Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

En omfattende prosedyre å evaluere In Vitro ytelsen til den antatte Hemangioblastoma Neovascularization bruker Spheroid spirende analysen

doi: 10.3791/57183 Published: April 12, 2018

Summary

Dette dokumentet presenterer en omfattende prosedyre for å vurdere i vitro om klassisk svulst angiogenese finnes i hemangioblastomas (HBs) og dens rolle i HBs. Resultatene markere kompleksiteten i HB-neovascularization og foreslår at dette vanlig form av angiogenese er bare en utfyllende mekanisme i HB-neovascularization.

Abstract

Inaktivering av von Hippel-Lindau (VHL) tumor suppressor genet spiller en avgjørende rolle i utviklingen av hemangioblastomas (HBs) i menneskelig sentralnervesystemet (CNS). Men både fargemaskin opprinnelsen og evolusjonsprosessen av HBs (inkludert neovascularization) fortsatt kontroversielt, og anti-angiogenese for VHL-HBs, basert på klassiske HB angiogenese, har produsert skuffende resultater i kliniske forsøk. En stor utfordring for vellykket klinisk oversettelsen av anti-vaskulær behandling er mangelen på en grundig forståelse av neovascularization i denne vaskulær svulst. I denne artikkelen presenterer vi en omfattende prosedyre for å vurdere i vitro om klassisk svulst angiogenese finnes i HBs, i tillegg til sin rolle i HBs. Med denne fremgangsmåten kan forskere nøyaktig forstå kompleksiteten av HB neovascularization og identifisere funksjonen til dette vanlig form av angiogenese i HBs. Disse protokollene kan brukes til å vurdere den mest lovende anti-vaskulær terapien for svulster, som har høy translasjonsforskning potensial for svulst behandling eller for å hjelpe i optimalisering av anti-angiogenic behandling for HBs i fremtiden oversettelser. Resultatene markere kompleksiteten i HB neovascularization og tyder på at denne felles skjema angiogenese er bare en utfyllende mekanisme i HB neovascularization.

Introduction

Hemangioblastomas (HBs) er godartet vaskulær svulster som finnes utelukkende i menneskelig sentralnervesystemet (CNS). De utvikler hos pasienter med von Hippel-Lindau (VHL) sykdom eller sporadisk lesjoner. VHL-HBs er vanskelig å kurere gjennom kirurgisk behandling på grunn av hyppige regelmessigheten flere lesjoner som følge av dette genetisk lidelse1. Selv om inaktivering av VHL tumor suppressor genet har blitt vurdert rotårsak av tumorigenesis av VHL-HBs, forblir fargemaskin opprinnelse (inkludert neovascularization) og evolusjonsprosessen av HBs i stor grad kontroversielle2. Derfor kan en bedre forståelse av HB-neovascular biologiske mekanismer gi nyttig innsikt i de mest lovende anti-vaskulær strategiene for VHL-HBs.

Nyere forskning har antydet at HB-neovascularization ligner på embryologic vasculogenesis3,4,5. Klassisk vaskulær endotelial vekstfaktor (VEGF)-mediert angiogenese som stammer fra vaskulære endotelet, og som er drevet av VHL tap av funksjon resulterte i spredning og neovascular formasjon, som er utfordret6. I 1965, Cancilla og Zimmerman funnet, bruker du elektronmikroskop, som HBs stammer fra endotelet7. Senere ble det funnet at stromal celler er utledet fra vasoformative element8. I 1982 funnet Jurco et al. at stromal celler er endothelial opprinnelse9. Derfor hypotese vi at vaskulær endotelial menneskeceller er de opprinnelige cellene HB-neovascularization10. Selv om det er bedre å bruke de primære kulturene fra HB celler avledet fra VHL pasienten operasjoner, viste vår tidligere forskning at primære kulturer fra HB er ikke stabil og cellelinjer kunne ikke være etablerte3. Videre kan primære kulturer i 3D-miljøet ikke identifisere fargemaskin opprinnelsen til HB-neovascularization fordi de inneholder progenitors av HB-vaskulær ingredienser10,11. Derfor, som en primitiv og klassisk modell til endotelceller, kan menneskelige vaskulær endotelceller (HUVEC) tjene som en alternativ mobilnettet modell for HBs.

Spheroid spirende analysen er en ny modell i vev engineering12,13. I dette papiret, en 3D kollagen-baserte coculture systemet i vitro bruker spheroid spirende analysen ble utviklet, med et samlet mål til å vurdere om klassisk svulst angiogenese finnes i HBs, i tillegg til sin rolle i HBs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne metoden ble utført i henhold til godkjente retningslinjer og reguleringer av forskning etikk komiteen av Huashan sykehuset, Fudan University. Tilsvarende standard sikkerhetstiltak ble fulgt i hvert trinn. En skjematisk presentasjon, se figur 1.

1. celle kultur og plasmider konstruere

  1. Rutinemessig vedlikehold den menneskelige umbilical blodåre endothelial cellen (HUVEC) i Dulbecco modifiserte Eagle's medium (DMEM) med 10% fosterets bovin serum (FBS), 100 enhet/mL av penicillin og 100 µg/mL streptomycin i en fuktet 5% CO2 inkubator på 37 ° C.
  2. Ufullstendig PLKO.1 plasmider med ApaI og EcoRI for syntese av shRNA fragment. Kontroller at oligonucleotide rekkefølgen av VHL shRNA vektor er CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Så, blande 20 µΜ system med fremover 5 µL oligo, 5 µL av omvendt oligo, 5 µL av 10 x NB buffer og 35 µL ddH2O sammen (det totale volumet er 50 µL). Varm blandingen ved 98 ° C i 4 min, og langsomt avkjøles til romtemperatur i noen timer.
  4. Ligate de glødet oligos og PLKO.1 plasmider sammen med T4 ligase på 4 ° C for overnatting. 16 h senere, legge til 5 µL av hemorroider i 25 µL kompetent DH5α celler. Deretter skjermen vellykket ligated plasmider og kontrollere innsatt fragment av sekvenser.

2. lentivirus pakken og infeksjon

  1. Bland 10 µg av vektoren PLKO.1-shVHL eller PLKO.1-shScramble, 7,5 µg av plasmider psPAX2 og 2,5 µg av konvolutten plasmider pMD2.G i 500 µL av DMEM media uten fosterets bovin serum (FBS) for 25 min totalt.
  2. Legge til 7 mLDMEM uten FBS løsning utarbeidet over.
  3. Kultur 293FT cellene i DMEM uten FBS i en 10 cm diameter vev kultur retter. Kontroller at antall 293FT celler er 1 x 107 benytter en celle teller.
  4. Legg 1 mL av løsningen forberedt over til middels 293FT celler transfection.
    Merk: 293FT cellen er avledet fra 293F celle linje og express stabilt SV40 store T antigen. Det er derfor en egnet vert for lentiviral produksjon.
  5. Erstatte kultur medium med DMEM som inneholder 10% FBS etter 6 h.
  6. Samle media bruker en pipette på 48 timer etter hva.
    Merk: Viruset finnes i DMEM som inneholder 10% FBS. De døde cellene flyter på mediet. Bruk 0,45 µm sterilt membran for å filtrere døde celler og urenheter. Generelt, det er ikke nødvendig å sjekke mangfold av infeksjon (MOI). Dette er å etablere en stabil celler linje. På det siste trinnet, vil alle levende celler uten infeksjonen dø av puromycin. ShScramble grupper og HUVEC celler er kontrollgruppen. Kontroller at alle HUVEC cellene dør med brukte puromycin konsentrasjonen av 72 h. Hver brønn har samme antall celler.
  7. Kultur HUVEC cellene i lentiviral media 72 h. Deretter legge til puromycin til media HUVEC cellene i en konsentrasjon av 2 µg/mL for 24 h. Bruk HUVEC celler uten behandling som kontrollgruppen. Kontroller at alle kontrollere celler dør på denne tiden.
    Merk: Levende celler representerer en stabil celle linje med VHL knockdown celler og shSramble celler. Plating tetthet er 5000/godt i 96-brønnen plater.

3. generasjon Endothelial celle Spheroids

  1. Trypsinize HUVECs cellene og resuspend i DMEM medium med 10% FBS. Legge til 1 mL av typsin-EDTA moderat flere celler i en 10 cm kultur parabol.
  2. Frø cellene i en 3D runde-96-brønns bunnplaten, på en celle tetthet av 1 × 103 celler/godt. Bruk en brønn som rommer en spheroid av 0,50 µL å suspendere formet. Telle celler med en celle telleren system følger produsentens instruksjoner.
  3. Inkuber cellene på 37 ° C og 5% CO2 sammenhengende i 72 h. Under disse forholdene, sikre at suspendert cellene danne celle spheroids automatisk. Erstatte halvparten av kultur mediet etter 36 h.

4. in vitro angiogenese analysen

  1. Tine gel løsningen på 4 ° C og fortynn den med redusert serum mediet i fortynning forholdet 1:5.
  2. Suge spheroids fra DMEM kultur medium med brønnene. Etter vask spheroids med 5 mL redusert serum medium, avbryte spheroids forsiktig og forsiktig utvannet gel. Kontroller at det er ingen luftbobler.
  3. Bygge 300 µL av blandet i en 15-vel plate. Etter inkubasjon på 37 ° C og 5% CO2 1t Legg 400 µL redusert serum mediet i hver brønn. Fyll sterilt vann rundt brønnene generere en fuktet miljø for å hindre fordampning.
  4. Deretter kultur plate på 37 ° C i 5% CO2 på 100% luftfuktighet 1t.
  5. Nøye Sug opp den gamle mediet og erstatte den med 600 µL av redusert serum medium med 1% endothelial celle vekst kosttilskudd i hver brønn.
  6. Etter 12 h eller 24 timer, ta bilder under en invertert lys mikroskop (40 *).

5. analyse

  1. Laste opp bildene til en tilkoblet avbildning analyse plattform å få spire lengde data (Tabell for materiale).
  2. Websiden kan du opprette en konto på e-post.
  3. Deretter laste opp bildene ved å klikke på knappen Last.
  4. Last ned resultatet ved å klikke Last ned-knappen.
    Merk: Programvaren genererer behandlet bildet og dataene. Dataene inneholder fem deler: kumulativ spire lengde, mener spire lengde, standardavviket for spire lengde, spire og formet område. I behandlet bildet, markeres hver parameter i en annen farge å lette identifikasjon i behandlet bildet: rød representerer spirer skjelett, gul antall spirer, blå spire strukturen, hvit spire slutten og oransje-formet.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Opprinnelige bildene er tatt av invertert lys mikroskop. Typisk bilder av kontrollgruppen og gruppen VHL er vist i figur 2-A1 og figur 2-A2. Spirende er kontrollgruppen kortere enn gruppen VHL.

Etter opplasting av bilder, gir online plattform analyseresultater direkte. Produksjonen består av to deler: behandlet bildet og tilsvarende analyseresultatene. Behandlet bilder av kontrollgruppen og gruppen VHL gene stillhet merkes med forskjellige farger (figur 2-A3 og figur 2-A4). Mener spire lengden er 65 µm og 125 µm i kontrollgruppen og gruppen VHL stillhet henholdsvis, og gjennomsnittlig kumulative spire lengden er 680 µm og 1250 µm i kontrollgruppen og gruppen VHL stillhet henholdsvis angir som spire lengde øker med omtrent to folder i gruppen VHL stillhet, sammenlignet med kontrollgruppen (figur 2B). Disse resultatene indikerer at VHL mangel fremmer fartøy-forming muligheten for menneskelig endotelceller.

Figure 1
Figur 1 . Skjemaet for spheroid spirende analysen. Trinn 1 viser HUVEC celler kultivert en rett. I trinn 2 flyttes HUVEC celler til 3D runde-96-brønns bunnplater for 72 h. trinn 3 viser skjemaet HUVEC celler endothelial celle spheroids automatisk i 3D plate. I trinn 4, legge til celle spheroid utvannet gel. I trinn 5, legg blandingen utarbeidet over til en 15-vel plate. Trinn 6 viser spheroid spirende i 15-vel plate. Trinn 7 viser spirende bildet tatt under en invertert lys mikroskop. Trinn 8 viser det opplastede bildet og trinn 9 er produksjon image fra plattformen (bar = 100 µm). Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 . Effekten av VHL genet silencing på angiogenic evnen til HUVEC celler i spheroid spirende analysen. (A) representant bilder av tut utvekst etter 12 h i kontroll (A1) og VHL-forstummet HUVEC spheroids (A2) (bar = 100 µm). Tallene A3 og A4 viser bildene analyseres av plattformen for tallene A1 og A2, henholdsvis. Rød representerer spirer skjelett, gul antall spirer, blå spire strukturen, hvit spire slutten og oransje-formet. (B) lengden av spirer. Statistisk analyse ble utført kort Student t-test. * representerer P < 0,05. CON, kontroll; HUVEC, menneskelige umbilical vene endothelial celle. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Nylig ble flere felt vaskulær biologi forskning stimulert av studere angiogenic endotelet15. I denne artikkelen vi utviklet en endothelial spheroid spirende teknikk som en eksperimentell modell å studere fartøyet dannelsen som stammer fra VHL genet tap av funksjon i manipulert endotelceller å identifisere roman kandidat molekyler av den angiogenic cascade. Best av vår kunnskap er dette den første rapporten undersøke angiogenic effekten av endogenic endret endotelceller.

Tissue (inkludert tumor vev) neovascularization er en kompleks prosess som skjer via angiogenic og vasculogenic mekanismer under utvikling og både fysiologiske og patologiske tilstander12,15 , 16. formet spirende analysen er preget av en kompleks kaskade av hendelser17,18, inkludert selv aggregering av endotelceller som er innebygd i en 3D-cellen matrix kultur system, som resulterer i spirende og gjengivelse av 3D nettverket kapillærene19. Denne 3D gel-embedded spheroid modellen har blitt en mye brukt system i vev engineering for å studere vaskulær dannelsen og dens mekanismer på grunn av sin evne til å gi et bedre mimicking miljø i en egnet matrise. Men er det mest avgjørende skrittet i denne biologiske prosessen aktivering av quiescent endotelceller17,20,21,22. I denne fremgangsmåten ble endotelceller aktivert ved endogenic silencing av VHL genet, en regulator vekst genet neovessels23,24. Forskjellig fra den klassiske endotel innvielsen via eksogene induksjon av matrix og tilsvarende ekstracellulære miljø (inkludert eksogene vaskulær vekst faktorer), denne endrede metoden kan utvides til mange programmer for å løse endogenic genetiske mekanismer. Neste, for å dempe virkningene av eksogene matrix, protokollen var optimalisert fortynne gel, som var et enkelt trinn i eksperimentet. Dessuten, tok det bare minutter å laste opp bilder til plattformen og vise analyseresultater. Plattformen tilbyr en analyse tjenesten som lar eksperimentator å gjøre en målsetting, sammenlignbare, og automatiserte bildeanalyse av spirende analysen bilder på nettet. Derfor overvinner protokollen målinger og beregningsuttrykk feil forårsaket av kunstige faktorer.

Mekanistisk forståelsen av de individuelle trinnene i neovascularization kaskade ga en rasjonell grunnlag for utviklingen av den anti-vaskulære behandlingen som for tiden blir godkjent for klinisk anvendelse i onkologi. Dette papiret etablert en enkel og robust spheroid-baserte analysen modell for å studere fartøyet formasjon som stammer fra manipulert endotelceller med tap av funksjon av VHL genet å identifisere roman kandidat molekyler for neovascularization overlappet, som kan benyttes for mange angiogenese - og vasculogenesis-relaterte programmer. Forfatterne spekulere at denne i vitro modellen kan gi ytterligere informasjon for å vurdere rollen angiogenese i noen solide tumorer (f.eks svulst vasculogenic etterligner) og undersøke mulige rollene til andre mulig stamfar celler generere svulst neovessels i vivo, spesielt hos pasienter med svulster som, som en gruppe, reagerer ikke på behandling med anti-angiogenic agenter bare.

Spheroid spirende analysen har blitt en brukte metoden angiogenese og relaterte mekanismer. Analysen har en viktig fordel ved å gi et bedre etterligne miljø enn den klassiske 2D kulturene. Nylig er 3D co kultur modeller utviklet for å studere svulst angiogenese som etterligner heterogenitet og kompleksiteten av angiogenese i svulst microenvironment25. I denne modellen er endotelceller kultivert direkte med kreftceller, i tillegg til en stromal komponent i et 3D-miljø. I tillegg har 3D i vitro kultur systemer blitt vist å reflektere mer nøyaktig svaret i vivo terapeutiske agenter enn konvensjonelle celle kultur systemer. Denne metoden brukes i tillegg til differensiering av embryonale stamceller, vevvekst, sårheling, iskemi og betennelse. Sammenlignet med den klassiske metoden, er vår tilnærming effektiv og lett å implementere. Vi tror det er et nyttig verktøy for studiet av angiogenese i vitro, og det åpnes en ny måte å forstå denne prosessen bedre.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble støttet av tilskudd fra Shanghai komiteen av vitenskap og teknologi (15411951800, 15410723200). Forfatterne ønsker å takke Prof YuMei Wen og Prof Chao Zhao av patogene Microorganism avdeling av Fudan University of deres kundestøtte.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
En omfattende prosedyre å evaluere <em>In Vitro</em> ytelsen til den antatte Hemangioblastoma Neovascularization bruker Spheroid spirende analysen
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter