Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

एक व्यापक प्रक्रिया का मूल्यांकन करने के लिए इन विट्रो में प्रदर्शन के ख्यात Hemangioblastoma Neovascularization का उपयोग कर अंडाकार आकृति अंकुरण परख

doi: 10.3791/57183 Published: April 12, 2018

Summary

यह कागज एक व्यापक प्रक्रिया प्रस्तुत करता है इन विट्रो में मूल्यांकन करने के लिए कि क्लासिक ट्यूमर angiogenesis hemangioblastomas (एचबीएस) और एचबीएस में अपनी भूमिका में मौजूद है । परिणाम एचबी-neovascularization की जटिलता पर प्रकाश डाला और सुझाव है कि angiogenesis के इस आम रूप केवल एचबी-neovascularization में एक पूरक तंत्र है ।

Abstract

वॉन Hippel की निष्क्रियता-लिंडाऊ (VHL) ट्यूमर शमनकर्ता जीन मानव केंद्रीय तंत्रिका तंत्र (सीएनएस) के भीतर hemangioblastomas (एचबीएस) के विकास में एक महत्वपूर्ण भूमिका निभाता है । हालांकि, दोनों कोशिकाविज्ञान मूल और एचबीएस की विकासवादी प्रक्रिया (neovascularization सहित) विवादास्पद रहते हैं, और विरोधी VHL के लिए angiogenesis-एचबीएस, क्लासिक एचबी angiogenesis के आधार पर, नैदानिक परीक्षणों में निराशाजनक परिणाम का उत्पादन किया है । एक बड़ी बाधा विरोधी संवहनी उपचार के सफल नैदानिक अनुवाद करने के लिए इस संवहनी ट्यूमर में neovascularization की एक पूरी तरह से समझ की कमी है । इस अनुच्छेद में, हम एक व्यापक प्रक्रिया मौजूद इन विट्रो में मूल्यांकन करने के लिए कि क्लासिक ट्यूमर angiogenesis एचबीएस में मौजूद है, साथ ही एचबीएस में अपनी भूमिका । इस प्रक्रिया के साथ, शोधकर्ताओं सही एचबी neovascularization की जटिलता को समझने और एचबीएस में angiogenesis के इस आम रूप के समारोह की पहचान कर सकते हैं । इन प्रोटोकॉल ट्यूमर के लिए सबसे होनहार विरोधी संवहनी चिकित्सा का मूल्यांकन करने के लिए इस्तेमाल किया जा सकता है, जो या तो ट्यूमर के इलाज के लिए उच्च शोधों की क्षमता है या विरोधी के अनुकूलन में सहायता के लिए-भविष्य के अनुवाद में एचबीएस के लिए angiogenic उपचार । परिणाम एचबी neovascularization की जटिलता पर प्रकाश डाला और सुझाव है कि इस आम फार्म angiogenesis केवल एचबी neovascularization में एक पूरक तंत्र है ।

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Hemangioblastomas (एचबीएस) सौम्य संवहनी ट्यूमर है कि विशेष रूप से मानव केंद्रीय तंत्रिका तंत्र (सीएनएस) के भीतर पाया जाता है । वे या तो वॉन Hippel-लिंडाऊ (VHL) रोग या छिटपुट घावों के साथ रोगियों में विकसित । VHL-एचबीएस इस आनुवंशिक विकार से परिणाम है कि लगातार पुनरावृत्ति और कई घावों के कारण शल्य चिकित्सा उपचार के माध्यम से इलाज करने के लिए मुश्किल कर रहे हैं1. यद्यपि VHL ट्यूमर शमनकर्ता जीन की निष्क्रियता को VHL-एचबीएस के tumorigenesis का मूल कारण माना गया है, कोशिकाविज्ञान मूल (neovascularization सहित) और एचबीएस की विकासवादी प्रक्रिया मोटे तौर पर2विवादास्पद रहती है. इसलिए, एचबी-neovascular जैविक तंत्र के एक बेहतर समझ VHL-एचबीएस के लिए सबसे होनहार विरोधी संवहनी रणनीतियों में उपयोगी अंतर्दृष्टि प्रदान कर सकते हैं ।

हालिया शोध में यह सुझाव दिया गया है कि एचबी-neovascularization embryologic vasculogenesis3,4,5के समान है । क्लासिक संवहनी endothelial वृद्धि कारक (वीईजीएफ़)-मध्यस्थ angiogenesis कि संवहनी endothelium से उत्पन्न और है कि समारोह के VHL नुकसान से प्रेरित है प्रसार और neovascular गठन, जो6चुनौती दी गई है के परिणामस्वरूप. १९६५ में, Cancilla और Zimmerman पाया, इलेक्ट्रॉन माइक्रोस्कोपी का उपयोग, कि एचबीएस endothelium7से उत्पंन । बाद में यह पाया गया कि stromal कोशिकाएँ vasoformative तत्वसे प्राप्त होती हैं. १९८२ में, Jurco एट अल. पाया कि stromal कोशिकाओं endothelial मूल9के हैं । इसलिए, हम कल्पना की है कि मानव संवहनी endothelial कोशिकाओं एचबी-neovascularization10की मूल कोशिकाओं रहे हैं । हालांकि यह एचबी VHL रोगी सर्जरी से व्युत्पंन कोशिकाओं से प्राथमिक संस्कृतियों का उपयोग बेहतर है, हमारे पिछले अनुसंधान से संकेत दिया कि एचबी से प्राथमिक संस्कृतियों स्थिर नहीं हैं, और सेल लाइनों3स्थापित नहीं किया जा सकता है । इसके अलावा, 3 डी वातावरण में प्राथमिक संस्कृतियों एचबी-neovascularization के कोशिकाविज्ञान मूल की पहचान नहीं है क्योंकि वे एचबी-संवहनी सामग्री के progenitors10,11शामिल हैं । इसलिए, endothelial कोशिकाओं के एक आदिम और क्लासिक मॉडल के रूप में, मानव संवहनी endothelial कोशिकाओं (HUVEC) एचबीएस के लिए एक वैकल्पिक सेलुलर मॉडल के रूप में सेवा कर सकता है ।

अंडाकार आकृति अंकुरण परख ऊतक इंजीनियरिंग 12, 13 में एक नया मॉडल है । इस पत्र में, एक 3 डी कोलेजन आधारित coculture प्रणाली में अंडाकार आकृति अंकुरण परख का उपयोग कर विकसित किया गया था, एक समग्र लक्ष्य है कि क्लासिक ट्यूमर angiogenesis एचबीएस में मौजूद है, साथ ही साथ एचबीएस में अपनी भूमिका का मूल्यांकन करने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

यह पद्धति Huashan अस्पताल, फुदन विश्वविद्यालय की अनुसंधान नैतिकता समिति के अनुमोदित दिशानिर्देशों और विनियमों के अनुसार की गई थी । इसी मानक सुरक्षा उपायों के प्रत्येक चरण में पीछा किया गया । एक योजनाबद्ध प्रस्तुति के लिए, कृपया चित्र 1देखें ।

1. सेल कल्चर और प्लाज्मिड का निर्माण

  1. नियमित रूप से Dulbecco के संशोधित ईगल के माध्यम (DMEM) में मानव नाल नस endothelial कोशिका (HUVEC) को बनाए रखने के 10% भ्रूण गोजातीय सीरम (FBS), १०० इकाई/एमएल पेनिसिलिन के, और १०० µ जी/streptomycin के एक humidified में 5% सह2 मशीन के साथ पूरक ३७ डिग्री सेल्सियस पर ।
  2. shRNA अंश के संश्लेषण के लिए आपै और EcoRI के साथ PLKO .1 प्लाज्मिड को पचा । सुनिश्चित करें कि VHL shRNA वेक्टर का oligonucleotide अनुक्रम CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14है ।
  3. इसके बाद, oligo के फॉरवर्ड 5 µ l के साथ 20 µ μ टम मिक्स करें, रिवर्स oligo के 5 µ एल, 10x µ बफर के 5 नेब एल और ३५ µ एल के ddH2हे एक साथ (कुल मात्रा ५० µ एल है) । 4 मिनट के लिए ९८ डिग्री सेल्सियस पर मिश्रण गर्मी है, और धीरे से कुछ ही घंटों में कमरे के तापमान को शांत ।
  4. Ligate annealed ओलिगोस्पर्मिया और PLKO .1 प्लाज्मिड के साथ 4 ° c पर रात भर के लिए टी-6 ligase । 16 ज बाद में, बंधाव मिश्रण के 5 µ l को 25 µ l सक्षम DH5α कोशिकाओं में जोड़ें । उसके बाद, सफलतापूर्वक ligated plasmids स्क्रीन, और sequencing द्वारा सम्मिलित किए गए अंश की जाँच करें ।

2. Lentivirus पैकेज और संक्रमण

  1. कुल मिलाकर, PLKO .1-shVHL या PLKO .1-shScramble वेक्टर, ७.५ µ जी की पैकिंग प्लाज्मिड psPAX2, और २.५ µ जी के लिफाफा प्लाज्मिड pMD2 के 10 µ g को µ मीडिया के ५०० DMEM एल में मिश्रण के बिना भ्रूण गोजातीय सीरम (FBS) 25 मिनट के लिए ।
  2. ऊपर तैयार किए गए समाधान के लिए FBS बिना 7 mLDMEM जोड़ें ।
  3. संस्कृति 293FT DMEM में FBS के बिना एक 10 सेमी व्यास ऊतक संस्कृति व्यंजन में कोशिकाओं । सुनिश्चित करें कि 293FT कोशिकाओं की संख्या 1 x 107 एक सेल काउंटर का उपयोग कर रहा है ।
  4. अभिकर्मक के लिए 293FT कोशिकाओं के माध्यम से ऊपर तैयार समाधान की 1 मिलीलीटर जोड़ें ।
    नोट: 293FT सेल लाइन 293F सेल लाइन से ली गई है और छुरा SV40 बड़े टी प्रतिजन व्यक्त करते हैं । इसलिए, यह lentiviral उत्पादन के लिए एक उपयुक्त मेजबान है ।
  5. कल्चरल मीडियम को 6 ज के बाद 10% FBS वाले DMEM से बदलें ।
  6. अभिकर्मक के बाद ४८ ज पर एक पिपेट का उपयोग कर मीडिया लीजिए ।
    नोट: वायरस 10% FBS युक्त DMEM में मौजूद है । मृत कोशिकाओं के माध्यम पर नाव । मृत कोशिकाओं और अशुद्धियों फिल्टर करने के लिए ०.४५ µm बाँझ झिल्ली का प्रयोग करें । आम तौर पर, संक्रमण (MOI) की बहुलता की जांच करने की जरूरत नहीं है । यह एक स्थिर कोशिकाओं लाइन स्थापित करने के लिए है । अंतिम चरण में, सफल संक्रमण के बिना सभी जीवित कोशिकाओं puromycin द्वारा मर जाएगा । shScramble समूह और HUVEC कक्ष नियंत्रण समूह हैं । सुनिश्चित करें कि सभी HUVEC कोशिकाओं ७२ एच द्वारा इस्तेमाल किया puromycin एकाग्रता के साथ मर जाते हैं । हर अच्छी तरह से कोशिकाओं की एक ही संख्या है ।
  7. कल्चर को lentiviral मीडिया में HUVEC कोशिकाओं को ७२ ज. फिर, puromycin HUVEC कोशिकाओं के मीडिया के लिए 2 µ g/एमएल के लिए 24 घंटे की एकाग्रता में जोड़ें HUVEC कोशिकाओं का उपयोग नियंत्रण समूह के रूप में किसी भी उपचार के बिना । सुनिश्चित करें कि सभी नियंत्रण कोशिकाओं को इस समय से मर जाते हैं ।
    नोट: जीवित कोशिकाओं VHL पछाड़ना कोशिकाओं और shSramble कोशिकाओं की एक स्थिर कोशिका लाइन का प्रतिनिधित्व करते हैं । चढ़ाना घनत्व 5000/९६ में अच्छी तरह से प्लेटें है ।

3. Endothelial सेल Spheroids की जनरेशन

  1. HUVECs कोशिकाओं को Trypsinize और DMEM मीडियम में 10% FBS के साथ रिसस्पेंड कर दीजिये । एक 10-मुख्यमंत्री संस्कृति डिश में कोशिकाओं की एक मध्यम संख्या के साथ, typsin के 1 मिलीलीटर-EDTA जोड़ें ।
  2. बीज एक 3d दौर में कोशिकाओं के नीचे ९६-अच्छी तरह से थाली, 1 × 103 कोशिकाओं के एक सेल घनत्व पर/ एक अच्छा है कि ०.५० µ एल के एक अंडाकार आकृति को समायोजित करने के लिए अंडाकार आकृति को निलंबित कर सकते है का प्रयोग करें । निर्माता के निर्देशों का पालन करते हुए कक्ष काउंटर सिस्टम का उपयोग करके कक्ष गिनना ।
  3. ३७ ° c और 5% कं2 लगातार ७२ h के लिए कोशिकाओं में मशीन । इन शर्तों के तहत, सुनिश्चित करें कि निलंबित कक्ष spheroids स्वचालित रूप से कक्ष बनाते हैं । ३६ एच के बाद संस्कृति माध्यम के आधे बदलें ।

4. इन विट्रो Angiogenesis परख

  1. 4 डिग्री सेल्सियस पर जेल समाधान गल और 1:5 के एक कमजोर पड़ने अनुपात में कम सीरम माध्यम के साथ यह पतला ।
  2. एक micropipette के साथ DMEM संस्कृति माध्यम से spheroids चूसना । कम सीरम मध्यम के 5 मिलीलीटर के साथ spheroids धोने के बाद, spheroids धीरे और सावधानी से पतला जेल में निलंबित । सुनिश्चित करें कि कोई हवाई बुलबुले हैं ।
  3. एक 15-खैर प्लेट में मिश्रित तरल के ३०० µ एल एंबेड करें । ३७ ° c और 5% सह 1 ज के लिए2 पर मशीन के बाद, एक अच्छी तरह से कम सीरम मध्यम ४०० µ एल जोड़ें । कुओं के आसपास बाँझ पानी भरने के लिए वाष्पीकरण में बाधा एक humidified वातावरण उत्पन्न करने के लिए.
  4. इसके बाद, संस्कृति ३७ ° c में 5% सह में थाली 1 एच के लिए १००% आर्द्रता पर2
  5. ध्यान से पुराने माध्यम महाप्राण और यह एक अच्छी तरह से 1% endothelial सेल वृद्धि की खुराक के साथ कम सीरम मध्यम के ६०० µ एल द्वारा प्रतिस्थापित.
  6. 12 ज या 24 घंटे के बाद, एक औंधा प्रकाश माइक्रोस्कोप (४० *) के तहत छवियों को ले लो ।

5. डेटा विश्लेषण

  1. एक ऑनलाइन छवि विश्लेषण मंच के लिए छवियों को अपलोड करने के लिए अंकुरित लंबाई डेटा (सामग्री की तालिका) प्राप्त करते हैं ।
  2. वेबपेज पर, ईमेल द्वारा एक खाता बनाएँ.
  3. फिर अपलोड बटन पर क्लिक करके छवियों को अपलोड करें ।
  4. डाउनलोड बटन पर क्लिक करके परिणाम डाउनलोड करें ।
    नोट: सॉफ्टवेयर प्रोसेस्ड इमेज और डाटा जेनरेट करेगा । डेटा पांच भागों: संचई अंकुर लंबाई, मतलब अंकुर लंबाई, अंकुरित लंबाई, अंकुरित क्षेत्र और अंडाकार आकृति क्षेत्र के मानक विचलन शामिल हैं । संसाधित छवि में, प्रत्येक पैरामीटर संसाधित छवि में पहचान को कम करने के लिए एक अलग रंग में उल्लिखित है: लाल अंकुरित कंकाल का प्रतिनिधित्व करता है, पीला अंकुरित की संख्या, नीले अंकुरित संरचना, सफेद अंकुर अंत, और नारंगी अंडाकार आकृति.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

मूल छवियों औंधा प्रकाश माइक्रोस्कोप द्वारा लिया जाता है । नियंत्रण समूह और VHL समूह की सामांय छवियां चित्रा 2-A1 और चित्रा 2-A2में दिखाई जाती हैं । नियंत्रण समूह की अंकुरित लंबाई VHL समूह की तुलना में कम है ।

छवियों को अपलोड करने के बाद, ऑनलाइन मंच सीधे विश्लेषण परिणाम प्रदान करता है । आउटपुट दो भागों के होते हैं: संसाधित छवि और संबंधित विश्लेषण परिणाम । नियंत्रण समूह और VHL जीन मौन समूह की प्रसंस्कृत छवियां अलग रंग (चित्रा 2-A3 और चित्रा 2-A4) से चिह्नित हैं । मतलब अंकुर लंबाई ६५ µm और १२५ µm नियंत्रण समूह और VHL साइलेंस समूह में क्रमशः है, और औसत संचयी अंकुरित लंबाई ६८० µm और १२५० µm नियंत्रण समूह और VHL साइलेंस समूह में क्रमशः है, यह दर्शाता है कि अंकुरित लंबाई बढ़ जाती है VHL साइलेंस समूह में लगभग दो परतों, नियंत्रण समूह (चित्रा 2बी) के साथ तुलना में । इन परिणामों से संकेत मिलता है कि VHL की कमी मानव endothelial कोशिकाओं की पोत-बनाने की क्षमता को बढ़ावा देती है.

Figure 1
चित्र 1 . अंडाकार आकृति अंकुरण परख के लिए स्कीमा । चरण 1 से पता चलता है HUVEC कोशिकाओं एक डिश कल्चरित । चरण 2 में, HUVEC कक्ष 3d राउंड-नीचे ९६-well प्लेट्स ७२ h के लिए ले जाए जाते हैं । चरण 3 HUVEC कक्ष प्रपत्र endothelial कक्ष spheroids स्वचालित रूप से 3d प्लेट में दिखाता है । चरण 4 में, सेल अंडाकार आकृति को पतला जेल में जोड़ें । चरण 5 में, एक 15-well प्लेट के ऊपर तैयार मिश्रण जोड़ें । चरण 6 15-अच्छी तरह से थाली में अंकुरण अंडाकार आकृति दिखाता है । 7 कदम एक औंधा प्रकाश माइक्रोस्कोप के तहत लिया अंकुरित छवि दिखाओ । चरण 8 अपलोड की गई छवि दिखाता है और चरण 9 प्लेटफ़ॉर्म से आउटपुट छवि है (बार = १०० µm) । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2 . अंडाकार आकृति अंकुरित परख में HUVEC कोशिकाओं की angiogenic क्षमता पर VHL जीन मुंह बंद करने का प्रभाव पड़ता है. (क) टोंटी के प्रतिनिधि छवियों पर नियंत्रण में 12 ज (A1) और VHL-खामोश HUVEC spheroids (A2) (बार = १०० µm) के बाद । आंकड़े A3 और A4 चित्र A1 और A2, क्रमशः के लिए प्लेटफ़ॉर्म द्वारा विश्लेषित चित्रों को दिखाते हैं । लाल अंकुरित कंकाल का प्रतिनिधित्व करता है, पीले अंकुरित की संख्या, नीले अंकुरित संरचना, सफेद अंकुरित अंत, और नारंगी अंडाकार आकृति । (ख) अंकुरित की लंबाई । सांख्यिकीय विश्लेषण ख़राब है छात्र टी परीक्षण का उपयोग किया गया था । * P का प्रतिनिधित्व < ०.०५ । चुनाव, नियंत्रण; HUVEC, मानव नाल नस endothelial कोशिका. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

हाल ही में, संवहनी जीव विज्ञान अनुसंधान के कई क्षेत्रों angiogenic endothelium15के अध्ययन से उत्तेजित थे । इस अनुच्छेद में, हम एक प्रयोगात्मक मॉडल के रूप में एक endothelial अंडाकार आकृति तकनीक अंकुरण विकसित करने के लिए पोत गठन है कि हेरफेर endothelial कोशिकाओं में समारोह के VHL है जीन नुकसान से उत्पंन अध्ययन के उपंयास उंमीदवार अणुओं की पहचान angiogenic झरना । हमारे ज्ञान का सबसे अच्छा करने के लिए, यह पहली रिपोर्ट endogenic संशोधित endothelial कोशिकाओं के angiogenic प्रभाव की जांच करने के लिए है ।

ऊतक (ट्यूमर ऊतक सहित) neovascularization एक जटिल प्रक्रिया है कि विकास के दौरान angiogenic और vasculogenic तंत्र के माध्यम से होता है, साथ ही दोनों शारीरिक और रोग की स्थिति में12,15 , 16. अंडाकार आकृति अंकुरण परख की घटनाओं की एक जटिल झरना की विशेषता है 17, 18, स्वयं endothelial कोशिकाओं है कि एक 3 डी सेल मैट्रिक्स संस्कृति प्रणाली है, जो अंकुरण में परिणाम में एंबेडेड है के एकत्रीकरण सहित और केशिकाओं के 3 डी नेटवर्क के प्रजनन19। इस 3 डी जेल एंबेडेड अंडाकार आकृति मॉडल संवहनी गठन और इसके लिए एक उपयुक्त मैट्रिक्स में एक बेहतर नकल उतार वातावरण प्रदान करने की क्षमता के कारण तंत्र का अध्ययन करने के लिए ऊतक इंजीनियरिंग में एक व्यापक रूप से इस्तेमाल किया प्रणाली बन गया है । हालांकि, इस जैविक प्रक्रिया का सबसे महत्वपूर्ण कदम quiescent endothelial कोशिकाओं के सक्रियकरण17,20,21,22है । इस प्रक्रिया में, endothelial कोशिकाओं VHL जीन, neovessels23,24के एक नियामक वृद्धि जीन के endogenic मुंह बंद करने द्वारा सक्रिय किया गया । मैट्रिक्स और इसी extracellular वातावरण (exogenous संवहनी वृद्धि कारकों सहित) के exogenous प्रेरण के माध्यम से क्लासिक endothelium दीक्षा से अलग है, इस संशोधित विधि कई के लिए बढ़ाया जा सकता है endogenic आनुवंशिक तंत्र को खंडित करने के लिए आवेदन । अगले, exogenous मैट्रिक्स के प्रभाव को कम करने के लिए, प्रोटोकॉल कमजोर द्वारा अनुकूलित किया गया था जेल, जो प्रयोग में एक सरल कदम था । इसके अलावा, यह मंच पर छवियों को अपलोड करने के लिए और विश्लेषण परिणाम प्राप्त करने के लिए केवल मिनट लगे । मंच एक छवि विश्लेषण सेवा है कि प्रयोगकर्ता एक उद्देश्य बनाने के लिए, तुलनीय, और परख छवियों अंकुरण ऑनलाइन के स्वचालित छवि विश्लेषण की अनुमति देता है प्रदान करता है । इसलिए, प्रोटोकॉल माप और परिकलन त्रुटियां मानव निर्मित कारकों के कारण पर काबू ।

neovascularization झरना के व्यक्तिगत कदम के यंत्रवत समझ विरोधी संवहनी उपचार है कि वर्तमान में ऑन्कोलॉजी में नैदानिक आवेदन के लिए अनुमोदित किया जा रहा है के विकास के लिए एक तर्कसंगत आधार प्रदान की है । इस पत्र की स्थापना की एक सरल और मजबूत अंडाकार आकृति आधारित परख के लिए पोत गठन है कि VHL जीन के समारोह के नुकसान के साथ endothelial कोशिकाओं से उत्पंन अध्ययन मॉडल के लिए उपंयास उंमीदवार अणुओं की पहचान के लिए neovascularization झरना, जो कई angiogenesis के लिए उपयोग किया जा सकता है-और vasculogenesis से संबंधित अनुप्रयोगों । लेखक अटकलें है कि इस इन विट्रो मॉडल में मदद करने के लिए कुछ ठोस ट्यूमर में angiogenesis की भूमिका का मूल्यांकन करने के लिए अतिरिक्त जानकारी प्रदान कर सकता है (जैसे, ट्यूमर vasculogenic नकल) और अंय संभव जनक कोशिकाओं की संभावित भूमिकाओं की जांच vivo मेंट्यूमर neovessels उत्पन्न करने के लिए, विशेष रूप से ट्यूमर के साथ रोगियों में है कि, एक समूह के रूप में, विरोधी angiogenic एजेंटों के साथ ही इलाज के लिए निष्क्रिय कर रहे हैं.

अंडाकार आकृति अंकुरण परख angiogenesis और संबंधित तंत्र का अध्ययन करने के लिए एक व्यापक रूप से इस्तेमाल किया विधि बन गया है । परख शास्त्रीय 2d संस्कृतियों से एक बेहतर नकल पर्यावरण प्रदान करके एक महत्वपूर्ण लाभ है । हाल ही में, 3 डी सह संस्कृति मॉडल ट्यूमर angiogenesis है कि ट्यूमर के भीतर angiogenesis की विविधता और जटिलता की नकल का अध्ययन करने के लिए विकसित किया गया है microenvironment25। इस मॉडल में, endothelial कोशिकाओं कैंसर कोशिकाओं के साथ सीधे संस्कृति, साथ ही एक 3 डी वातावरण में एक stromal घटक हैं । इसके अलावा, 3 डी इन विट्रो संस्कृति प्रणालियों में और अधिक सही पारंपरिक सेल संस्कृति प्रणालियों से चिकित्सीय एजेंटों के लिए vivo में प्रतिक्रिया को प्रतिबिंबित करने के लिए दिखाया गया है । इसके अलावा, इस विधि भ्रूण स्टेम कोशिकाओं के भेदभाव के लिए प्रयोग किया जाता है, ऊतक विकास, घाव भरने, ischemia, और सूजन । क्लासिक विधि के साथ तुलना में, हमारे दृष्टिकोण प्रभावी और लागू करने के लिए आसान है । हमारा मानना है कि यह इन विट्रो मेंangiogenesis के अध्ययन के लिए एक उपयोगी उपकरण है, और यह इस प्रक्रिया को बेहतर समझने के लिए एक नया तरीका खुलता है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

यह काम विज्ञान और प्रौद्योगिकी की शंघाई समिति (१५४११९५१८००, १५४१०७२३२००) से अनुदान द्वारा समर्थित किया गया था । लेखक प्रो YuMei वेन और उनके तकनीकी सहायता के लिए फुदन विश्वविद्यालय के रोगजनक सूक्ष्मजीवों विभाग के प्रो चाओ Zhao शुक्रिया अदा करना चाहता हूं ।

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
एक व्यापक प्रक्रिया का मूल्यांकन करने के लिए इन <em>विट्रो में</em> प्रदर्शन के ख्यात Hemangioblastoma Neovascularization का उपयोग कर अंडाकार आकृति अंकुरण परख
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter