Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Cancer Research

Всеобъемлющей процедуры для оценки производительности в Vitro предполагаемый Гемангиобластома неоваскуляризация, используя сфероида прорастания Assay

doi: 10.3791/57183 Published: April 12, 2018

Summary

Этот документ представляет собой всеобъемлющую процедуру для оценки в vitro классические опухоли ангиогенеза существует ли в гемангиобластомы (ХБС) и его роль в ОБД. Результаты подчеркивают сложность HB-неоваскуляризации и предполагают, что эта распространенная форма по ангиогенез только дополнительный механизм в HB-неоваскуляризации.

Abstract

Инактивации ген-супрессор опухолевого фон Хиппель-Линдау (ВХЛ) играет решающую роль в развитии гемангиобластомы (ХБС) внутри человека центральной нервной системы (ЦНС). Однако цитологические происхождения и процесс эволюции HBs (включая неоваскуляризация) остаются спорными, и анти ангиогенеза для ВХЛ-HBs, основанный на классической HB ангиогенеза, дали неутешительные результаты в клинических испытаниях. Одним из основных препятствий для успешной клинической перевод анти сосудистой лечения является отсутствие глубокого понимания неоваскуляризация в этом сосудистые опухоли. В этой статье мы представляем всеобъемлющей процедуры для оценки в vitro классические опухоли ангиогенеза существует ли в ОБД, а также его роль в ОБД. С этой процедурой исследователи могут точно понять сложность HB неоваскуляризации и определить функции этой распространенной формой ангиогенеза в ОБД. Эти протоколы могут использоваться для оценки наиболее перспективных анти сосудистой терапии опухолей, который имеет высокий трансляционная потенциал для лечения опухоли либо пособничество в оптимизации лечения анти ангиогенных HBs в будущем переводы. Результаты подчеркивают сложность HB неоваскуляризации и предположить, что это общие формы ангиогенез-это только дополнительный механизм в HB неоваскуляризации.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Гемангиобластомы (ХБС) являются доброкачественные сосудистые опухоли, которые находятся исключительно в пределах человека центральной нервной системы (ЦНС). Они развиваются в больных с фон Хиппель-Линдау (ВХЛ) болезни или спорадические поражений. ВХЛ-HBs трудно вылечить путем хирургического лечения из-за частого повторения и несколько поражений, которые в результате этого генетические расстройства1. Хотя инактивации ген-супрессор опухолевого ВХЛ рассмотрел причины tumorigenesis ВХЛ-HBs, цитологические происхождения (включая неоваскуляризация) и эволюционного процесса HBs остаются во многом спорные2. Поэтому лучшее понимание биологических механизмов HB-неоваскулярной может дать полезную информацию в наиболее перспективных анти сосудистой стратегии для ВХЛ-HBs.

Недавние исследования показали, что HB-неоваскуляризация похож на эмбриологических vasculogenesis3,4,5. Классический Сосудистый эндотелиальный фактор роста (VEGF)-опосредованной ангиогенеза, возникла из эндотелия и что движет ВХЛ потеря функции привело к распространению и формирование неоваскулярной, которая была оспорена6. В 1965 году, Cancilla и Циммерман найдена, с помощью электронной микроскопии, что ХБС возникла из эндотелия7. Позже было установлено, что стромальных клеток являются производными от vasoformative элемент8. В 1982 году Jurco et al. обнаружил, что стромальных клеток эндотелия происхождения9. Таким образом мы предположили, что человеческого сосудистой эндотелиальные клетки являются оригинальные клетки HB-неоваскуляризация10. Хотя это лучше использовать основной культуры от HB клеток, полученных от пациентов хирургии ВХЛ, наши предыдущие исследования указал, что основной культуры от HB не являются стабильными и клеточных линий не может быть установленным3. Кроме того основных культур в 3D среде не может опознать цитологического происхождения HB-неоваскуляризация потому, что они включают в себя родоначальниками HB-сосудистой ингредиенты10,11. Таким образом, как примитивные и классическая модель эндотелиальных клеток клеток человека сосудистого эндотелия (HUVEC) может служить альтернативной сотовой модели для HBs.

Прорастания пробирного сфероида представляет собой новую модель в ткани, инженерных12,13. В этом документе, 3D на основе коллагена coculture системы в пробирке с помощью сфероида прорастания пробирного была разработана, с общей целью оценить классические опухоли ангиогенеза существует ли в ОБД, а также его роль в ОБД.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Этот метод был проведен в соответствии с утвержденными руководящими принципами и положениями исследовательской этики Комитета из Хуашань больницы, Университет Фудань. Соответствующий стандарт безопасности меры соблюдались в каждом шаге. Для схематического представления пожалуйста, обратитесь к рис.

1. клетки культуры и плазмидные конструкции

  1. Постоянно поддерживать человека пупочную вену эндотелиальных клеток (HUVEC) в Дульбекко модифицированная орла среднего (DMEM) с 10% плода бычьим сывороточным (ФБС), 100 единицы/мл пенициллина и 100 мкг/мл стрептомицина в увлажненные 5% CO2 инкубатора в 37 ° C.
  2. Дайджест PLKO.1 плазмиду с ApaI и EcoRI для синтеза индуцируемый фрагмента. Убедитесь, что последовательности олигонуклеотида ВХЛ индуцируемый вектора CCGGGATCTGGAAGACCACCCAAATCTCGAGA TTTGGGTGGTCTTCCAGATCTTTTTG14.
  3. Затем смешайте 20 µΜ системы с вперед 5 мкл oligo, 5 мкл обратный oligo, 5 мкл 10 x буфер НЭБ и 35 мкл ddH2O вместе (общий объем-50 мкл). Нагрейте смесь на 98 ° С в течение 4 мин и медленно остыть до комнатной температуры в течение нескольких часов.
  4. Перевязать отожженная oligos и PLKO.1 плазмиды вместе с T4 лигаза на 4 ° C для ночлега. 16 h позже, 5 мкл лигирование смеси в 25 мкл компетентным DH5α клетки. Затем экран успешно перевязаны плазмид и проверьте вставленного фрагмента путем sequencing.

2. Лентивирусы пакет и инфекции

  1. В общей сложности Смешайте 10 мкг PLKO.1-shVHL или PLKO.1-shScramble вектора, 7.5 мкг упаковки плазмида psPAX2 и 2,5 мкг конверт плазмида pMD2.G в 500 мкл DMEM СМИ без плода бычьим сывороточным (ФБС) 25 мин.
  2. Добавьте в раствор, приготовленный выше 7 mLDMEM без FBS.
  3. Культура клетки 293FT в среде DMEM без FBS в блюдах культуры ткани диаметром 10-см. Убедитесь, что количество клеток 293FT 1 x 107 , используя счетчик соматических клеток.
  4. Добавьте 1 мл раствора, подготовленный выше средний 293FT клеток для transfection.
    Примечание: Клеточная линия 293FT является производным от линии клеток 293F и стабильно Экспресс SV40 большой T антигена. Таким образом это подходящий хост для лентивирусные производства.
  5. Заменить культурной среде DMEM, содержащие 10% FBS через 6 ч.
  6. Сбор средств массовой информации, с помощью пипетки на 48 ч после transfection.
    Примечание: Этот вирус существует в среде DMEM, содержащие 10% FBS. Мертвые клетки плавать на носителе. Используйте 0,45 мкм стерильным мембраны для фильтрации ороговевшие клетки и загрязнения. Как правило нет необходимости для проверки кратности инфекции (МВД). Это заключается в создании стабильной клеток линии. На последнем шаге все живые клетки без успешного инфекции умирают по puromycin. ShScramble группы и клеток HUVEC являются контрольной группы. Убедитесь, что все клеток HUVEC умереть с концентрацией используемых puromycin 72 ч. Каждый хорошо имеет такое же количество клеток.
  7. Культура клеток HUVEC в лентивирусные СМИ за 72 ч. Затем добавьте puromycin к средствам массовой информации клеток HUVEC в концентрации 2 мкг/мл в течение 24 ч. Использование HUVEC клетки без какого-либо лечения как в контрольной группе. Убедитесь, что все управления клетки умирают на этот раз.
    Примечание: Живые клетки представляют собой стабильный клеток линии ВХЛ нокдаун клеток и shSramble клеток. Плотность покрытия 5000/хорошо в 96-луночных пластины.

3. поколение сфероидов эндотелиальных клеток

  1. Trypsinize HUVECs клеток и Ресуспензируйте в среде DMEM с 10% FBS. С умеренным количеством клеток в культуре 10 см блюдо добавьте 1 мл typsin-ЭДТА.
  2. Заполнение ячеек в 3D раунд-96-луночных днище, на плотность клеток 1 × 103 клеток/скважины. Использование колодца, который может вместить сфероиде 0,50 мкл приостановить сфероида. Подсчет количества ячеек с помощью счетчика системы клеток следуя инструкциям производителя.
  3. Инкубируйте клетки при 37 ° C и 5% CO2 непрерывно в течение 72 ч. В этих условиях убедитесь, что подвесной клетки образуют сфероидов ячейки автоматически. Замените половину из питательной среды после 36 часов.

4. в vitro Assay ангиогенеза

  1. Оттепель решения гелем на 4 ° C и разбавить его с сокращение сыворотке среднего на коэффициент разбавления 1:5.
  2. Сосать сфероидов от DMEM питательной среды с микропипеткой. После мытья сфероидов с 5 мл среды, сокращение сыворотке, приостановить сфероидов мягко и осторожно в разреженных геля. Убедитесь, что нет пузырьков воздуха.
  3. Внедрите 300 мкл смешанной жидкости в пластине 15-хорошо. После инкубации при 37 ° C и 5% CO2 за 1 ч мкл 400 сокращение сыворотке среднего для каждой скважины. Заполните стерильной воды вокруг лунки для создания увлажненной среде затрудняет испарение.
  4. После этого культура пластины при 37 ° C в 5% CO2 при влажности до 100% за 1 ч.
  5. Тщательно аспирационная старый среднего и заменить его 600 мкл сокращение сыворотке среды с 1% добавки рост эндотелиальных клеток в каждой скважине.
  6. После 12 ч или 24 ч, принимать изображения под Перевернутый световой микроскоп (40 *).

5. анализ данных

  1. Загрузите изображения на платформу анализа изображений в Интернете для получения рассады длина данных (Таблица материалов).
  2. На веб-странице Создайте учетную запись по электронной почте.
  3. Затем загрузите изображения, нажав кнопку Загрузить.
  4. Скачайте результат, нажав кнопку Загрузить.
    Примечание: Программное обеспечение будет генерировать обработанные изображения и данные. Данные содержат пять частей: Накопительное Росток, длина средняя Росток, стандартное отклонение длины Росток, прорастают зона и зона сфероида. Обработанные изображения, каждый параметр изложена в другой цвет для облегчения идентификации обработанные изображения: красный представляет ростки скелета, желтый количество побегов, синий структура прорастают, конец белый прорастают и оранжевый сфероида.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Исходные изображения принимаются Перевернутый световой микроскоп. Типичный изображения ВХЛ группы и группы управления показаны на рисунке 2-A1 и 2-A2. Прорастания длина контрольной группы короче, чем в группе ВХЛ.

После загрузки изображений, онлайн платформа предоставляет результаты анализа непосредственно. Вывод состоит из двух частей: обработанные изображения и соответствующие результаты анализа. Обработанные изображения в контрольной группе и группе молчание генов ВХЛ отмечены различными цветами (рис. 2-A3 и 2-A4). Средняя Росток составляет 65 мкм и 125 мкм в контрольной группе и группе молчание ВХЛ, соответственно, и средний совокупный Росток составляет 680 мкм и 1250 мкм в контрольной группе и группе молчание ВХЛ, соответственно, о том, что, прорастают длина увеличивается на примерно две складки в ВХЛ молчание группы, по сравнению с контрольной группой (рис. 2B). Эти результаты показывают, что дефицит ВХЛ способствует судна формирование способности эндотелиальных клеток человека.

Figure 1
Рисунок 1 . Схема для прорастания пробирного сфероида. Шаги 1 показывает, что HUVEC клетки культивировали блюдо. В шагах 2 клеток HUVEC перемещаются в 3D раунд-96-луночных поддоны для 72 ч. шаги 3 показывает форма клеток HUVEC эндотелиальных клеток сфероидов автоматически в 3D пластины. В шаги 4 Добавьте ячейку сфероида разбавленный гель. В шаги 5 Добавьте смесь, подготовленный выше к пластине 15-хорошо. Шаги 6 показывает сфероида прорастания в пластине 15-хорошо. Шаги 7 показывают прорастания изображения взяты под Перевернутый световой микроскоп. Шаги 8 показывает загруженные изображения и шаг 9 выходного изображения от платформы (бар = 100 мкм). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2 . Влияние ВХЛ подавления экспрессии гена на ангиогенных способность клеток HUVEC в прорастания пробирного сфероида. (A) представитель изображения носик нарост через 12 ч в управления (A1) и замолчать ВХЛ HUVEC сфероидов (А2) (бар = 100 мкм). Цифры A3 и A4 Показать изображения, проанализированы платформой для фигур А1 и А2, соответственно. Красный представляет ростки скелета, желтый количество побегов, синий структура прорастают, конец белый прорастают и оранжевый сфероида. (B) длина проростков. Статистический анализ проводилось с использованием непарных студент t теста. * Представьте P < 0,05. CON, управления; HUVEC, эндотелиальных клеток человека пупочную вену. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

Недавно несколько полей сосудистая биология исследований были простимулированы изучение ангиогенных эндотелия15. В этой статье, мы разработали эндотелиальной сфероида прорастания техника как экспериментальная модель для изучения формирования судна, что происходит от гена ВХЛ потеря функции в манипулировать эндотелиальные клетки для выявления роман кандидат молекул ангиогенных Каскад. Насколько нам известно это первый доклад для изучения эффектов ангиогенных эндогенная модифицированных эндотелиальных клеток.

Неоваскуляризация ткани (включая опухолевой ткани) представляет собой сложный процесс, который происходит через ангиогенных vasculogenic механизмов и во время разработки, а также в обоих физиологических и патологических условиях12,15 , 16. сфероида прорастания пробирного характеризуется сложной каскад событий17,18, включая самостоятельной агрегации эндотелиальных клеток, которые внедряются в системе культуры матрица 3D клеток, что приводит к прорастания и воспроизведение 3D сети капилляров19. Эта модель 3D гель встроенный сфероида стала система широко используется в тканевой инженерии для изучения сосудистой формирования и его механизмов из-за его способности предоставлять среде лучше подражая в подходящую матрицу. Однако наиболее важным шагом этого биологического процесса является активация покоя эндотелиальных клеток17,20,21,22. В этой процедуре эндотелиальные клетки были активированы эндогенная сайленсинг гена ВХЛ, регулятор роста ген показаниями23,24. Отличается от классической эндотелия инициации через экзогенных индукции матрицы и соответствующего внеклеточных среды (включая экзогенных сосудистые факторы роста), этот модифицированный метод может быть расширена до многочисленных приложения, чтобы разгадать эндогенная генетических механизмов. Далее чтобы уменьшить влияние экзогенных матрицы, протокол был оптимизирован путем разбавления гель, который был простой шаг в эксперименте. Кроме того он взял только минут для загрузки изображений на платформу и для получения результатов анализа. Платформа предоставляет службу анализа изображений, которая позволяет экспериментатор сделать объективную, анализ сопоставимых и автоматизированных изображения прорастания пробирного изображений в Интернете. Таким образом протокол преодолевает измерения и вычисления ошибки, вызванные антропогенными факторами.

Механистического понимания отдельных шагов неоваскуляризация Каскад рациональной основой для развития анти сосудистой лечения, который утверждается в настоящее время для клинического применения в онкологии. Этот документ создан простой и надежной основе сфероида пробирного модель для изучения формирования судна, что исходит от манипуляций эндотелиальных клеток с потерей функции ВХЛ гена для выявления роман кандидат молекул для неоваскуляризации Каскад, который может быть использован для многочисленных приложений, связанных с ангиогенеза и vasculogenesis. Авторы высказали предположение, что эта модель в пробирке может предоставить дополнительную информацию, чтобы помочь оценить роль ангиогенеза в некоторых солидных опухолей (например, опухоль vasculogenic мимикрия) и изучения потенциальной роли других возможных прогениторных клеток сформировать опухоль показаниями в естественных условиях, особенно у больных с опухолями, которые, как группа, не реагируют на лечение с анти ангиогенных агентов только.

Прорастания пробирного сфероида стал широко используемый метод для изучения ангиогенеза и соответствующих механизмов. Assay имеет важное преимущество, обеспечивая лучше имитировать окружающей среды, чем классический 2D культур. Недавно были разработаны модели 3D Сопредседатель культуры для изучения ангиогенез опухоли, который имитирует неоднородность и сложности по ангиогенез в опухоли микроокружения25. В этой модели эндотелиальные клетки культивированный непосредственно с раковые клетки, а также стромальные компонент в 3D-среде. Кроме того 3D в vitro системах культуры было показано, чтобы более точно отразить в vivo ответ на терапевтических агентов, чем обычные клетки культуры систем. Кроме того этот метод используется для дифференциации эмбриональных стволовых клеток, рост тканей, заживление ран, ишемии и воспаления. По сравнению с классическим методом, наш подход является эффективным и простым в реализации. Мы считаем, что он является полезным инструментом для изучения ангиогенеза в пробирке, и открывает новый способ понять этот процесс лучше.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Эта работа была поддержана от грантов от шанхайского комитета по науке и технике (15411951800, 15410723200). Авторы хотели бы поблагодарить профессора YuMei Вэнь и профессор Chao Чжао патогенного микроорганизма Департамента Фуданьский университет для их технической помощи.

Materials

Name Company Catalog Number Comments
human umbilical vein endothelial cell Fudan IBS Cell Center FDCC-HXN180
dulbecco’s modified eagle’s medium  Gibco 11995040
fetal bovine serum Gibco  26400044
PLKO.1-puro vector Addgene #8453
packing plasmid psPAX2  Addgene #12260
envelope plasmid pMD2.G Addgene #12259
3D round-bottom 96-well plates S-Bio MS-9096M
matrigel BD Biosciences 354234
Opti-MEM medium Gibco 31985-070 reduced serum medium 
15-well plate Ibidi 81501 Air bubbles in the gel can be reduced by equilibrating the μ–Slide angiogenesis before usage inside the incubator overnight
endothelial cell growth supplements Sciencell #1052
10-cm culture dish Corning Scipu000813
Puromycin Gibco A1113802
typsin-EDTA Gibco 25200056
Automated Cell Counter System   BioTech
Image Analysis software  Winmasis http://mywim.wimasis.com 

DOWNLOAD MATERIALS LIST

References

  1. Lonser, R. R., et al. von Hippel-Lindau disease. Lancet. 361, (9374), 2059-2067 (2003).
  2. Hussein, M. R. Central nervous system capillary haemangioblastoma: the pathologist's viewpoint. Int J Exp Pathol. 88, (5), 311-324 (2007).
  3. Ma, D., et al. Hemangioblastomas might derive from neoplastic transformation of neural stem cells/progenitors in the specific niche. Carcinogenesis. 32, (1), 102-109 (2011).
  4. Zhuang, Z., et al. Tumor derived vasculogenesis in von Hippel-Lindau disease-associated tumors. Sci Rep. 4, 4102 (2014).
  5. Glasker, S., et al. VHL-deficient vasculogenesis in hemangioblastoma. Exp Mol Pathol. 96, (2), 162-167 (2014).
  6. Wizigmann-Voos, S., Breier, G., Risau, W., Plate, K. H. Up-regulation of vascular endothelial growth factor and its receptors in von Hippel-Lindau disease-associated and sporadic hemangioblastomas. Cancer Res. 55, (6), 1358-1364 (1995).
  7. Cancilla, P. A., Zimmerman, H. M. The fine structure of a cerebellar hemangioblastoma. J Neuropathol Exp Neurol. 24, (4), 621-628 (1965).
  8. Kawamura, J., Garcia, J. H., Kamijyo, Y. Cerebellar hemangioblastoma: histogenesis of stroma cells. Cancer. 31, (6), 1528-1540 (1973).
  9. Jurco, S., et al. Hemangioblastomas: histogenesis of the stromal cell studied by immunocytochemistry. Hum Pathol. 13, (1), 13-18 (1982).
  10. Ma, D., et al. Identification of tumorigenic cells and implication of their aberrant differentiation in human hemangioblastomas. Cancer Biol Ther. 12, (8), 727-736 (2011).
  11. Ma, D., et al. CD41 and CD45 expression marks the angioformative initiation of neovascularisation in human haemangioblastoma. Tumour Biol. 37, (3), 3765-3774 (2016).
  12. Sharifpanah, F., Sauer, H. Stem Cell Spheroid-Based Sprout Assay in Three-Dimensional Fibrin Scaffold: A Novel In Vitro Model for the Study of Angiogenesis. Methods Mol Biol. 1430, 179-189 (2016).
  13. Cai, H., et al. Long non-coding RNA taurine upregulated 1 enhances tumor-induced angiogenesis through inhibiting microRNA-299 in human glioblastoma. Oncogene. 36, (3), 318-331 (2017).
  14. Xu, J., et al. Construction of Conveniently Screening pLKO.1-TRC Vector Tagged with TurboGFP. Appl Biochem Biotechnol. 181, (2), 699-709 (2017).
  15. Laib, A. M., et al. Spheroid-based human endothelial cell microvessel formation in vivo. Nat Protoc. 4, (8), 1202-1215 (2009).
  16. D'Alessio, A., Moccia, F., Li, J. H., Micera, A., Kyriakides, T. R. Angiogenesis and Vasculogenesis in Health and Disease. Biomed Res Int. 2015, 126582 (2015).
  17. Finkenzeller, G., Graner, S., Kirkpatrick, C. J., Fuchs, S., Stark, G. B. Impaired in vivo vasculogenic potential of endothelial progenitor cells in comparison to human umbilical vein endothelial cells in a spheroid-based implantation model. Cell Prolif. 42, (4), 498-505 (2009).
  18. Morin, K. T., Tranquillo, R. T. In vitro models of angiogenesis and vasculogenesis in fibrin gel. Exp Cell Res. 319, (16), 2409-2417 (2013).
  19. Blacher, S., et al. Cell invasion in the spheroid sprouting assay: a spatial organisation analysis adaptable to cell behaviour. PLoS One. 9, (5), 97019 (2014).
  20. Straume, O., et al. Suppression of heat shock protein 27 induces long-term dormancy in human breast cancer. Proc Natl Acad Sci U S A. 109, (22), 8699-8704 (2012).
  21. Naumov, G. N., Akslen, L. A., Folkman, J. Role of angiogenesis in human tumor dormancy: animal models of the angiogenic switch. Cell Cycle. 5, (16), 1779-1787 (2006).
  22. Naumov, G. N., Folkman, J., Straume, O. Tumor dormancy due to failure of angiogenesis: role of the microenvironment. Clin Exp Metastasis. 26, (1), 51-60 (2009).
  23. Wang, Y., Yang, J., Du, G., Ma, D., Zhou, L. Neuroprotective effects respond to cerebral ischemia without susceptibility to HB-tumorigenesis in VHL heterozygous knockout mice. Mol Carcinog. 56, (10), 2342-2351 (2017).
  24. Stratmann, R., Krieg, M., Haas, R., Plate, K. H. Putative control of angiogenesis in hemangioblastomas by the von Hippel-Lindau tumor suppressor gene. J Neuropathol Exp Neurol. 56, (11), 1242-1252 (1997).
  25. Correa de Sampaio, P., et al. A heterogeneous in vitro three dimensional model of tumour-stroma interactions regulating sprouting angiogenesis. PLoS One. 7, (2), 30753 (2012).
Всеобъемлющей процедуры для оценки производительности <em>в Vitro</em> предполагаемый Гемангиобластома неоваскуляризация, используя сфероида прорастания Assay
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).More

Wang, Y., Chen, D., Chen, M., Ji, K., Ma, D., Zhou, L. A Comprehensive Procedure to Evaluate the In Vitro Performance of the Putative Hemangioblastoma Neovascularization Using the Spheroid Sprouting Assay. J. Vis. Exp. (134), e57183, doi:10.3791/57183 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter