en iyi duruma getirilmiş konsantrasyonu adımları 1.2-2.2 tekrar ederek hedef DNA sindirmek için kullanın. Genellikle, 10-12 kadar reaksiyonlar (Yani 10-12 toplam malzeme başlayan µg) yeterli verim ayarlama sonraki adımlarına devam etmek için DNA sayfa jel ayıklama takip sindirilir.
  6. Steril neşter kullanarak, jel marker lane yanında kesmek ve sadece merdiven içeren 1 X bir ultra-duyarlı nükleik asit leke taze 1 x TBE çalışan ile tampon içeren jel parçası leke. DNA merdiven görselleştirmek ve MNase sindirilmiş DNA parçalarının yaklaşık 18-30 kan basıncı jilet kullanarak arasında boyut aralığındaki tüketim.
    Not: MNase sindirilmiş parçaları UV ışık için kullanılmasını önlemek. Bu mavi bir ışık kaynağı (UV) yerine kullanın veya UV altında merdivenin fotoðraf, ölçeği ve eksizyon MNase sindirilmiş DNA parçalarının kılavuzunu kullanma bu yazıcıya yazdırma mümkündür). Bu adımı boyama ve DNA parçalarının ışığa maruz kalma UV önler. Her zaman bir kullanılmayan, steril tek kullanımlık bistüri veya jilet için bu adımı kirlenmesini önlemek için kullanın.
  7. Microcentrifuge tüp jel dilim aktarın.
  8. Jel geri kalanı ile nükleik asit leke leke, UV ışığına maruz ve jel eksizyon adım bir kaydını tutmak için bir görüntü kaydetmek.

3. sayfa-jelleri Crush ve emmek yöntemi kullanarak gelen DNA parçalarının yalıtım

Not: Bu adımı Sambrook et al. kabul edilmiştir 11

  1. Sayfa jel solubilization arabellek (4 M amonyum asetat, 150 µL 1 M magnezyum asetat, 0, 5 M ethylenediaminetetraacetic asit (EDTA) (pH 8) ultrasaf H2O 15 mL toplam hacmiyle 30 µL 1.88 mL) hazırlayın.
  2. Steril pipet ucu kullanarak mikro-santrifüj tüpü duvara eksize jel dilim ezmek.
  3. 2 sayfa solubilization arabellek hacimleri jel ve dönen bir platform üzerinde 16 h için 37 ° C'de kuluçkaya ekleyin.
  4. Örnekleri için bir microcentrifuge maksimum hızda 1 dk santrifüj kapasitesi. Süpernatant herhangi bir ezilmiş jel adet aktarmak için dikkat çekici bir yeni microcentrifuge tüp için transfer.
  5. 0,5 eklemek sayfa solubilization arabelleğe jel hacimleri cips, girdap ve (Adım 3.4) aralıklarla tekrarlayın. Supernatants birleştirmek.
  6. Standart fenol kloroform ayıklama kullanarak DNA parçaları ayıklayın.
    Dikkat: Fenol deri ile temas gelirse ya da yutulması halinde toksiktir. Güvenlik önlemleri eldiven, koruyucu gözlük, önlük ve duman mahallede çalışma gibi kritik öneme sahiptir. Enstitü nün düzenlemelere göre tüm fenol içeren atık imha.
    1. Fenol: kloroform: izoamil alkol (25:24:1) bir birim örnek ve girdap iyice ekleyin.
    2. Santrifüj 10 dk içinde oda sıcaklığında masa üstü bir santrifüj maksimum hızda (16.000 x g) için. Dikkatle üst sulu faz taze microcentrifuge tüp aktarın. Üzerinde herhangi bir fenol pipetting sırasında taşımak için değil, kendine iyi bak.
    3. 3.6.1 ve bir kez 3.6.2 adımları yineleyin.
    4. Az miktarda glikojen, 3 M sodyum asetat (pH 5.2) 0.1 birimleri (0.2 µL) ekleyin ve % 100 etanol (alkol) 2 cilt.
    5. Girdap ve birkaç saat için-20 ° C'de kuluçkaya veya bir gece.
    6. Masa üstü bir santrifüj kullanarak 4 ° C'de maksimum hızda 30 dk santrifüj.
    7. Dikkatle süpernatant kaldırmak ve DNA Pelet % 70 ile yıkayın alkol.
    8. Masa üstü bir santrifüj kullanarak 4 ° C'de maksimum hızda 30 dk santrifüj.
    9. DNA Pelet kurumasına ve süpernatant çıkarın. Tüm alkol buharlaşıp vardır emin olun ama Pelet aşırı kuru değil dikkatli olun.
    10. DNA Pelet H2o 12 µL içinde erimesi
      Not: Sayfa jel ayıklama çok verimli değildir. 1-20 ng arıtılmış parçalarının jel çıkarma sonra kurtarmak DNA ile MNase sindirilmiş başlayan her 10 µg için bekliyoruz. Denetim tutar ve parçaları bütünlüğünü 1/6inci yükleyerek (2 µL) üzerinde bir sayfa jel (şekil 2C).

4. son MNase sindirilmiş, jel saf parçaları tamiri

  1. Kit blunting bir DNA'yı kullanarak aşağıdaki tepki kadar ayarla: Adım 3.6.10, 10 blunting tampon, 1 mM dNTP Mix 1,5 µL, 0.6 µL azalmanın enzim, H2O. 1.4 µL X 1,5 µL saf DNA'ın 10 µL
  2. 30 dk 22 ° C'de kuluçkaya ve sonra ısı-enzim kuluçka 10 dk 70 ° C'de tarafından devre dışı bırakabilirsiniz.
  3. H2O 85 µL ekleyin ve bir reaksiyon standart fenol/kloroform-ekstraksiyon ve alkol-yağış (3.6 bölümünde anlatıldığı gibi) kullanarak temizlik yapmak. Derhal bağlayıcı ligasyonu için gidin.

5. bağlayıcı üretimi

Not: Bölüm 3 hemen bağlayıcı ligasyonu ile devam edebilmek için paralel olarak kuvvetlendirilmesine halkalı gerekir. Aşağıda kullanılan astar dizileri seçilen gRNA ifade vektör için uygun olmalıdır. Bu burada sunulan vektör pgRNA-pLKO.1 için tasarlanmıştır. 9 astar dizileri 5'-bağlayıcı-F (TTGGAATCACACGACCTGGA) ve 5'-bağlayıcı-689 bp amplicon verimli R (CGGTGTTTCGTCCTTTCCAC), pgRNA-pLKO.1 üzerinden 5' bağlayıcı amplifikasyon için kullanın. PgRNA-pLKO.1 üzerinden 3' bağlayıcı amplifikasyon için astar 3'-bağlayıcı-F: (GTTTTAGAGCTAGAAATAGCAAGTTAAAATA) ve 3'-bağlayıcı-R: (ACTCGGTCATGGTAAGCTCC), hangi bir 848 bp amplicon verim kullanın.

  1. PCR yükseltmek (gerekirse seçim ve özel astar sahneleri, reaktifler kullanarak) gRNA ifade öğesinden bağdaştırıcı diziler. PgRNA-pLKO.1 aşağıdaki 50 µL PCR tepki kadar ayarlamak için: 25 µL PCR ana mix, astar F 2.5 µL (10 µM), 2,5 µL astar R (10 µM), 0.1 ng gRNA ifade vektör (pgRNA-pLKO.1) H2O.
  2. Aşağıdaki koşullar kullanarak bir thermocycler reaksiyonlar kuluçkaya: 1 geçiş yapmak için 30 98 ° C s, 32 devredir 98 ° C 10 s, 10 59 ° C s, 30 72 ° C s, 1 çevriminde 72 ° C 10 dak.
  3. Katı faz ters çevrilebilir immobilizasyon boncuk üretici yönergelerine göre kullanarak PCR reaksiyonları arındırmak. H2o 30 µL içinde elute
  4. Sonunda tamir, MNase sindirilmiş DNA parçalarının bağlayıcıya, Özet bağlayıcı uygun (burada HindIII ve SacII) enzimleri ile yön ligasyonu zorlamak için. Aşağıdaki reaksiyonlar ayarlayın:
    1. 5' bağlayıcı HindIII ile sindirim için saflaştırılmış 5' bağlayıcı amplicon adım 5.3 30 µL kullanın., 5 µL arabellek, HindIII (20U/µL) 3 µL ve H2o 12 µL
    2. 3' bağlayıcı SacII ile sindirim için saflaştırılmış 3' bağlayıcı amplicon adım 5.3 30 µL kullanın., 5 µL arabelleği, SacII 3 µL (20 U/µL) ve H2o 12 µL
  5. 3 h için 37 ° C'de digests kuluçkaya.
  6. DNA jel boya yükleme ekleyin ve restriksiyon enzimi özetler bir % 1'özel jel çalıştırın. 637, bantları tüketim bp (5' bağlayıcı Özet) ve 295 bp (3' bağlayıcı Özet).
  7. Bir jel ekstraksiyon kiti kullanarak eksize jel adet DNA'dan arındırmak.

6. bağlayıcı ligasyonu ve ekler amplifikasyon

  1. MNase sindirilmiş, sonunda tamir parçaları ve bağlayıcı sıraları ekimolar miktarda kullanarak 14 µL ligasyonu tepki kadar ayarla.
    Not: Bağlayıcı parçası oranları için optimize edilmiş olması. Bu bir Hayır-fragment denetim (NFC) tepki eklemek önerilir.
    1. (Son tamir ve saf) MNase sindirilmiş parçaları, 120 kullanım 5 ng ng 5' bağlayıcı (safHindIII Özet,), 55 ng 3' bağlayıcı (SacII Özet, saf), T4 ligaz arabellek 1.4 µL ve konsantre T4 DNA ligaz H2O. 1.4 µL
  2. Tüp ligasyonu reaksiyonlar için 16 h 16 ° C'de kuluçkaya. Yapmak değil enzim ısı devre dışı. Derhal nick-çeviri için gidin.
    Not: Sonunda tamir MNase sindirilmiş parçaları fosfatlar 5' gerekli sağlamak için ligasyonu halkalı, bağlayıcı kendileri un fosforile olan.
  3. İçin ligasyonu reaksiyon (ve NFC reaksiyon) aşağıdakileri ekleyin: Taq 2 25 µL ana mix (nick tercümesi kabil) X, 2.5 µL astar bağlayıcı-Minus450-F (10 µM, GGGCAAGTTTGTGGAATTGG), 2,5 µL astar bağlayıcı-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC) ve 6 µL H2O.
  4. Bir no-şablonu denetimi (NTC) içerir. Aşağıdaki koşullar kullanarak bir thermocycler reaksiyonlar kuluçkaya: 1 döngüsü (nick çeviri): 72 ° C 20 dk, 1 döngüsü için: 95 ° C 5 dk, 3-4 döngüleri için: 15 95 ° C s, 15 58 ° C s, 30 72 ° C s, 1 döngüsü: 72 ° C 5 min için.
  5. Bir reaksiyon katı faz ters çevrilebilir immobilizasyon boncuk boncuk oranı 1:1 bir örnek ile kullanarak temizlik gerçekleştirin. H2o 40 µL içinde elute
  6. Daha da yükseltmek istediğiniz parça (5' bağlayıcı + MNase + 3 parçası ' bağlayıcı) aşağıdaki astar ve uygun PCR reaktifler kullanarak:
    1. 12.5 µL PCR ana mix, astar bağlayıcı-Minus450-F 1,25 µL kullanın (10 µM, GGGCAAGTTTGTGGAATTGG), 1,25 µL astar bağlayıcı-Plus275-R (10 µM, AAGTGGATCTCTGCTGTCCC), saflaştırılmış nick çeviri ürün--dan adım 6.4 2.5 µL. ve H2O. 7.5 µL kullanın aşağıdaki koşullar: 1 döngüsü: 30 98 ° C s, 10-16 döngüleri: 10 98 ° C s, 10 63 ° C s, 72 ° C 15 s, 1 döngüsü: 72 ° C 10 dk için.
      Not: gerekirse, çeşitli tepkiler paralel olarak sonraki adımlar için yeterli PCR ürünü sağlamak için ayarlanabilir. PCR ürünü az miktarda bir özel jel üzerinde görselleştirmek için 32 15 döngü sayısını artırmak ve adım 6.5 gibi ek reaksiyonlar ayarlayın. Amplicons 15 döngüsünden sonra görünür değilse bu reaksiyon kalite kontrol kullanılabilir. Ayrıca bir şablonu kontrol (NTC) içerir.

7. Boyut seçimi

Not: Bu adımı MNase parçaları doğru ekli 5' ve 3' bağlayıcı ile parçaları iki kenarından ayıran 5' veya iki 3' halkalı boyutuna göre.

  1. Tüm 15-döngüsü PCR reaksiyonları adım 6.5 birleştirmek., boya yükleme DNA ekleyin ve üzerinde % 0,8 özel jel çalıştırın. Önemli grup 869, tüketim bp ve bir jel ekstraksiyon kiti kullanılarak DNA arındırmak.
  2. (Bir Spektrofotometre kullanarakörneğin ) DNA miktarını ölçmek.

8. klonlama gRNA Gibson derleme tarafından ifade vektör içine PCR güçlendirilmiş parçalarının

  1. Derleme hazırlamak mix aşağıdaki gibi usta:
    Not: Aşağıdaki adımları Gibson ve ark. adapte olmuşlardır 12.
    1. 1 M Tris (hydroxymethyl) aminomethane (Tris) 3 mL birleştirerek 6 mL izotermal tepki arabelleği oluşturmak-HCl pH 7.5, 1 M MgCl, 60 µL 100 mM deoxyguanosine trifosfat (dGTP), 100 mM deoxyadenosine trifosfat (dATP) 60 µL, 100 mM deoxythymidine 60 µL 300 µL trifosfat (dTTP), 100 mM deoxycytidine trifosfat (dCTP), 1 M dithiothreitol (DTT), polietilen glikol (PEG)-8000, 100 mM Nikotinamid adenin dinükleotit (NAD) ultrasaf H2o 300 µL 1.5 g 300 µL 60 µL
      Not: Bu arabellek bölünmemeli ve -20 ° C'de depolanmış olabilir
    2. 320 µL izotermal tepki arabellek X 5, 10 U/µL T5 eksonükleaz aktivitesi, 2 U/µL DNA polimeraz, derleme ana karışımı ile 5 µL ultrasaf H2O. kullanım 15 µL 40 U/µL DNA ligaz 160 µL 20 µL 3 µL birleştirerek 1.2 mL derleme ana karışımı oluşturmak yerleştirin.
      Not: Derleme ana mix bölünmemeli ve saklı-20 ° C'de nerede fazla bir yıl için kararlı olduğunu ve birden çok donma-çözülme çevrimleri tolere edebilir. T5 eksonükleaz seçilen miktarı uzun çıkıntılar ile kullanmak için idealdir.
  2. Vektör omurga sindirim
    Not: derleme reaksiyonlar 8.3 adımda istediğiniz sayıyı için giriş olarak vektör yeterli miktarda sindirimi emin olun.
    1. Aşağıdaki reaksiyon ekleyin: ı (5U/µL) ve 38.5 µL H2O. Incubate gRNA ifade vektör (pgRNA-pLKO.1), 5 µL arabelleği, yaş1,5 µL 1,5 µg sindirmek için 2 h 37 ° C'de.
  3. Doğrusallaştırılmış vektör dephosphorylation.
    Not: Bu tavsiye, ama kesinlikle gerekli bir adımdır. T5 eksonükleaz ana karışımında çoğunlukla yaşkaldırmak Taq DNA ligaz hareket etmeye fırsat bulamadan çıkıntılar. Bu nedenle, aşırı yeniden ligasyonu Yöneyin beklenmiyor.
    1. Karides alkalen fosfataz enzim (rSAP, 1 U/µL) 2.5 µL ekleyin.
    2. 30 dk 37 ° C'de kuluçkaya ve enzim 65 ° c 5 min için kuluçka tarafından devre dışı bırakabilirsiniz.
  4. DNA arıtma gerçekleştirmek
    Not: Bu bir özel jel ayıklama adımı gerçekleştirmeniz önerilir. Alternatif olarak, sütun veya boncuk arıtma-ebilmek var olmak kullanılmış. Vektör sindirim örneğin özel Jel Elektroforez tarafından eksiksiz olduğunu kontrol etmek önemlidir. Karşılaştırma için sindirilmemiş vektör paralel olarak çalıştırılması gerekir.
  5. Örnek saf sindirilir vektör miktarını ölçmek.
  6. Vektör için derleme ekler logosuna 2 kat molar fazlalığı ile ayarlayın. 20 µL tepki kullanım 100 ng vektörünün (yaş), 8.5 adımından sindirmek başına 12,2 ng, Ekle (adımından 7.1.), adım 8.1.2 derleme ana karışımı 15 µL. H2' O.
  7. 50 ° c için 1 h kuluçkaya.
  8. Sütun arıtma kullanarak reaksiyonlar arındırmak. DNA H2O 75 µL içinde resuspend (veya uygun birim elektroporasyon ölçeğini bağlı olarak).
    Not: Dönüşüm verimliliği DNA saflık üzerinde büyük ölçüde bağlıdır. Ek arıtma adımları (örneğin fenol/kloroform ayıklama) verimliliği artırmak.

9. elektro-yetkili TG1 E. coli hücreleri hazırlanması

  1. Tüm şişeler santrifüj kapasitesi ve şişeler sonraki doldurma ısıyla önce distile su ile durulama ve deterjanlar ücretsiz emin olun.
    Not: Bu adım dönüşüm verimliliği etkileyen herhangi bir kirleri çıkarmak için yardımcı olur. Su kullanımdan hemen önce atılmalıdır. Alternatif olarak, tek kullanımlık Santrifüjü şişe kullanımı tavsiye olabilir.
  2. Santrifüj şişeleri, tüpler ve electrocompetent hücreleri hazırlanması için kullanılan çözümler kullanmak için buz önceden soğutulmuş emin olun. Soğuk bir odada dönüşüm verimliliği etkileyen sıcaklık dalgalanmaları en aza indirmek için aşağıdaki adımları yapmak en iyisidir.
  3. 2TY orta hazırlayın. Bacto tryptone 16 g için 10 g maya özü ve NaCl, 5 g 1 L, mix ve basınçlı kap distile su ekleyin. Mağaza orta oda sıcaklığında.
  4. 2TY-agar kaplı bioassay yemekleri ve 10 cm Petri uygun antibiyotik içeren yemekler hazırlamak. Tabaklar 4 ° C'de depolayın
    Not: Antibiyotik seçimi gRNA ifade vektör, pgRNA-pLKO.1 için kullanım 100 µg/mL Ampisilin niteliğine bağlıdır.
  5. TG1 hücre 2TY orta (olmadan antibiyotik) 10 mL aşılamak için bir gliserol stoktan kazı.
  6. Kültür 37 ° c gece (~ 16 h) 225 rpm'de sallayarak ile kuluçkaya.
  7. 2TY orta (olmadan antibiyotik) 1 litre ile 10 mL (1/100 seyreltme) gecede kültürünün aşılamak ve eşit (perdeler içeren) iki 2 L şişeler arasında bölmek.
  8. Kültür 37 ° c, 225 0,55 bir OD600 nm (yaklaşık 1,5-2 saat sonra) ulaşılana kadar devir/dakika kuluçkaya. Bir Spektrofotometre OD600 nm düzenli olarak denetlemek için kullanın.
  9. Kültürler için 30 dk buzda chill.
  10. Kültür (önceden buzda soğutulmuş) eşit dört 500 ml'lik santrifüj şişe arasında bölünmüş.
  11. Santrifüj, 4.000 x g önceden soğutulmuş bir santrifüj 4 ° C'de 15 dakika.
  12. Supernatants dikkatle boşaltmak ve 1 birim (yani 250 mL) önceden soğutulmuş buz gibi steril distile H2O her santrifüj şişe ekleyin. Bakteriyel Pelet dönen veya şişeyi ters çevirme (veya gerekirse nazik pipetting) resuspend.
    Not: Küçük hacimli su ekleyerek Pelet resuspend daha kolaydır. Pelet sonunda tamamen resuspended emin olun.
  13. Santrifüj, 4.000 x g 4 ° C'de 15 dakika
  14. Yıkama iki kez tekrarlayın (9,12 adımlar. ve 9,13). Süpernatant kaldırın. Bakteriyel Pelet yıkandıktan sonra giderek daha gevşek hale geldikçe decanting dikkatli olun.
  15. Pelet 50 mL steril, buz gibi % 10 gliserol resuspend ve öncesi soğutulmuş 50 mL santrifüj tüpü aktar.
  16. Santrifüj hücreleri, ~ 4.000 x g 4 ° C'de 15 dakika Dikkatli bir şekilde süpernatant çıkarın.
  17. Yavaşça buz gibi steril % 10 gliserol 2 mL bakterilerde resuspend.
  18. Hücreleri hemen adım için kullanılacak ise buz üzerinde tutun.
    Not: Hücreleri olabilir 50 µL 0.5 mL tüpler bir kuru buz etanol banyoda aliquots donup kalan ev ve-80 ° C'de depolanan, ancak bu önerilmez.

10. TG1 Electrocompetent E. coli hücre çoğalmasıyla

Not: Elektroporasyon darboğazlar kapsamlı Kütüphane üretimi biridir. Kitaplığı temsil korumak için bu kadar çok bireysel elektroporasyon reaksiyonlar gerekli/uygulanabilir yapmak için ve aşağıda açıklanan kalite kontrol adımları gerçekleştirmek için tavsiye edilir (10,6. ve 10,8.).

  1. Aliquot arıtılmış tepkiler (Adım 8.8) içine steril ve önceden soğutulmuş PCR tüpleri ve buz (tüp başına 1 µL) saklayın. 1 mm boşluk elektroporasyon cuvettes buz soğuk.
  2. 25 µL taze hazırlanmış TG1 hücrelerinin DNA bir aliquot için doğrudan eklemek ve hemen karışımı bir elektroporasyon küvet aktarın. Flick veya dokunun hücre DNA'sı karışımı sağlamak için küvet küvet haznesi (olmadan herhangi bir kapana kısılmış hava veya baloncuklar) uzunluğu boyunca dağıtılır.
  3. Slayt odasında küvet koyun ve uygun adım programını başlatın (örneğin 1 darbe 1.8 kV (EC1)).
    Not: electroporator yay küvet fiske, odasında hiçbir hava kabarcıkları olduğundan emin olun ve yeniden deneyin diye 5,7 ve 6.0 Bayan arasında zaman sürekli yalan söylemeliyim.
  4. Hemen oda sıcaklığında 2TY orta 975 µL küvet için ekleyin.
  5. Bir aktarım pipet kullanarak, electroporated bakteri 50 mL tüp taşıyın. 10,2 adımları yineleyin. ve bir 50 mL tüp içinde bir kütüphane ile dönüştürülmüş tüm hücreleri toplamak.
  6. Toplam hacim belge.
  7. Kalite kontrol adım
    1. Taze oluşturulan elektro-yetkili hücreleri yetki ölçmek için bir ayrı elektroporasyon tepki kesilmemiş plazmid DNA (örneğin 10 pg pUC19 denetim plazmid) tanımlanmış bir miktar kullanarak gerçekleştirin. Bu 1.5 mL microfuge tüp aktarın.
      Not: En az10 koloni oluşturan başına 10 adet (cfu) µg DNA yetkinlik olmalıdır. Taze hazırlanmış hücreleri genellikle bundan daha iyi performans sağlar.
  8. 60 dk. 225 rpm'de sallayarak için 37 ° C'de dönüştürülmüş bakteri kuluçkaya.
  9. Kalite kontrol adım:
    1. Plaka uygun antibiyotik seçimi ile 10 cm agar tabakta (örneğin 10 10-100 kat seyreltme µL) kitaplığıyla dönüştürülmüş bakteri tanımlanmış az miktarda.
      Not: Toplam kültür birim (adım 10,6) bilerek, elde edilen koloni sayı kolonileri tüm kitaplığı için toplam sayısını tahmin etmek için kullanılabilir. 20-30 kat temsil kitaplığın ideal olarak sağlanmalıdır.
  10. Uygun antibiyotik seçimi içeren 2TY kaplı agar bioassay yemekleri üzerine bakterilerin kalan dağıtmak.
    Not: Kültür hacmi Santrifüjü ~ 4.000 x g 10 dk (veya görünür Pelet oluşturmuştur ve süpernatant temiz görüntüleninceye kadar), tarafından azaltılabilir. Bu plakalar kültürünü yaymak sonra kuruması için gereken zamanı azaltır. Sıvı kültür yerine tabak kullanımı bireysel kolonileri orantısız büyüme en aza indirir. 13
  11. PUC19 denetim elektroporasyon tepki olarak uygun antibiyotik seçimi ile bir ek 10 cm agar çanak uygun bir hacmi yayıldı.
  12. Ağar kaplamalar gecede (16 h) 37 ° C'de kuluçkaya
  13. Elde edilen kolonileri CFU/µg DNA bakteriler için tahmin etmek için denetim plakaları (pUC19 ve Denetim Kitaplığı plaka) Kütüphane karmaşıklık yanı sıra saymak.

11. plazmid DNA ekstraksiyon

  1. 2-TY medya 10 mL gecede plakayı ekleyin, bakteriyel katman tek kullanımlık bir ayırıcı kullanarak plaka kapalı kazımak ve bir 50 mL tüp içinde toplamak. Tüm plaka görünene kadar temiz bir kaç kere tekrar edin.
  2. DNA bir plazmid Maxi Kiti (2-3 sütun biyo-tahlil plaka) kullanarak ayıklayın.

Representative Results

El altında iletişim kuralını kullanarak, CORALINA gRNA kütüphaneler insan ve fare genomik DNA9 ve BAC DNA (şekil 1) üretilmedi. Giriş DNA gRNA ifade vektörel çizimler klonlama için uygun parçaları üretmek için kontrollü nükleaz sindirim için optimal koşullar belirlenmesi gerekir. Tipik bir sonuç micrococcal nükleaz sindirim optimizasyonu için şekil 2Atasvir edilir. Nükleaz yetersiz miktarda (0,1, 2, 3, 4, 4,5-5 birimleri) üretir (10-100 bp) gereken boyut aralığındaki göze çarpan ürün ve 5,5-7,5 birimleri hala üretilen ortalama olarak çok uzun olan parçaları. Enzim (50 adet) daha büyük miktarlarda giriş DNA aşırı düşüşü 10 dk sonra yol. Sonuç olarak, bir ara tutar (10 adet) seçildi. "Denemeler" den yeterince üretmek için parçaları sonraki arıtma ve (şekil 2B) klonlama için sindirilmiş ölçekli. Bu körü körüne DNA parçalarının boyutuna göre seçin ve sadece DNA parçalarının ışığa maruz kalma UV en aza indirmek oryantasyon DNA merdiveninde itimat için tavsiye edilir iken, jelleri sindirim ve kesme kalite kontrolü için daha sonra Boyanabilen. Şekil 2B hangi DNA parçaları arasında 20 ve 30 bp eksize bir sayfa jel temsil edici bir örnek gösterir. Jel saf MNase parçaları başarılı boyutu seçimi ve arıtma MNase sindirilmiş parçaları (şekil 2C) kontrol etmek için sayfa jel % 20 yüklü. İletişim kuralı el altında özelleştirilmiş Bağlayıcı sıraları, MNase sindirilmiş parçaları seçim gRNA ifade vektörel çizimler clone için izin kullanımı ile uyumludur. Burada, gRNA-PLKO9 bel kemiği olarak kullanıldı. Halkalı standart PCR kullanarak gRNA ifade vektör güçlendirilmiş. Şekil 2B güçlendirilmiş Bağlayıcı sıraları ek, yanlış, yoksun veya hiçbir şablon amplicons temsil edici bir örnek gösterilmektedir. Daha sonra bağlayıcı amplicons halkalı doğru yönde MNase sindirilmiş parçaları üzerine bakmaksızın emin olmak için enzimleri ile sindirmek. Şekil 2B özel jelleri 5' ve 3' halkalı, önce ve sonra sindirim HindIII ve SacII ile sırasıyla gösterir gösteren öngörülen 637 ve 295 halkalı tam sindirim kan basıncı. Jel görüntünün sağ kısmı sindirilir bağlayıcı parçaları eksizyon makaleler. Aşağıda sindirilir halkalı çıkarımı jel, halkalı MNase sindirilmiş sonunda tamir parçaları için ligasyonu protokolündeki sonraki adımdır. Bağlayıcı sıraları unphosphorylated primerler kullanılarak PCR tarafından üretmediğinden halkalı öz ligasyonu değil vuku bulmak. Sadece son tamir MNase sindirilmiş DNA parçaları fosfat grupları ligasyonu için gerekli sağlar. Nick çeviri ligasyonu ürün PCR ile güçlendirilmiş. GRNA dizileri kütüphanede gösterimi çarpık aşırı PCR güçlendirme önyargı önlemek için amplifikasyon 20'den az döngüleri toplam sınırlıdır. PCR, amplifikasyon ürünleri özel jeller üzerinde görselleştirmek zordur. Ayrı denetim PCR 32 çevrimleri ile bu nedenle ürünleri algılamak için gerçekleştirilir (ancak Kütüphane hazırlık için kullanılmaz). Bu denetim sonuçlarını PCR şekil 2Eiçinde gösterilen. Bu tüp ligasyonu reaksiyonlar optimize etmek ve reaksiyonlar bazen "hiçbir parçaları denetimlerde" oluşan PCR eserler yoksun sağlamak için sağlar (NFC). Şekil 2E istenen amplicon gösterir (5' bağlayıcı + DNA parçası + 3' bağlayıcı, uzunluk: 869 bp) amplifikasyon ligasyonu reaksiyonların ekimolar (1:1) oranları parçaları ve bağlayıcı sıraları arasında kullanarak takip.

Figure 1
Resim 1 : GRNA kitaplığı hazırlanması için zaman çizelgesi önerdi. CORALINA basit ve maliyet-etkin bir strateji kapsamlı gRNA kitaplıkları oluşturmak için farklı DNA kaynaklardan herhangi bir organizma bir bolluk sunmaktadır. İletişim kuralı el altında tamamlanması sırasında iş günü getirilebilir. Bağlayıcı üretimi, DNA sonu-tamiri ile paralel olarak gerçekleştirilebilir. Electrocompetent bakteri hazırlanması iki gün sürer ve bir gecede büyüme adım içerir ve bu nedenle reaksiyonlar ayarlanır derleme önce başlatılmalıdır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2 : Protokol sırasında kritik adımlar. (A)kontrollü sindirim BAC DNA parçaları farklı boyutlarda nesil sağlar. Burada gösterilen MNase sindirim optimizasyonu olduğunu. 10 dk. 10 U MNase oluşturmak için DNA parçalarının İstenilen uzunlukta (20-30 bp) saf BAC DNA MNase farklı miktarda ile tedavi edildi. (B) boyutu parçaları eksizyon üzerinden polyacrylamide Jeller kullanarak 20 ve 30 bp arasında seçim. Arıtılmış BAC DNA 10 U MNase 10 dk ile tedavi edildi. Görüntü eksizyonu kaydedildi. (C) kalite kontrol, jel saf parçacıkları. Jel-arıtma sonra 1/6th saf MNase parçaları yüklü olduğunu %20 başarılı boyutu seçimi ve arıtma denetlemek için sayfa jel. (D) amplifikasyon halkalı yönlü klonlama emin olmak için derleme ve restriksiyon enzimi hazım için bağlayıcı sıraları. 5' ve 3' halkalı güçlendirilmiş ve HindIII ve SacII, sırasıyla kesti. Hayır-şablonu denetimler (NTC) PCR eserler ve DNA kirlenme için denetime dahil edildi. Sol: analitik örnek uygulama; doğru: partiye hazırlık örnek uygulama. Görüntü Jel kesme sonra kaydedildi. Halkalı DNA parçaları için (E) başarılı ligasyonu PCR artan sayıda PCR döngüsü (32) ile kullanarak ve hiçbir şablon kontrolleri ile H2O (NTC) gerçekleştirme veya önceki nick çeviri adımdaki NTC kullanarak kontrol analiz edilebilir giriş olarak (NTC NT)). Bir amplifikasyon ligasyonu ve nick çeviri tepki içinden MNase parçaları ihmal olan bir parça kontrol (NFC), eklemek önemlidir. Beklenen amplicon hangi MNase Birleşik parçalar bağlayıcı ile DNA örnekleri üretmek sadece (869 bp). Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Discussion

CORALINA hedef DNA kontrollü nükleaz sindirim tarafından büyük ölçekli gRNA kitaplıkları oluşturmak ve elde edilen çift telli parçalarını klonlama toplu için kullanılabilir. İstatistiksel çıkarsama çok fazla 107 bireysel gRNA dizileri zaten başarıyla el9iletişim kuralını kullanarak klonlanmış olduğunu gösterir. CORALINA birden fazla şekilde özelleştirilebilir. Seçtiğiniz şablon DNA bir hedef bölge ve oluşturulan Kütüphane maksimal karmaşıklığı tanımlar. Bu iletişim kuralını kullanan, CORALINA kütüphaneler insandan daha önce oluşturulmuş olan ve genomik DNA fare9. Temsilcisi sonuçları burada sunulan arıtılmış BAC DNA CORALINA kitaplıktan nesil tasvir. Daha fazla özelleştirme gRNA ifade vektör ve bağlayıcı sıraları seçimi ile elde edilebilir. Biz daha önce bağlayıcı uzunlukları Gibson derleme için üç farklı çift küçük farklılıklar nedeniyle verimliliği9' test ettik.

Sindirmek toplu DNA kökenlerine nedeniyle CORALINA gRNAs protospacer değildir genellikle tam olarak 20 bp uzunluğu, ama göstermek her ikisi de bağlıdır bir ortalamaya sahip bir uzunluğu dağıtım MNase sindirim parametrelerinin yanı sıra eksizyon boyutunu yapılan sayfa jel s. şekil 2B ve C, gösterilen temsilcisi örnek parçaları ortalama uzunluğu 19 ve 27 bp arasında gösterilmektedir. Deneyim, parçaları uzunluğu sadakatle oluşturulan gRNA protospacer9tarafından korunur. Süre parçaları 20 kısa bp elde edilen gRNAs daha yüksek hedef kapalı oranı nedeniyle kaçınılmalıdır, uzun parçaları büyük olasılıkla bir sorun olduğundan beri aşağı akım uygulamalarda çok daha az gösterdi o gRNAs protospacers 45 sürece ile kan basıncı hala vardır fonksiyonel9.

CORALINA protokolü en kritik iki adımda MNase sindirilmiş parçaları ve klonlama adımları boyutu yelpazesi vardır. Çok kısa parçaları nesil (örneğin ortalamanın altında 18 bp) veya çok fazla boş gRNA ifade vektörel çizimler birleşme-render Kütüphane işe yaramaz. Böylece, MNase sindirim adım (şekil 2A) en iyi duruma getirmek, eksizyon (şekil 2B, C), izlemek için gRNA vektör omurga tam sindirim için kontrol ve protokol boyunca hiçbir parçası denetimleri de dahil olmak üzere önemlidir. Özel bakım gRNA Kütüphane gösterimi korumak için alınacak have. Kütüphane nesil bir ortak performans sorunu genel olarak plazmid verimli transfer içine bakteri amplifikasyon için var. Böylece, bol miktarda bakteri ile mükemmel yetkinlik ve bireysel elektroporasyon olaylar, çok sayıda gRNA klon yüksek bir sayı elde etmek için gerekli.

GRNA Kütüphane üretim için yeni stratejiler CRISPR tabanlı tarama yaklaşımlar sonraki on yıl boyunca tam potansiyelini hasat için gerekli olacaktır. Önceden tarama mükellef sistemleri modellemek ve CRISPR tabanlı farklı mühendislik yaklaşımlar daha büyük bir dizi yapmak için gerekli büyük ölçekli kütüphaneler, oluşturmak düşük maliyetli, basit ve özelleştirilebilir yöntemleri için önemli bir talep vardır. Bu doğru bir ilk adım CORALINA sağlamaktadır. Potansiyel kullanır manifold özellikle genleri kapsamlı kütüphaneler üretmek için, daha az yaygın model sistemleri kütüphanelerin, son derece odaklanmış kütüphaneler ve hangi farklı CRISPR proteinler (farklı PAM ile deneysel set-up cDNA elde gereksinimleri) birlikte kullanılır.

Diğer yöntemler aksine, CORALINA girişten DNA tüm olası gRNAs oluşturur. Ancak, gerekli PAM sıra eksik gRNAs kütüphanede, gRNA kitaplığı oluşturmak için CRISPR yiyen (Tablo 1) ikinci bir enzimatik yöntem ile paylaşan bir özelliği de eklenmiştir yönteminin bir dezavantajı vardır. İdeal yöntem seçimi gRNA Kütüphane üretimi planlanan tarama özellikleri üzerinde bağlıdır için deneme, özellikle doğa (genetik, düzenleyici, intergenic) ve hedef bölgenin (tek odağı, birden çok bölge, genom çapında) boyutunu. Biz CORALINA kodlamayan, çok sayıda zaman kullanarak özel bir ters görmek veya düzenleyici bölgeleridir çözümlenmesi için eksik veya güvenilmez sırası bilgi ise (egzotik model sistemleri, türleri (örneğin microbiomes) karışımları veya deneysel olarak elde giriş), farklı CRISPR endonucleases birleştirilir veya analiz doyurarak kısa ve tanımlanmış bir odağı (BACs tarafından temsilörneğin ) gerçekleştirilir.

Disclosures

Yazarlar ifşa gerek yok.

Acknowledgments

Yazarlar Prof. Dr. Stephan Beck ve Prof. Dr. Magdalena Goetz onların bilgi için teşekkürler, yardımcı ve CORALINA yöntemi, Maximilian Wiessbeck ve Valentin Baumann yararlı yorumlar için gelişmekte olan destek istiyorum. İş DFG (STR 1385/1-1) tarafından desteklenmiştir.

Materials

Name Company Catalog Number Comments
500 mM EGTA Sigma Aldrich 03777-10G 1.4., Inactivation of Mnase
Novex Hi-Density TBE Sample Buffer Thermo Fisher Scientific LC6678 2.1.
Novex® TBE Gels, 20%, 10 well Thermo Fisher Scientific EC6315BOX 2.1., pre-made 20 % PAGE gel
O'RangeRuler 5 bp DNA Ladder, Thermo Fisher Scientific SM1303 2.1.
Novex® TBE Running Buffer Thermo Fisher Scientific LC6675 2.1., PAGE gel running buffer
Disposable scalpel, sterile VWR  233-5363  2.3., other equivalent reagents may be used
SYBR Green I nucleic acid stain (1000x concentrate in DMSO) Sigma Aldrich
S9430
2.3. +2.5., also available from Thermo Fisher Scientific (S7563)
UltraPure Phenol:Chloroform:Isoamyl Alcohol (25:24:1) Thermo Fisher Scientific 15593-031 3.6.1. + 4.3., other equivalent reagents may be used
Glycogen Sigma 10901393001 3.6.4., other equivalent reagents may be used
3M Sodium acetate , pH5.2 Thermo Fisher Scientific   R1181 3.6.4., other equivalent reagents may be used
Ethanol  3.6.4. + 9.1.8., molecular biology grade
Quick blunting kit  New England Biolabs E1201 4.1.
ammomium acetate Sigma
A1542
3.1., other equivalent reagents may be used
magnesium acetate Sigma
M5661
3.1., other equivalent reagents may be used
0.5 M EDTA (pH 8.0) VWR   MOLEM37465520 (or Promega V4231) 2.2. + 3.1., other equivalent reagents may be used
Agencourt AMPure XP beads Beckman coulter A63881 5.3. + 6.5.
Gel extraction kit QIAGEN 28704 5.7.+ 7.1. +8.4., other equivalent reagents may be used
concentrated T4 DNA ligase New England Biolabs  M0202T 6.1.+ 8.1.2.
Long Amp Taq 2X Master Mix  New England Biolabs M0287S 6.3.
Phusion High-Fidelity PCR Master Mix with HF Buffer New England Biolabs M0531S 5.1. + 6.6., other equivalent reagents may be used
HindIII New England Biolabs R0104S 5.4.1. 
SacII New England Biolabs R0157S 5.4.2.
AgeI New England Biolabs R0552S 8.2.1.
Tris base Sigma 93362 8.1.1.
2M MgCl Sigma 93362 8.1.1.
dGTP,dATP, dCTP, dTTP New England Biolabs N0446S 8.1.1.
DTT Sigam
DTT-RO
8.1.1.
PEG-8000  Sigma
P5413
8.1.1.
NAD Sigma
N6522
8.1.1.
T5 exonuclease New England Biolabs M0363S 8.1.2.
Phusion DNA polymerase  New England Biolabs M0530S 8.1.2.
Taq DNA ligase New England Biolabs M0208L 8.1.2.
rSAP New England Biolabs M0371S 8.3.1.
TG1 competent cells Lucigen 60502-1 9.1.
1mm gap electroporation cuvettes  VWR 732-2267  10.2.
Bio-Assay Dish (Polystyrene, 245 mm x 245 mm x 25 mm) Fisher Scientific DIS-988-010M  9.4.
NaCl Sigma S7653  9.3.
Bacto-tryptone BD 211705 9.3.
Yeast extract BD 212750 9.3.
Agar Sigma
A1296
9.4.
Glycerol Sigma
G5516
9.17.
MNAse New England Biolabs M0247S 1.1.
Nanodrop Thermo Fisher Scientific ND-2000 throughout
Micropulser Biorad 165-2100 10.2.
Electroporation cuvettes Biorad 732-2267  10.2.
250 ml centrifuge tubes Corning 430776 9.1-9.9.

DOWNLOAD MATERIALS LIST

References

  1. Mali, P., Esvelt, K. M., Church, G. M. Cas9 as a versatile tool for engineering biology. Nat Methods. 10, (10), 957-963 (2013).
  2. Yang, H., et al. One-step generation of mice carrying reporter and conditional alleles by CRISPR/Cas-mediated genome engineering. Cell. 154, (6), 1370-1379 (2013).
  3. Stricker, S. H., Koferle, A., Beck, S. From profiles to function in epigenomics. Nat Rev Genet. 18, (1), 51-66 (2017).
  4. Dominguez, A. A., Lim, W. A., Qi, L. S. Beyond editing: repurposing CRISPR-Cas9 for precision genome regulation and interrogation. Nat Rev Mol Cell Biol. 17, (1), 5-15 (2016).
  5. Shalem, O., et al. Genome-scale CRISPR-Cas9 knockout screening in human cells. Science. 343, (6166), 84-87 (2014).
  6. Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. Genetic screens in human cells using the CRISPR-Cas9 system. Science. 343, (6166), 80-84 (2014).
  7. Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol. 32, (3), 267-273 (2014).
  8. Hart, T., et al. High-Resolution CRISPR Screens Reveal Fitness Genes and Genotype-Specific Cancer Liabilities. Cell. 163, (6), 1515-1526 (2015).
  9. Koferle, A., et al. CORALINA: a universal method for the generation of gRNA libraries for CRISPR-based screening. BMC Genomics. 17, (1), 917-940 (2016).
  10. Lane, A. B., et al. Enzymatically Generated CRISPR Libraries for Genome Labeling and Screening. Dev Cell. 34, (3), 373-378 (2015).
  11. Sambrook, J., Russell, D. W. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. CSH Protoc. (1), (2006).
  12. Gibson, D. G. Enzymatic assembly of overlapping DNA fragments. Methods Enzymol. 498, 349-361 (2011).
  13. Elsaesser, R., Paysan, J. Liquid gel amplification of complex plasmid libraries. Biotechniques. 37, (2), 200-202 (2004).
Büyük ölçekli gRNA Kütüphane üretim herhangi bir DNA kaynaktan için evrensel bir iletişim kuralı
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).More

Köferle, A., Stricker, S. H. A Universal Protocol for Large-scale gRNA Library Production from any DNA Source. J. Vis. Exp. (130), e56264, doi:10.3791/56264 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter