Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Developmental Biology

Hücre toplama Trans Drosophila çentikle bağlama değerlendirmek için deneyleri-ligandlar ve onun inhibisyon CIStarafından-ligandlar

doi: 10.3791/56919 Published: January 2, 2018

Summary

Vivo sistemlerinin karmaşıklığı trans- ve BDTtarafından harekete geçirmek ve çentik reseptör inhibisyonu birbirinden ayırmak zor yapar-ligandlar, anılan sıraya göre. Burada, vitro hücre toplama deneyleri için nitel ve yarı kantitatif değerlendirmesi Drosophila çentik transiçin bağlama dayalı bir iletişim kuralı mevcut-ligandlar vs CIS-ligandlar.

Abstract

Çentik sinyal geniş hayvan geliştirme ve yetişkin bakım ve kullanılan bir evrimsel korunmuş hücre-hücre iletişim sistemidir. Çentik reseptör hücreleri komşu gelen ligandlar ile etkileşimi sinyal aktivasyonu neden olmaktadır (trans-harekete geçirmek), sinyal ligandlar aynı hücreden ile etkileşim inhibe ederken (CIS-inhibisyon). Transarasındaki uygun dengeyi-harekete geçirmek ve BDT-inhibisyon yardımcı olur çentik bazı bağlamlarda hayvan geliştirme sırasında sinyal en uygun belirlemektedir. Üst üste gelen ifade etki alanları çentik ve birçok hücre tipleri içinde onun ligandlar ve geri bildirim mekanizmaları varlığı nedeniyle verilen translasyonel modifikasyon trans- CISkarşı üzerinde etkileri eğitimi-çentik etkileşimleri ve onun ligandlar vivo içinde zordur. Burada, Drosophila S2 hücrelerde hücre toplama deneyleri çentik bağlama trans ve CISher ligand için üzerinde bir çentik yol değiştirici aşağı vurma etkilerini değerlendirmek amacıyla kullanmak için bir iletişim kuralı açıklar. Stabil veya geçici bir çentik ifade vektör ile transfected S2 hücreleri her çentik ligand (S2-Delta veya S2 Serrate) ifade hücreleri ile karıştırılır. Trans-reseptör ligandlar arasındaki bağı heterotypic hücre toplamları oluşumuna neden olur ve oluşan mL başına toplamları sayısı açısından ölçülür > 6 hücreler. CISinhibitör etkisini incelemek için-ligandlar, çentik ve her ligand ortak ifade S2 hücreleri S2-Delta veya S2 Serrate hücreleri ile karıştırılır ve toplamları sayısı yukarıda açıklandığı gibi sayılabilir. CISvarlığı nedeniyle toplamları sayısı göreli düşüş-ligandlar CISölçüsü sağlar-ligand- transinhibisyonu aracılı-bağlama. Bu basit deneyleri genetik veya farmakolojik işlemler bağlama üzerinde çentik için onun ligandlar etkileri üzerinde yarı Nicel veri sağlayabilir ve in vivo etkileri altında yatan moleküler mekanizmaları deşifre yardımcı olabilir Çentik sinyal üzerinde böyle manipülasyonlar.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kurallı sinyal çentik çentik reseptörleri ve onların ligandlar1arasındaki etkileşimi kolaylaştırmak için hücreler komşu fiziksel temas gerektiren bir kısa menzilli hücre-hücre iletişim mekanizmasıdır. Çentik reseptör (sinyal alma hücrelerinin yüzeyinde mevcut) etkileşim ligandlar (sinyal gönderme yüzeyinde mevcut hücreleri) çentik sinyal başlatır ve transbilinen-harekete geçirmek2. Öte yandan, çentik ve onun ligandlar aynı hücrede arasındaki etkileşimi çentik yolu inhibisyonu yol açar ve CISbilinmektedir-inhibisyon3. Trans- ve BDTarasındaki denge-etkileşimleri optimum ligand-bağımlı çentik4sinyal sağlamak için gereklidir. Drosophila vardır bir çentik reseptörü ve iki ligandlar (Delta ve Serrate) dört çentik reseptörleri ve beş ligandlar var memeliler aksine [1 (JAG1), JAG2, pürüzlü delta benzeri 1 (DLL1), DLL3 ve DLL4]5. Bu basitlik sahip, Drosophila model çentik-ligand etkileşimleri ve daha sonra üzerinde çentik sinyal yolu değiştirici etkilerini incelemek/çalışma için kolaylığı sağlar. (Kanat geliştirme Drosophiladahil olmak üzere), hayvan gelişimi sırasında belirli bağlamlarda CIS- ve trans-etkileşimleri çentik uygun sinyal elde etmek ve kader1,6 hücre için söz konusu . BDT- transkarşı çentik yolu değiştiriciler Bu içeriklerde etkilerini ayırt etmek önemlidir-çentik etkileşimleri ile onun ligandlar.

Bizim grup daha önce ksiloz Drosophila çentik için olumsuz olarak adlandırılan bir karbonhidrat kalıntı ilavesi çentik kanat geliştirme7de dahil olmak üzere belirli bağlamlarda sinyal düzenleyen bildirdi. Şems kaybı (enzim o xylosylates çentik) için bir "kayıp kanat damarın" fenotip7açar. Daha yakın zamanlarda, gen dozaj deneyler ve klonal analiz shams kaybı Delta-aracılı çentik singling geliştirir göstermek için kullanılmıştır. Gelişmiş çentik shams mutantlar sinyal azalmış CISbir sonucu olup ayırt etmek için-inhibisyon veya artmış trans-harekete geçirmek, içinde larva kanat Imaginal diskler ligandlar çentik Ektopik overexpression çalışmaları dpp-GAL4 sürücüyü kullanarak uygulandı. Bu deneyler Shams transdüzenleyen kanıt düşündüren sağlanan-harekete geçirmek-in Delta tarafından çentik çentik CISetkilemeden-inhibisyon ligandlar8tarafından. Ancak, düzenlemeler geri besleme ve endojen ligandlar etkileri Ektopik overexpression çalışmalar1,6,9yorumu karmaşık.

Drosophila S2 hücreleri10 kullanıldı, bu sorunu gidermek için hangi çentik-ligand etkileşim çalışmaları11,12için basit vitro sistem sağlamak. S2 hücreleri değil endojen çentik reseptör ve Delta ligand11 hızlı ve çentik-ligand toplama deneyler8etkilemez Serrate13, düşük düzeyde ifade eder. Bu nedenle, S2 hücreleri stabil veya geçici çentik ve/veya bireysel ligandlar (Delta veya Serrate) sadece çentik reseptör veya onun ligandlar biri hızlı hücre oluşturmak için veya bunların bir kombinasyon tarafından transfected. Çentik ifade S2 hücrelerinin ligand ifade S2 hücreleri sonuçlarında heterotypic toplamları Reseptör-ligand bağlayıcı11,12,14tarafından aracılı oluşumu ile karıştırma. Miktar toplam oluşumu sağlar bir ölçüsü trans-çentik ve onun ligandlar15 (şekil 1) bağlama. Benzer şekilde, S2 hücreler çentik ve Delta veya Serrate ligandlar ile ortak transfected olabilir (Yani CIS-ligandlar). BDT-bu çentik ifade S2 hücrelerde ligandlar iptal etmek çentik bağlama ile trans-ligandlar ve sonucu azalmıştır toplama oluşumu8,12,14. Toplama oluşumu CIStarafından neden göreli düşüş-ligandlar CISinhibitör etkisini ölçüsü sağlar-ligandlar üzerinde çentik ve transarasında bağ-ligandlar (Şekil 2). Buna göre hücre toplama deneyleri xylosylation kaybı trans- ve BDTüzerindeki etkisini incelemek için kullanılmıştır-çentik ve onun ligandlar arasındaki etkileşimler.

Burada, çentik bağlama ile transdeğerlendirmek için hücre toplama deneyleri amaçlayan için detaylı bir iletişim kuralı mevcut-ligandlar ve onun inhibisyon CIStarafından-ligandlar Drosophila S2 hücreleri kullanarak. Örnek olarak, biz bize çentik ve transarasında bağ çentik xylosylation etkisini belirlemek izin verilen veri sağlar-Delta8. Bu basit deneyleri çentik-ligand etkileşimleri vitro yarı nicel bir değerlendirme sağlar ve çentik yolu değiştiriciler vivo içinde etkileri altında yatan moleküler mekanizmalar belirlemek.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. Şems nakavt için çift telli RNA (dsRNA) hazırlanması

  1. PCR güçlendirme ürünleri
    1. Vahşi tipi sarı beyaz (y w) genomik DNA ve pAc5.1-EGFP dsRNA sentezinde kullanılan DNA parçalarının yükseltmek için şablon ve aşağıdaki astar çiftleri kullanın. Aşağıdaki PCR termal profili kullan: denatürasyon (95 ° C, 30 s), tavlama (58 ° C, 30 s) ve uzantı (72 ° C, 1 dk.).
      Yeşil flüoresan Protein gelişmiş (EGFP) dsRNA astar (5' - 3')-
      İleri astar-GAAATTAATACGACTCACTATAGGGGGTGAGCAAGGGCGAGGAG
      Astar GAAATTAATACGACTCACTATAGGGGGTCTTTGCTCAGGGCGG ters
      Şems dsRNA astar (5' - 3')-
      İleri astar-TTAATACGACTCACTATAGGGGAGATGCTGTATGTGGACACGGAT
      Astar TTAATACGACTCACTATAGGGGAGATCCGTGGATAACCTTAACGA ters
      Not: EGFP dsRNA negatif kontrol kullanılır.
  2. Jel-arındırmak Polimeraz zincir reaksiyonu (PCR) ürünleri üreticisinin protokolüne göre ticari jel arıtma seti kullanarak.
  3. Vitro transkripsiyon ticari bir ürün üreticisinin protokolüne göre T7 organizatörü dan transkripsiyonu yetenekli kullanarak gerçekleştirin.
  4. Bir RNA arıtma seti üreticisinin protokolüne göre kullanarak dsRNA arındırmak ve-80 ° C'de depolayın
  5. Şems nakavt verimliliğini (1.5.1-1.5.5) aşağıdaki adımları kullanarak değerlendirmek.
    1. Fetal sığır Serum (FBS) ve 100 U/mL penisilin-streptomisin plaka 1 mL/Schneider'ın ortamının iyi hemasitometre ve plaka 5 x 105 S2 hücreleri de 6 her kuyuya kullanarak el ile hücrelerin % 10 ile desteklenmiş sayısı.
    2. Her şey için EGFP- veya Şems dsRNA 7.5 µg ekleyin ve 25 ° c 24 h için kuluçkaya.
    3. Hasat (EGFP dsRNA tedavi) denetim ve Şems dsRNA tedavi S2 hücreleri nazik Santrifüjü 1000 x g için 25 ° c 5 min ve bir RNA ekstraksiyon kiti göre kullanarak RNA izolasyonu için işlem tarafından aşağı peletleme tarafından takip pipetting tarafından üreticinin iletişim kuralı.
    4. Spektrofotometre ve işlemi 100 kullanarak RNA ölçmek için 1-adım qRT-PCR ticari qPCR reaktifler ve astar/sonda ve aşağıdaki PCR termal profili kullanarak RNA'ın ng: denatürasyon (95 ° C, 15 s) ve TAV/uzantısı (60 ° C, 1 dk).
      Not: Lütfen astar/sonda setleri ve bu çalışmalarda shams , denetim qRT-PCR deneyleri için kullanılan alet Malzemeler tablo bilgi için bakınız.
    5. 2-ΔΔCT yöntemi16kullanarak göreli shams mRNA düzeyleri hesaplayın.

2. değerlendirme arasındaki çentik reseptörü ve Trans-ligandlar

  1. Sinyal alma hücreleri (çentik reseptör ifade S2) hazırlayın.
    1. El ile bir hemasitometre kullanarak hücreleri saymak ve plaka 5 x 105 S2 ve her şey bir 6-şey plaka 1 ml/Schneider'ın ortamının de istikrarlı S2-çentik hücrelerde FBS ve 100 U/mL penisilin-streptomisin % 10 ile desteklenmiştir.
      Not: Drosophila genomik Kaynak Merkezi (DGRC) üzerinden kullanılabilir olan S2-çentik hücreler için 200 nM metotreksat medya ekleyin. 0,5 mM metotreksat hisse senedi çözüm hazırlamak için ilk 20 mM metotreksat çözümde 250 µL 1 M NaOH hazırlamak. Ardından, bu çözüm için 1 M fosfat tampon serum ve store-20 ° C'de 0,5 mM sulandırmak S2-çentik hücrelerde, çentik protein Drosophila metallothionein organizatörü DEVRESEL_ÖDEME vektör kontrolü altında ifadesidir.
    2. Her şey için dsRNA 7.5 µg ekleyin ve 25 ° c 24 h için kuluçkaya.
    3. 0.7 mM çentik ifade teşvik ve 25 ° C de 3 gün kuluçkaya CuSO4 ekleyin.
      Not: CuSO4 metallothionein düzenleyici tarafından kontrollü proteinlerin ifade ikna etmek için kullanılır.
  2. Sinyal gönderme hücreleri (Delta veya Serrate ligandlar ifade S2 hücre) hazırlayın.
    1. El ile bir hemasitometre ve plaka ~ 5 x 106 istikrarlı S2-Delta veya S2 SerrateTom hücrelerde her şey 1 ml 6-şey plaka kullanarak hücreleri saymak/FBS ve 100 U/mL penisilin-streptomisin iyi Schneider'ın orta % 10 ile desteklenmiştir.
      Not: S2-Delta hücreler için 200 nM metotreksat ve 100 µg/mL hygromycin S2 SerrateTom hücreler için medya ekleyin. Delta ve SerrateTomifadesi — Serrate12domates öğesini, işlevsel sürümü — Drosophila metallothionein organizatörü DEVRESEL_ÖDEME vektör altındadır.
    2. 0.7 mM ligandlar ifade teşvik ve 25 ° c 3 h için kuluçkaya CuSO4 ekleyin.
  3. Sinyal gönderme ve sinyal alma hücreler arasında toplama gerçekleştirmek.
    1. DsRNA tedavi edilen S2 hasat (kontrol) ve S2-çentik hücreleri tarafından yumuşak pipetting ve hemasitometre tarafından elle sayım sonra hücreler/iyi bir 24-şey plaka plaka 2.5 x 105 .
    2. 5 x 105 istikrarlı S2-Delta veya S2 SerrateTom hücre Schneider'ın orta 200 µL toplam bir birim içinde eklemek (% 10 ile desteklenmiş FBS ve 100 U/mL penisilin-streptomisin).
      Not: tüm S2 hücreleri (kaplama, indüksiyon ve dsRNA tedavisi de dahil olmak üzere) işleme altında bir biyogüvenlik kabini yapıldı.
    3. Plaka bir orbital Çalkalayıcı 150 RPM (942.48 rad/dak) yerleştirin.
    4. 1 dk sonra her şey içeriğini karıştırmak ve toplamları sayılması için 20 µL çıkar.
      1. Aynı anda ters bileşik 10 x büyütme (PLL 10/0,25 amaç) kullanma mikroskop altında temsilcisi bir görüntü çekmek.
      2. El ile agrega saymak (> 6 hücreler) bir hemasitometre kullanarak.
    5. Bir shaker tabakta bir yer.
    6. Resim alma ve 5 dk sonra ve 15 dak toplama sayma yineleyin.
  4. Transmiktar gerçekleştirmek-bağlama.
    1. S2 hücreleri ve S2-Delta veya S2 SerrateTom hücreler arasındaki mL başına toplamları sayısını bir arka plan denetimi olarak hesaplayın.
    2. S2-çentik ve S2-Delta veya S2 SerrateTom hücreler arasındaki mL başına toplamları sayısını hesaplamak ( transbüyüklüğü-bağlama).

3.Çentik ve Transarasında bağ inhibisyonu değerlendirilmesi- CIStarafından ligandlar-ligandlar

  1. Sinyal alma hücreleri hazırlayın.
    1. Her şey bir 6-şey plaka 1 ml/de Schneider'ın orta plaka 5 x 105 S2 hücrelerde % 10 ile FBS ve 100 U/mL penisilin-streptomisin desteklenmiştir.
    2. Her şey için dsRNA 7.5 µg ekleyin ve 25 ° c 24 h için kuluçkaya.
    3. DsRNA tedavi edilen hücreleri pBluescript ve Devresel ödeme-çentikile11 (DGRC) tek başına veya DEVRESEL_ÖDEME-çentik ve Devresel ödeme-Delta11 ile birlikte transfect (DGRC) veya DEVRESEL_ÖDEME Serrate17 toplam DNA toplama µg/iyi bir ticari transfection reaktif üreticisinin protokolüne göre kullanarak 2.
      Not: pBluescript bir denetim olarak kullanılır. Co transfected hücreleri S2-çentik adı verilecek & Deltageçici veya S2-çentik & Serrategeçici hücreleri bundan sonra.
    4. 25 ° c 24 h için geçici transfected S2 hücreleri kuluçkaya.
    5. 0.7 mM çentik ve ligandlar ifade teşvik ve 25 ° C de 3 gün kuluçkaya CuSO4 ekleyin.
  2. Hücreleri sinyal gönderme 2.2 içinde açıklandığı şekilde hazırlayın.
  3. Sinyal gönderme ve sinyal alma hücreler arasında toplama 2.3 bölümünde açıklandığı gibi gerçekleştirmek.
  4. Transinhibisyonu ölçmek- CIStarafından bağlama-ligandlar.
    1. S2 hücreleri ve S2-Delta veya S2 Serrate hücreler arasındaki mL başına toplamları sayısını bir arka plan denetimi olarak hesaplayın.
    2. CIStarafından inhibisyon büyüklüğü ölçmek-ligandlar gibidir.
      1. A toplamları S2-çentikgeçici ve S2-Delta hücreler arasındaki sayısını tanımlamak için kullanılır.
      2. Toplamları S2 hücreler arasında sayıda geçici çentik ve Delta ile birlikte transfected gibi B tanımlayın (S2-çentik & Deltageçici) ve S2-Delta hücreleri.
      3. Göreli toplama C hesaplamak = (B x 100) /A
      4. BDT- ligand (Delta veya Serrate) 100-tarafından inhibisyon büyüklüğünü hesaplamak C.
        Not: göreli toplama ise % 45, o zaman CISbir örnek olarak-ligandlar transetkisizleştirmek için kabul edilir-55 oranında bağlama.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Vivo gözlemlerimiz xylosyltransferase gen shams sonuçlarında çentik nedeniyle sinyal kazanç kaybı Delta-aracılı transartış önerdi- CISetkilemeden çentik aktivasyonu-inhibisyonu Çentik ligandlar8tarafından. Bu kavramı sınamak için vitro hücre toplama deneyleri gerçekleştirilmiştir. İlk olarak, S2 hücre deyimde Şems Şems dsRNA kullanarak yere düştü. EGFP dsRNA denetimi olarak kullanıldı. Nakavt (KD) gerçek zamanlı PCR tarafından incelenmiş ve %808' den büyük olduğu gösterilmiştir. O zaman, çentik reseptör transile bağlama-Delta Şems KD muayene toplama deneyleri kullanarak üzerine. S2-çentik ve S2-Delta hücreler arasında toplama onları karıştırma sonra çeşitli zaman noktalarda incelenmiştir. Toplama düz S2 hücreleri ve S2-Delta hücreleri arasında arka plan denetimi olarak alınmıştır. Toplam sayısını gösteren grafik farklı oluşan şekil 3 gösterir karıştırdıktan sonra puan (1, 5, 15 ve 30 dk) zaman. Keskin bir artış göre daha yavaş 30 dk kadar artmaya devam toplamları sayısı toplamları arasında 1 ve 5 dk. daha sonra dizi gözlendi. Bu nedenle, toplama oluşumu 1, 5 ve 15 dk görüntüsü ve toplamları sayısı karıştırma 5 dk sonra sayılabilir.

Şekil 4A shams KD çentik reseptör ve transarasında bağ üzerinde etkilerini değerlendirmek için kararlı S2-çentik ve S2-Delta hücreler arasında toplama deneyleri hücre temsilcisi görüntüleri gösterir-Delta. Resimleri toplama üç kez puan (1, 5 ve 15 dk) göster. Arka plan denetimi için düz S2 hücreleri ( Şems dsRNA ile tedavi) S2-Delta hücreleri ile karıştırıldı. EGFP dsRNA tedavi S2-çentik hücreleri toplamları sayısı zamanla artış S2-Delta hücrelerle kurdu. Buna ek olarak, Şems dsRNA tedavi S2-çentik hücreleri toplamları daha hızlı oluşur ve agrega ve denetim olanlar (şekil 4B) sayısından daha büyük. Bu Shams seviyeleri azalan transgeliştirir belirtilen-çentiği Delta8ile bağlama.

İncelemek için olup Şems düzenleyen CISinhibitör etkisi-ligandlar üzerinde çentik ve transarasında bağ-Delta, biz ilk kurulan çentik ve Delta eş o ifadesi içinde sinyal alma hücre hücre toplama azaltmak Çentik ve transtarafından aracılık-Delta. Şekil 5A gösterir S2-Delta ile S2-çentik arasında oluşan toplam sayısını gösteren grafik & Delta CISfarklı miktardageçici hücrelerle-Delta. Çentik ve Delta ifade yapıları eşit miktarda S2 hücrelere önemli ölçüde transfecting bu hücreleri ve S2-Delta hücreleri arasında oluşan toplam sayısını azaltır. Ayrıca, CISmiktarı azalan-Delta sonuçları toplamları, sayısındaki bir artış girinti aralığını gösteren /BDT-Delta oranları bu deneyleri, CISkullanılan-Delta çentik arasındaki inhibe ve Trans-Delta bir doz bağımlı şekilde. S2-çentik beri & çentik ve Delta Deltageçici hücreleri hızlı, onlar bağımsız olarak S2-Delta hücreleri homotipik toplamları formu. S2-çentik arasında homotipik oluşumu toplar Eğer incelemek için & Deltageçici hücreleri CISkarıştırıcı bir faktör olabilir-inhibisyon deneyleri, şekil 5A' gösterilen bu hücreler S2 hücreleri ile karışık ve sayısal toplar. Şekil 5B S2 hücreleri S2-çentik ile karıştırdıktan sonra oluşan toplam sayısını gösterir & Deltageçici hücreler çeşitli çentik ifade /BDT-Delta oranları. Homotipik toplamları heterotypic toplamları için şekil 5A ' gösterildiği gibi karşılaştırıldığında oldukça az sayıda gözlendi. Biz bu toplama deneyleri sadakatle CISetkisini ölçmek sonucuna-Delta üzerinde çentik ve transarasında bağ-Delta.

Biz sonraki shams KD CISinhibitör yeteneği üzerinde etkisi incelenmiştir-Delta. Bu son, S2-Delta ve S2-çentik arasında toplama & Deltageçici hücreleri inceledi. Şekil 6A gösterir temsilcisi toplama S2-Delta hücreleri ile S2-çentikgeçici (kontrol) veya S2-çentik arasında görüntülerini & Deltageçici hücreleri. S2-Delta ve EGFP dsRNA tedavi S2-çentikgeçici hücre sayısı zamanla toplama S2-Delta ve istikrarlı S2-çentik hücreler (şekil 4) arasındaki benzer artırmak toplamları kurdu. Özellikle, S2-Delta ve S2-çentik karıştırma & Deltageçici hücreler eşit miktarda çentik ve Delta ifade Plasmid'ler ile birlikte transfected daha az toplamları EGFP KD ve Şems KD, o azalan düşündüren üzerine kurulan Shams düzeyini CISyeteneğini etkilemez-çentik engellemek için Delta /trans-Delta bağlama. Daha iyi shams KD etkinlikte, CISetkilerini değerlendirmek için-Delta, inhibisyon CIStarafından büyüklüğü-Delta ölçülen bir çentik aralığı içinde göreli toplama yüzde hesaplayarak /BDT-Delta 3.4.2 bölümünde açıklandığı gibi oranları. Miktar göreli toplama toplama üzerine EGFP ve Şems dsRNA tedavi (şekil 6B) karşılaştırılabilir inhibisyonu gösterdi. Birlikte, bu gözlemler xylosylation kaybı transteşvik öneririz- CISetkilemeden bağlama-inhibisyon8ve shams gözlenen kanat ven kaybı fenotip moleküler mekanizması sağlamak mutantlar.

Figure 1
Resim 1: Şematik gösterimi hücre toplama tahlil için Trans-bağlama. Reseptörü (S2-çentik) ve ligand indüksiyon (S2-Delta veya S2 Serrate) ifade S2 hücre 0.7 mM CuSO4gösteren diyagram. Her iki S2 hücre indüksiyon karıştırılarak, hangi toplamları hale eğilimi izliyor. Bu toplamları (> 6 hücreler) görüntüsü ve sayılabilir.Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 2
Resim 2: CISdeğerlendirmek için hücre toplama tahlil şematik gösterimi-inhibisyon. S2 hücreleri geçici DEVRESEL_ÖDEME-çentik (S2-Ngeçici), DEVRESEL_ÖDEME-çentik ve Devresel ödeme-Delta ile transfected (S2-çentik & Deltageçici), veya DEVRESEL_ÖDEME-çentik ve Devresel ödeme Serrate (S2-çentik & Serrategeçici). 0.7 mM CuSO4 ve S2-Delta hücreleri ile karıştırma indüksiyon sonra toplar (> 6 hücreler) sayısal. İnhibisyon CIStarafından-ligandlar göreli toplama yüzde olarak ölçülen her CISde -ligand. CISetkileri-ligandlar üzerinde çentik ve transarasında bağ-Serrate geçici transfected hücreleri (gösterilmez)Tom S2 Serrate hücreleri ile karıştırılarak belirlenebilir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 3
Şekil 3: S2-çentik ve S2 veya farklı zaman noktalarda S2-Delta hücreleri arasında toplama. Grafik hücreleri belirtilen tür arasındaki (1, 5, 15 ve 30 dk) farklı zaman noktalarında toplamları mL başına sayısını gösterir. Hata çubukları üç çoğaltır ortalaması (SEM) standart hatasını gösterir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 4
Şekil 4: Hücre toplama aracılı çentik ve trans-Delta. (A)resimleri göster toplama farklı zaman noktalarda (1, 5 ve 15 dk). Toplama Şems dsRNA tedavi düz S2 hücreleri ve S2-Delta hücreleri arasında arka plan denetimi olarak alınmıştır. Shams- dsRNA tedavi S2-çentik hücre sayısında bir artış gösteriyor ve toplamları boyutunu EGFP dsRNA tedavi (Denetim için) S2-çentik hücreleri S2-Delta hücreleri ile karıştırdıktan sonra karşılaştırılır. Ölçek çubuğu = 100 µm. hücre sayısı (B) miktar toplar daha 6 hücre büyük toplama 5 dakika sonra. Hata Çubuklarõn SEM * P < 0,01 (One-way Varyans analizi (ANOVA)). Üç çoğaltır üç bağımsız tekrarlar ile gerçekleştirilmiştir. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 5
Şekil 5: CIS-Delta engeller hücre toplama oluşumu aracılı çentik ve trans-Delta bir doz bağımlı şekilde. (A) grafik gösterir (açısından sayısı toplamları/mL) toplama S2-Delta hücreleri ve geçici çentik ve BDTiçin ifade vektörel çizimler farklı oranları ile transfected S2 hücreler arasındaki-Delta (1:0, 1:1, 1:0. 5, 1:0.2 ve 1:0. 1). Hata Çubuklarõn SEM * P < 0,01 (One-way ANOVA). Üç çoğaltır üç bağımsız tekrarlar ile gerçekleştirilmiştir. CISdüzeyini azalan unutmayın-Delta sonuçlar toplama, büyük olasılıkla azaltılmış CISnedeniyle bir artış-inhibisyon. (B) grafik homotipik toplama (açısından mL başına toplamları sayısı) geçici S2 hücrelerde gösterilen çentik ve Delta (1:0, 1:1, 1:0. 5, 1:0.2 ve 1:0. 1) farklı oranları ile transfected ve düz S2 hücreleri ile karışık. Hata çubuklarını göstermek SEM toplamları sayısıdır S2-Delta ile S2-çentik arasında oluşan heterotypic toplamları sayısından daha küçük & Deltageçici hücreleri. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Figure 6
Şekil 6: Şems nakavt CISinhibitör etkinliği etkilemez-Delta. (A)gösterildi temsilcisi görüntüler shams KD CISüzerinde etkisi vardır-Delta-çentik tarafından aracılı hücre toplama inhibisyonu aracılı /trans-Delta bağlama. Resimleri toplama farklı zaman noktalarda (1, 5 ve 15 dk) göster. Toplama Şems dsRNA tedavi düz S2 hücreleri ve S2-Delta hücreleri arasında arka plan denetimi olarak alınmıştır. Stabil transfected Barcelona'da S2-çentik hücreleri, Şems KD toplamları S2-Delta ve denetim (EGFP dsRNA tedavi) karşılaştırıldığında S2-çentikgeçici hücreler arasındaki sayısı arttı. CISortak ifade-Delta 1:1 oran çentik ile sonuçlandı kontrol (EGFP dsRNA tedavi) toplamları sayısı karşılaştırılabilir bir düşüş de shams tedavi dsRNA hücreler olduğu gibi. Ölçek çubuğu = 100 µm. (B) grafik gösterir S2-Delta hücreleri ve geçici işbirliği ile belirtilen oranları çentik ve CIS(1:0, 1:1, 1:0. 5, 1:0.2 ve 1:0. 1) transfected S2 hücreler arasındaki göreli toplama-Delta. EGFP ve Şems dsRNA tedavi göstermek toplama karşılaştırılabilir bir düşüş her çentik /BDT-Delta oranı. Burada sunulan veri üç bağımsız deneyler temsilcisi vardır. Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Kurallı sinyal çentik çentik reseptör ve onun ligandlar5arasındaki etkileşimler bağlıdır. Çentik yolu en çalışmaları, öncelikle çentik ve ligandlar komşu hücrelere (trans) bağlama dikkate rağmen çentik ve aynı hücre ligandlar etkileşim ve bu sözde CIS-etkileşimleri çentik bir inhibitör rol oynayabilir 3,4sinyal. Buna göre kurallı çentik sinyal üzerinde bir değiştirici etkileri altında yatan mekanizmaları deşifre etmek için genellikle çentik-ligand etkileşimleri (trans ve BDT) her iki tür incelemek uygun olur. Ancak, hayvan geliştirme sırasında pek çok bağlamlarda, in vivo çalışmalar1,6her ikisi de bu etkileşimler ve onların geri besleme yönetmelik katılımı zorlaştırmaktadır. Mevcut iletişim kuralında, biz Drosophila S2 hücreleri kullanarak bağlama ile trans- ligandlar ve onun inhibisyon CIStarafından - çentik reseptör değerlendir vitro hücre toplama deneyleri için detaylı bir metodoloji sağlamak ligandlar. Biz çentik genetik bir değiştirici etkisini değerlendirmek için bu yöntem kullanımı (xylosyltransferase Şems7,8) Reseptör-ligand bağlayıcı üzerinde sinyal sundu.

İlk olarak, istikrarlı S2-Delta ve EGFP veya Şems dsRNA tedavi istikrarlı S2-çentik hücreler arasındaki trans shams KD etkisini incelemek için toplama deneyleri gerçekleştirilmiştir-bağlama. Toplama Şems dsRNA tedavi düz S2 hücreleri ile S2-Delta hücrelerinin arka plan denetimi olarak alınmıştır. Shams KD toplama S2-çentik ve denetimine göre S2-Delta hücreler arasındaki gelişmiş. Arka plan deneysel kontrol toplamalardan düz S2 hücreleri ve ligand taşıma S2 hücreleri arasında paralel transolarak gerçekleştirmek önemlidir-deneyler bağlama. Endojen çentik reseptör ve Delta ligand11 Drosophila S2 hücreleri ifade değil rağmen Serrate düşük seviyelerde ifadesidir S2 hücreleri13' te bildirilmektedir. Bu göz önüne alındığında, düz S2 hücreleri hücre toplama deneyleri içinde arka plan denetimi olarak kullanıldı; Bu hücreler herhangi bir toplama (şekil 5B) belli etmedi. Toplamları kullanarak el ile bir hemasitometre dikkate alınır. Toplam miktar tutarlılık sağlamak için 10-20 µL karma hücre nüfusun dışarı iyi sayımı için başına en az üç farklı alanlardan pipetted. Bu deneyleri sağlıklı büyüyen S2 hücrelerini gerektirir. S2 yarı yapisan doğası göz önüne alındığında hücreler, nazik hücreleri toplarken pipetting ve toplama tahlil sırasında sallayarak sabit önemlidir.

Daha önce biz ve diğerleri iyi kurulmuş, çözünür ligand-reseptör bağlama deneyleri trans17,18,19, Reseptör-ligand bağlayıcı nicel bir değerlendirme için kullandık 20. toplama deneyleri yarı kantitatif olduğundan, çözünür ligand bağlayıcı deneyleri de çentik-ligand trans shams KD etkisini incelemek için gerçekleştirilen-bağlama. Gözlemlenen sonuçları bu toplama deneyleri8' den elde edilen eğilim benzerdi. Bu çentik bağlama ile transsadık değerlendirilmesi tespit-hücre toplama deneyleri kullanarak ligandlar. Toplama oluşumu Reseptör-ligand bağlayıcı bir okuma olsa da, çentik reseptör veya onun ligandlar yüzey ifade tarafından belirtilen değiştiriciler etkileniyorsa karmaşık olabilir. Toplama oluşumu değişikliği değişmiş Reseptör-ligand taşıması nedeniyle veya yüzey ifade değişmiş ayırt edemez olarak bu hücre toplama deneyleri sınırlandırılması vurgulamaktadır. Bu nedenle, toplama deneyleri için paralel, çentik ve ligandlar yüzey ifadesi her değiştirici etkilerini gerekir S2 hücrelerde test edilecek. Çalışmalarımız bağlamında, yüzey düzeyde çentik ve Delta Şems dsRNA tedavi S2 hücre8' etkilenen değil.

Transinhibisyonu incelemek için- CISeklenmesi tarafından bağlama-ligandlar, toplama deneyleri gerçekleştirilen S2-Delta hücreleri ve EGFP veya Şems dsRNA tedavi S2-çentik & Deltageçici hücreleri . Bu hücreler arasında toplamları sayısı toplamları S2-Delta hücreleri ve S2-çentikgeçici hücreleri arasında oluşan sayı ile karşılaştırıldı. Toplamları sayısı göreli düşüş hesaplanır ve CIStarafından inhibisyon büyüklüğü için bir göstergesi olarak kullanılan-Delta. Kontrol deneyleri gösterdi o CIS-ligandlar göstermek çentik sağlam ve doz bağımlı inhibisyonu /trans-Delta bağlama üzerinde çentik bir oldukça geniş aralığı için CIS-ligand oranları (1:1 1:0. 1) (şekil 5A)8 . 1:1 oran CISen güçlü derecesini sonuçlandı-inhibisyonu ve CISgöreli düzeyine azalan-Delta zayıflamış CIS-inhibisyon. Buna göre bu dizi oranları üzerinden KD deneyler gerçekleştirilen. Not, çentik reseptör miktarı ve toplam transfected DNA'ın tüm deneyler sabit tutuldu. Bu toplama oluşumu öncelikle BDTetkinliği tarafından etkilenen sağlayacaktır-ligandlar ve çentik ifadesi hücreleri tarafından düzeyi tarafından değil değiştirilmiş.

Bu önceden çentik ve CISCo o ifade gösterildi-S2 hücrelerdeki ligandlar homotipik toplamalardan14oluşumuna neden olur. Benzer olup olmadığını incelemek için homotipik toplamalardan S2-çentik arasında & Deltageçici veya S2-çentik & Serrategeçici hücreleri CIStoplama quantifications bizim yorumlarını uzlaşma-ligand çalışmaları, Denetim toplama tahlil S2-çentik arasında gerçekleştirilen & Deltageçici ve düz S2 hücreleri. Bu deneylerde kullanılan S2 hücre sayısı CISiçinde kullanılan S2-Delta hücre olduğu gibi-Delta deneyler. Bazı homotipik toplama gözlendi, ancak miktar gösterdi sonuç toplamları S2-çentik arasında heterotypic toplamları ile karşılaştırıldığında toplam toplamları düşük bir kısmını katkıda & Deltageçici ve S2-Delta hücreleri () Şekil 5B).Biz değişiklikleri CIStoplamları sayısında gözlemlenen sonucuna-ligand deneyleri vardır öncelikle BDTinhibitör etkisi nedeniyle-ligandlar üzerinde çentik ve transarasında bağ-Delta.

Özet olarak, bu protokol için sunulan toplama deneyleri trans- ve BDTyarı kantitatif değerlendirmesi için kolay ve basit bir metodoloji sağlamak-çentik reseptör ve onun ligandlar etkileşimler. Bu deneyleri çentik-ligand bağlayıcı vitro genetik veya farmakolojik çentik yol değiştirici etkilerini incelemek için kullanılan ve bu nedenle bu niteleyiciler vivo içinde etkileri üzerinde çentik temel mekanizmaları aydınlatmak yardımcı olabilir işaret.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Yazarlar hiçbir çıkar çatışması var.

Acknowledgments

Yazarlar NIH/NIGMS destek kabul (HJN R01GM084135) ve Glycoscience (hibe #110071 HJN) ve are minnettar Tom V. Lee için tartışma ve öneriler deneyleri, Mizutani Vakfı ve Spyros Artavanis-Tsakonas, Hugo Bellen, Robert Fleming, Ken Irvine ve Plazmidler ve hücre hatları için Drosophila genomik Kaynak Merkezi (DGRC).

Materials

Name Company Catalog Number Comments
BioWhittaker Schneider’s Drosophila medium, Modified Lonza 04-351Q
HyClone Penicillin-Streptomycin 100X solution GE Healthcare lifescience  SV30010
CELLSTAR 6 well plate Greiner Bio-One 657 160
CELLSTAR 24 well plate Greiner Bio-One 662160
VWR mini shaker Marshell Sceintific 12520-956
Hemocytometer Fisher Sceintific  267110
FuGENE HD Transfection Reagent Promega E2311
MEGAscrip T7 Transcription Kit Ambion AM1334
Quick-RNA MiniPrep (RNA purification Kit) Zymo Research R1054
VistaVision Inverted microscope VWR
9MP USB2.0 Microscope Digital Camera + Advanced Software AmScope MU-900 Image acquisition using ToupView software
PureLink Quick Gel Extraction Kit Invitrogen K210012
Fetal Bovine Serum GenDepot F0600-050
Methotrexate Sigma-Aldrich A6770-10
Hygromycin B Invitrogen HY068-L6
Copper sulphate Macron Fine Chemicals 4448-02
S2 cells Invitrogen R69007
S2-SerrateTom cells Gift from R. Fleming (Fleming et al, Development, 2013)
S2-Delta cells DGRC 152
S2-Notch cells DGRC 154
pMT-Delta vector DGRC 1021 Gift from S. Artavanis-Tsakonas
pMT-Serrate vector Gift from Ken Irvine (Okajima et al, JBC, 2003)
pMT-Notch vector DGRC 1022 Gift from S. Artavanis-Tsakonas
pAc5.1-EGFP Gift from Hugo Bellen
TaqMan RNA-to-Ct 1-Step Kit Applied Biosystem 1611091
TaqMan Gene Expression Assay for CG9996 (Shams) Applied Biosystem Dm02144576_g1  with FAM-MGB dye
TaqMan Gene Expression Assay for CG7939 (RpL32) Applied Biosystem Dm02151827_g1 with FAM-MGB dye
Applied Biosystems 7900HT Fast Real-Time PCR system Applied Biosystem 4351405 96-well Block module

DOWNLOAD MATERIALS LIST

References

  1. de Celis, J. F., Bray, S., Garcia-Bellido, A. Notch signalling regulates veinlet expression and establishes boundaries between veins and interveins in the Drosophila wing. Development. 124, (10), 1919-1928 (1997).
  2. Fortini, M. E. Notch signaling: the core pathway and its posttranslational regulation. Dev Cell. 16, (5), 633-647 (2009).
  3. del Alamo, D., Rouault, H., Schweisguth, F. Mechanism and significance of cis-inhibition in Notch signalling. Curr Biol. 21, (1), R40-R47 (2011).
  4. Sprinzak, D., et al. Cis-interactions between Notch and Delta generate mutually exclusive signalling states. Nature. 465, (7294), 86-90 (2010).
  5. Kopan, R., Ilagan, M. X. The canonical Notch signaling pathway: unfolding the activation mechanism. Cell. 137, (2), 216-233 (2009).
  6. Huppert, S. S., Jacobsen, T. L., Muskavitch, M. A. Feedback regulation is central to Delta-Notch signalling required for Drosophila wing vein morphogenesis. Development. 124, (17), 3283-3291 (1997).
  7. Lee, T. V., et al. Negative regulation of notch signaling by xylose. PLoS Genet. 9, (6), e1003547 (2013).
  8. Lee, T. V., Pandey, A., Jafar-Nejad, H. Xylosylation of the Notch receptor preserves the balance between its activation by trans-Delta and inhibition by cis-ligands in Drosophila. PLoS Genet. 13, (4), e1006723 (2017).
  9. Jacobsen, T. L., Brennan, K., Arias, A. M., Muskavitch, M. A. Cis-interactions between Delta and Notch modulate neurogenic signalling in Drosophila. Development. 125, (22), 4531-4540 (1998).
  10. Schneider, I. Cell lines derived from late embryonic stages of Drosophila melanogaster. J Embryol Exp Morphol. 27, (2), 353-365 (1972).
  11. Fehon, R. G., et al. Molecular interactions between the protein products of the neurogenic loci Notch and Delta, two EGF-homologous genes in Drosophila. Cell. 61, (3), 523-534 (1990).
  12. Fleming, R. J., et al. An extracellular region of Serrate is essential for ligand-induced cis-inhibition of Notch signaling. Development. 140, (9), 2039-2049 (2013).
  13. Saj, A., et al. A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network. Dev Cell. 18, (5), 862-876 (2010).
  14. Fiuza, U. M., Klein, T., Martinez Arias, A., Hayward, P. Mechanisms of ligand-mediated inhibition in Notch signaling activity in Drosophila. Dev Dyn. 239, (3), 798-805 (2010).
  15. Ahimou, F., Mok, L. P., Bardot, B., Wesley, C. The adhesion force of Notch with Delta and the rate of Notch signaling. J Cell Biol. 167, (6), 1217-1229 (2004).
  16. Livak, K. J., Schmittgen, T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, (4), 402-408 (2001).
  17. Okajima, T., Xu, A., Irvine, K. D. Modulation of notch-ligand binding by protein O-fucosyltransferase 1 and fringe. J Biol Chem. 278, (43), 42340-42345 (2003).
  18. Acar, M., et al. Rumi is a CAP10 domain glycosyltransferase that modifies Notch and is required for Notch signaling. Cell. 132, (2), 247-258 (2008).
  19. Bruckner, K., Perez, L., Clausen, H., Cohen, S. Glycosyltransferase activity of Fringe modulates Notch-Delta interactions. Nature. 406, (6794), 411-415 (2000).
  20. Yamamoto, S., et al. A mutation in EGF repeat-8 of Notch discriminates between Serrate/Jagged and Delta family ligands. Science. 338, (6111), 1229-1232 (2012).
Hücre toplama <em>Trans</em> <em>Drosophila</em> çentikle bağlama değerlendirmek için deneyleri-ligandlar ve onun inhibisyon <em>CIS</em>tarafından-ligandlar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Pandey, A., Jafar-Nejad, H. Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands. J. Vis. Exp. (131), e56919, doi:10.3791/56919 (2018).More

Pandey, A., Jafar-Nejad, H. Cell Aggregation Assays to Evaluate the Binding of the Drosophila Notch with Trans-Ligands and its Inhibition by Cis-Ligands. J. Vis. Exp. (131), e56919, doi:10.3791/56919 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter