Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

CRISPR/Cas9에 의해 Murine 인간과 조 혈 조상 세포의 고효율 유전자 장애

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

프로토콜에 대 한 빠른 마우스에서 유전자 장애 CRISPR/Cas9-중재 하 고 인간의 기본 조 혈 모 세포가이 문서에서 설명 하는. Cas9-sgRNA ribonucleoproteins sgRNAs 녹음 방송 생체 외에서 그리고 상업적인 Cas9를 통해 생성 된 electroporation 통해 소개 된다. 높은 편집 효율성 제한 시간 및 금융 비용으로 달성 된다.

Abstract

조 혈 줄기 세포 (HSCs) 분야에서 진보는 동물 모델 뿐 아니라 주 조상 세포를 유전자 방법으로 주 었 되었습니다. HSCs에서 완전 한 유전자 제거 녹아웃 쥐에서 HSCs 고립 된, 수 및 기본 인간의 HSCs에서 유전자 제거 불가능 했다 생성이 필요 합니다. 바이러스 성 변환 노크 다운 방법, 사용 될 수 있지만 이러한 변수 효능에서 고통. 인간의 일반적인, 유전자 조작 및 마우스 조 혈 모 세포에서 낮은 효율 및 광범위 한 시간 및 비용 투입에 의해 방해 되었다. 최근, CRISPR/Cas9 포유류 세포의 DNA를 능력을 극적으로 확장 했다. 그러나, 조 혈 모 세포에 CRISPR/Cas9의 응용 프로그램은 도전, 그들의 낮은 transfection 효율 때문에 주로 플라스 미드-기반 접근의 독성과 바이러스 기반 프로토콜의 느린 처리 시간.

CRISPR/Cas9-중재 유전자 murine 인간과 조 혈 줄기와 뿌리에서 최대 90%의 녹아웃 효율성과 셀 편집을 수행 하는 빠른 방법은이 문서에서 제공 됩니다. 이 이렇게는 간소화 된 3 일 워크플로 ribonucleoprotein (RNP) 배달 전략을 이용 한다. Cas9-sgRNA RNP 사용 히트 한 접근 방식, 편집 된 세포의 게놈에 없는 외 인 DNA 시퀀스를 소개 하 고 대상에서 효과 감소 수 있습니다. RNP-기반 방법은 빠르고 간단: sgRNAs, 바이러스 준비 또는 특정 sgRNA 화학 수정의 복제는 필요 하지 않습니다. 이 프로토콜 과학자 성공적으로 oligonucleotide 종합을 위한 가동을 포함 하 여 1 주일 이내 주 조 혈 모 세포의 유전자의 녹아웃을 생성할 수 있어야 합니다. 이 방법은 훨씬 광범위 한 사용자 그룹에 맞게 그들의 필요를 위해이 프로토콜을 허용할 것 이다.

Introduction

CRISPR/Cas9의 출현은 근본적으로 포유류 세포에서 유전자 편집을 단순화. 초기 CRISPR/Cas9 프로토콜 활용 플라스 미드 또는 Cas9 단백질 및 sgRNA,12,3의 바이러스 기반 배달. 이러한 방법을 세포 및 동물 모델의 개발을 위한 혁신적인 입증 하 고 또한 성공적으로 기본 조 혈 줄기와 조상 세포 (HSPCs)4,5에 적용 된. 그러나, 이러한 방법은 다양 한 단점이 있다. 첫째, 유전자 장애 효율 504,5종종 남아 있다. 셀 라인에 녹아웃 (KO) 클론을 생성 하기 위한 충분 한 동안, 단기 문화에 대 한 필요성은 HSPCs 같은 전략에 의무가 없습니다. 둘째, 복제에 대 한 요구 사항은 단일 실험에서 시험 될 수 있다 고 생성 구문을 transfect 하기 어려운, 큰 sgRNAs의 양을 제한 합니다. 셋째, 이러한 접근 강제 처리 시간을 느리게 하는 과학자.

이러한 한계를 극복, 우리의 그룹 개발 하 고 최근 HSPCs Cas9 sgRNA ribonucleoproteins (RNPs)를 사용 하 여 다른 CRISPR/Cas9 접근 출판-배달6을 기반으로. 이 전략에서 CRISPR의 원시 구성 요소 (Cas9 단백질 및 생체 외에서 복사할 sgRNA) 사전 complexed와 electroporation (그림 1)를 통해 대상 세포에 직접 전달. Cas9-sgRNA RNP 복잡의 반감기는 시간 보다 짧은 그 플라스 미드 또는 바이러스 성 핵 산 베 꼈 다, 오프 대상 속도 초기 접근7에 비해 낮은. 또한, RNP 접근 세포 변환에 지도 대상 세포 게놈으로 통합 임의로 수 외 인 DNA의 모든 소스를 제거의 혜택을 추가 합니다.

이 프로토콜 기반으로 RNP 기반 유전자 장애 실험에 대 한 간소화 된 워크플로우도 그림 1에 표시 합니다. 첫 번째 단계는 설계 하 고 각 sgRNA에 대 한 프라이 머를 주문. 이 프라이 머는 sgRNAs를 생체 외에서 전송 (IVT)에 사용 되는 sgRNA DNA 서식 파일을 만들기 위해 활용 됩니다. 순화 sgRNAs 다음 양식 Cas9 sgRNA RNP 복합물에 이전에 구입한 Cas9 단백질, 알을 품는. 마지막으로, 사전 complexed Cas9 sgRNA RNPs electroporated 세포로는. Electroporation, 다음 편집 효율 시험 될 수 있다 생체 외에서하 고 /vivo에서 실험, 필요에 따라 시작할 수 있습니다. 이 혁신적인 실험 방법의 자세한 내용은 아래 찾을 수 있습니다.

Protocol

프로토콜 베일 러 의과대학 인간 윤리 위원회의 지침을 따릅니다. 마우스에 수행 하는 모든 실험 절차는 베일 러 대학의 약 기관 동물 관리 및 사용 위원회에 의해 승인 됩니다.

1입니다. sgRNA Fwd 디자인

  1. Http://www.crisprscan.org/?page=track8 sgRNAs 관심의 설계를 시작으로 이동 합니다.
  2. "마우스" 또는 "인간" 버튼의 셀 유형에 따라 클릭 하십시오.
  3. 관심사의 유전자 UCSC 검색 상자에 입력 하 고 이동을 누릅니다.
  4. 확대 하 고 유전자의 영역으로 이동 (. 특정 exon) 그 대상에 대 한 관심의 이다.
    참고: 효율적인 유전자 장애 특정 셀 형식에서 모든 베낀된 isoforms에 초기 exon(s)를 대상으로 하는 것이 좋습니다 달성 하십시오.
  5. 잠재적인 sgRNA 대상 시퀀스는 "CRISPRscan에 대 한 예측 유전자 (CD)" 아래에 나열 된 확인 하십시오 제목.
  6. 상대적으로 높은 점수를 가진 대상 시퀀스에 클릭 및 목표 (밝은 녹색으로 강조 표시)에서 몇 가지. "올리고 시퀀스" 섹션 아래에 표시 된 전체 시퀀스를 복사 하 고 텍스트 문서에 붙여 넣습니다. 3'는 시퀀스의 끝에 "ATAGC"를 추가 합니다. 완료 되 면, 전체 길이 시퀀스에 대 한 순서를 놓습니다.
    참고: 각 대상 시퀀스에 대 한 CRISPRscan8 T7 발기인, protospacer (대상) 시퀀스와 유니버설 발판 중첩 시퀀스를 포함 하는 "통합된" 앞으로 sgRNA 뇌관을 제공 합니다 ( 그림 1A참조). 전체 길이 순서 protospacer의 길이 따라 56 또는 57 뉴클레오티드의 이루어집니다.

2. sgRNA DNA 템플릿 합성

  1. 녹이 고 희석 sgRNA Fwd 및 범용 계 뇌관 (완전 한 순서는 표 1 참조). 10 µ M 최종 농도 얻기 위해서는 100 µ m, 프라이 머 희석 후 1시 10분 하는 방법에 제조업체 지시에 따라 nuclease 무료 물과 함께 희석.
  2. PCR을 중복 수행 하려면 PCR 스트립 튜브에 다음 ( 그림 1B참조), 믹스: 2 µ L 앞으로 sgRNA 뇌관 (10 µ M), 2 µ L 범용 계 비 계 뇌관 (HPLC 정화) (10 µ M), 10 µ L 고 충실도 DNA 중 합 효소 마스터 믹스 (2 배)와 6 µ L nuclease 무료 물.
  3. 다음 프로그램으로 PCR을 실행: 3 분, 5 98 ° C 95 ° C의 5에 대 한 60 ° C s, 72 ° C 10 s, 6 주기, 1 분, 4 ° C 영원히 72 ° C 2로 이동.
  4. DNA 정화 열 (테이블의 자료 참조)를 사용 하 여 PCR 제품을 정화. 다음 제조 지침 및 차입 버퍼의 11.5 µ L을 elute.
  5. 분 광 광도 계에 PCR 제품의 농도 측정 합니다. 차입 버퍼와 악기를 빈.
    참고: DNA 농도 50 ~와 ~ 120 ng / µ L 사이 이어야 한다.

3. sgRNA의 녹음 방송 생체 외에서

  1. PCR 스트립 튜브 (시 약은 RNA 합성 키트에 제공 됩니다)에서 다음과 같은 구성 요소를 혼합: eluted DNA, dNTPs의 4 µ L, 반응 버퍼, x 10의 1 µ L의 T7 RNA 중 합 효소 효소 혼합의 1 µ L 4 µ L.
  2. 적어도 4 h 37 ° C에서 샘플을 품 어.
  3. RNase 청소 에이전트 RNase gloved 손에서 제거를 적용 합니다.
  4. Nuclease 무료 물으로 50 µ L의 총 볼륨까지 각각의 RNA 샘플을가지고 (제조업체 지침에 따라 RNA 정화의 첫 번째 단계).
  5. 제조업체 지침에 따라 RNA 정화를 계속 수행 하십시오 하 고 키트 제공 nuclease 무료 물 50 µ L에 elute.
  6. 분 광 광도 계에 eluted sgRNA의 농도 측정 합니다. 빈 물 nuclease 무료 악기.
    참고: 정화 후 예상된 수익률 RNA (즉 1.0-1.5 µ g / µ L의 농도)의 50-80 µ g 이다.
  7. 순화 sgRNA를 사용 하 여 즉시 또는 장기에 대 한 2-4 µ L-80 ° C에서의 aliquots에 저장.

4. HSPC 격리와 문화

  1. Murine HSPCs 격리와 문화
    참고: 남성과 여성의 Ubc GFP 마우스 (JAX004353)와 Rosa26-LSL-tdTomato (JAX007914) 2-6 개월에 Vav iCre (JAX008610)로 넘어 아래 결과 얻기 위해 사용 되었다.
    1. 자 궁 경부 전위를 통해 마 취 쥐 안락사
      참고: 2 훈련된 인 독립적으로 확인 해야 하지 성공적인 안락사 호흡의 부족을 지적 하 여 고 5 분 이상에 대 한 하트 비트 동물에서 피부를 제거 합니다.
    2. Tibias, 화관, 및 쥐의 장 골 볏을 dissect 하 고 모든 근육과 결합 조직 해 부 뼈 주위를 제거. HBSS 2% 보완으로 얼음에 조직 문화 접시에 그대로 뼈를 배치 FBS (HBSS +). 이동 층 류 두건 곧 알 뼈 청소 하 고 조직 문화 접시에 전송 되었습니다.
    3. 전송 청소 뼈 살 균 박격포, 포함 2 mL에 얼음 처럼 차가운 HBSS + 3 뼈 당. 방 앗 공이 사용 하 여, 방출 내에서 골 수 뼈 조각으로 뼈 분쇄. Pestling 뼈는 유 봉 아래 크래킹 중지 될 때까지 계속 합니다.
    4. 40 µ m 셀 스 트레이너를 사용 하 여 50 mL 원뿔 튜브에 박격포와 필터에서 상쾌한을 수집 합니다. 5 mL와 나머지 뼈 조각 씻어 얼음 HBSS +와 같은 40 µ m 스 트레이너를 사용 하 여 동일한 50 mL 원뿔 튜브에 필터.
    5. 얼음 처럼 차가운 HBSS + 튜브 토 핑 하 고 7 분 삭제는 상쾌한에 대 한 400 x g에서 centrifuging에 의해 두 번 셀을 씻어.
    6. 두 번째 세척에 따라 얼음 차가운 PBS의 20 mL에 셀 펠 릿을 resuspend. Trypan 블루 제외9수 가능한 셀.
    7. 1 mL 당 1 x 108 실행 가능한 세포를 품 어 차가운 HBSS + 얼음에 45 분 1: 100 희석에 c 키트 항 체 biotin 활용.
    8. 7 분 x 400g에 centrifuging와 삭제는 상쾌한 차가운 HBSS + 세포를 씻어.
    9. 안티 비오 틴 자석 구슬 제조업체 지침에 따라 셀을 품 어.
    10. C-키트 긍정적인 세포 자기 열 또는 자기 활성화 셀 종류로 제조 업체의 지침을 사용 하 여 격리 합니다. 15 mL 원뿔 튜브에 c 키트 긍정적인 세포를 수집 합니다.
    11. 15 mL 원뿔 튜브 토 핑에 의해 PBS로 두 번 셀을 세척 하 고 7 분에 대 한 400 x g에서 centrifuging 삭제는 상쾌한. 2 세척 사이 trypan 블루 제외9실행 가능한 세포의 총 수를 계산 합니다.
    12. Resuspend c-키트 + 2 %FBS, 50 ng/mL 마우스 줄기 세포 요소 (SCF), 50 ng/mL 마우스 thrombopoietin (TPO), 10 ng/mL 마우스와 일리노이-3, 일리노이-6 10 ng/mL 마우스 보충 murine HSPCs에 대 한 문화 매체의 100 µ L 당 최대 106 viablecells의 농도에 세포.
    13. 37 ° c, 5% CO2 는 electroporation 이전 24 시간 최대 1 시간 이상 세포를 품 어.
  2. 인간 HSPCs 격리와 문화
    참고: 층 류 두건에이 단계를 수행 해야 합니다.
    1. 40 µ m 셀 스 트레이너를 통해 골/탯 줄 혈액 세포를 필터링 합니다.
    2. 1 mM EDTA (PBS/EDTA) 보충 하는 PBS로 1:2 필터링 된 골/탯 줄 혈액 세포를 희석.
    3. 밀도 그라데이션 매체의 15 mL 50 mL 원뿔 튜브로 분배. 부드럽게 밀도 그라데이션 중간 표면에 희석된 골/코드 혈액의 30 mL를 붓는 다. 세포 현 탁 액의 볼륨 30 mL 보다 크면 여러 튜브를 준비.
      참고: 피와 밀도 그라데이션 매체 간의 인터페이스를 최대한 날카로운 유지 있는지 확인 합니다.
    4. 750 x g 30 분 동안 아무 감속에 튜브를 회전 합니다.
    5. 깨끗 한 50 mL 원뿔 튜브에 매체의 인터페이스와 전송에서 감지 되 셀 레이어를 수집 합니다. PBS/EDTA와 튜브를 회전 280 g 15 분 삭제에 대 한에 셀은 상쾌한 수 있습니다.
    6. 7 분 x 400g에 PBS/EDTA 회전 및 삭제는 상쾌한에 두 번 셀을 씻어.
    7. 제조업체 지침에 따라 안티 CD34 자석 구슬을 가진 단 세포를 품 어.
    8. CD34 + 세포 자기 열 또는 자기 활성화 셀 종류로 제조 업체의 지침을 사용 하 여 격리 합니다. 15 mL 원뿔 튜브에서 CD34 + 세포를 수집 합니다.
    9. 워시는 PBS와 튜브 토 핑 7 분에 대 한 400 x g에서 회전 하 고는 상쾌한 삭제 하 여 두 번 CD34 + 세포를 수집. 2 세척 사이 trypan 블루 제외9실행 가능한 세포의 총 수를 계산 합니다.
    10. 100 ng/mL으로 보충 하는 문화 매체에 셀 resuspend 인간의 SCF, 100 ng/mL 인간의 FLT3 ligand (FLT3L), 100 ng/mL ~2.5 x 105 가능한 세포의 농도에 인간 TPO / ml. 문화 37 ° C, 5 %CO2 최대 48 h 이전 24 h에서 CD34 + 세포 격리 electroporation 하.
      참고: Electroporation 이전 cytometry 여 농축된 CD34 + 인구의 순도 확인 합니다.

5입니다. Electroporation

참고: 다음 프로토콜 10 µ L electroporation 팁 최적화 되어 있습니다. 모든 단계는 층 류 후드에서 수행 되어야 합니다.

  1. Trypan 블루 제외9셀을 계산. 복제 (예: 수집 6 x 105 셀 3 electroporations) 당 2 × 105 가능한 세포를 수집 합니다.
  2. 300 x g 7 분 하 고 신중 하 게 회전 하는 PBS로 두번 세척 세포 제거는 상쾌한.
  3. 병렬로, PCR 튜브 Cas9 유일한 제어를 제외 하 고 각 복제에 대 한 총 sgRNA의 RT 1.5 µ g Cas9 1 µ g에 20-30 분에 배양 하 여 Cas9 sgRNA RNP 단지를 준비 합니다.
    참고: Cas9 단백질은 10 µ µ g/l 농도에서 제공 됩니다. 정확한 pipetting 되도록 희석 1시 10분 nuclease 무료 물으로 필요한 Cas9 단백질의 총 금액 (예 10 electroporations에 대 한 Cas9 단백질의 1 µ l 고 nuclease 무료 물 9 µ l로 희석 고 복제 당 희석된 Cas9의 1 µ l를 품 어. sgRNA의 농도 따라 복제 당 1.7와 2 µ l 사이 Cas9와 sgRNA의 총 볼륨을 구성 한다. 경우 2를 사용 하 여 sgRNAs 품 어 500 복제; 당 각 sgRNA의 ng 3 사용 하는 경우 sgRNAs 330을 품 어 복제, 당 각 sgRNA의 ng.
  4. 버퍼 T 10 µ L의 총 수를 곱하여 필요한 복제 물의 resuspension의 총 볼륨 (예: 30 µ L 3 복제에 대 한) 필요한 계산 합니다. 버퍼 T. 확인 셀 서 스 펜 션의 최종 농도 2 x 107 셀/mL의 계산 볼륨 수송과 셀 resuspend
  5. 포함 하는 사전 complexed sgRNA/Cas9 RNP (예: 사전 complexed Cas9-sgRNA를 포함 하는 PCR 튜브에 세포 현 탁 액의 3 중 aliquot 30 μ) 각 PCR 튜브에 resuspended 셀/복제의 aliquot 10 µ L.
  6. 설정 하려면 electroporation 시스템 악기 고 electroporation 베트에 버퍼 E의 3 개 mL를 추가 켜고 베트 홀더는 베트 밀어넣습니다.
  7. 장치에서 원하는 electroporation 조건 설정: 인간 HSPCs (1600 V, 10 ms, 3 펄스) 또는 마우스 HSPCs (1700 V, 20 ms 1 펄스).
    참고: 경우 원하는 CD34 + HSPCs에 실험을 수행 하기 전에 sgRNA 효율 시험 될 수 있다 선에 급성 골수성 백혈병 (AML) 셀 (예: HL60) electroporation 다음과 같은 전략 (AML 셀 라인에 대 한 중간 항생제 무료 사용)를 사용 하 여: 버퍼 R, V, 35 ms, 1 펄스 1350입니다.
  8. electroporation 특별 한 electroporation 피 펫, electroporation 피 펫 팁에 래치는 클로 수행 됩니다. Electroporation 피 펫을 잡고, 발톱을 연장, 피 펫 팁, 내부 디스크를 잡아 누르고 단단히 보안 아래로 피 펫 팁.
  9. 혼합 10 번 위아래로 샘플 플라스틱 거기 있는지 아무 거품 만들기 10 µ L를 꺼내와 피 펫 팁 electroporation 베트에 전해 버퍼에 직접 삽입. 베트의 벽을 터치 하지 마세요. 화면에서 "시작"을 누릅니다. "완료" 메시지가 나타나면, 피 펫, 제거 하 고 내용을 새로운 HSPC 문화 매체와 분배.
  10. 모든 샘플에 대 한 반복 합니다. 필요한 경우에 변경 피펫은 샘플 사이의 팁.

Representative Results

이 프로토콜의 목표 유전자 녹아웃 (KO) 마우스 및 인간의 HSPCs Cas9-sgRNA RNPs를 사용 하 여 수행 하는 것입니다. 워크플로 쉽고 빠르게 이며 고 효율성의 평가 실험 설계에서 보다는 더 적은 주에 실험의 완료에 대 한 수 있습니다.

플라스 미드 또는 바이러스-기반 접근법에 비해, 우리의 프로토콜의 성공 sgRNA RNPs의 조합 및 electroporation에 작성 합니다. 이 복제-무료 전략에는 크게 transfect에 구성 요소를 얻는 데 필요한 시간이 줄어듭니다. 또한, electroporation transfection 셀의 최대 95%의 수 RNPs sgRNAs의 납품을 극대화 수 있습니다. 전송 (IVT), 체 외에서 통해 실험실에서 synthetized 정화 Cas9 단백질 여러 회사 (에서 구입하실 수 있습니다. 프로토콜 참조). IVT sgRNA DNA 템플릿을 가져온 sgRNA Fwd 뇌관 (그림 1A, B)를 사용 하 여 짧은 PCR을 수행 하 고 보편적인 발판 계 뇌관 (그림 1B -프로토콜 참조). PCR 제품은 IVT (그림 1C)에 대 한 템플릿으로 사용 됩니다. Cas9-sgRNA RNP 단지 15-30 분 동안 잠복기는 sgRNAs와 Cas9는 생성 됩니다 (그림 1C). 마지막으로, sgRNA RNPs는 세포로 electroporated. 편집된 HSPCs 다음 생체 외에서 그리고 vivo에서 실험을 수행 하기 위해 사용할 수 있습니다.

마우스 세포에서 유전자 장애

Cas9-sgRNA RNP electroporation 전략, c의 효능을 입증-키트 + HSPCs 편 GFP 또는 tdTomato을 표현 하는 쥐에서 분리 되어 GFP 또는 tdTomato에 대 한 sgRNA와 electroporated. 3 sgRNA GFP에 대 한 설계, 중 GFP sg1 수행 가장 효율적으로 전시 GFP 식 cytometry (그림 2A, B)에 의해 결정으로의 약 70-75% 중단. 게놈 수준에서 유전자 장애 주파수 척도, electroporated 세포에서 게놈 DNA 고립 되었고 T7 endonuclease 나 기반 (T7EI) 분석 결과 수행 되었다. 그림 2C같이 T7EI 분석 결과 60 %indel 형성을 발견 했습니다. 참고 T7EI 분석 실험 indels의 주파수를 과소 평가 하는 경향이 있다. 우리는 또한 tdTomato 및 electroporated HSPCs tdTomato Rosa26 소재 시에서 표현에 대 한 sgRNA 생성. 그림 2D같이 tdTomato s g 1은 효율적으로 tdTomato의 식 ablated.

인간 세포에서 유전자 장애

여기, CD45, 조 혈 모 세포에 세포 표면 마커를 대상으로 한 sgRNA 방식으로 획득 하는 효율적인 중단 표시 됩니다. CD45의 다른 exons를 대상으로 하는 3 개의 sgRNAs (CD45 sg1, sg2, 디자인과 sg3) 했다. sgRNAs의 효율성은 급성 골수성 백혈병 HL60 세포 선 (그림 3A)에 시험 되었다. 단백질 코 electroporation 후 5 일 cytometry에 의해 평가 되었다. CD45 sg1 가장 효율적인 (98% 고 효율성- 그림 3A) 고 추가 실험을 위해 사용 되었다. 그림 3B 보여줍니다 CD45 코 기본 인간 CD34 + 조상 세포 CD45 sg1, cytometry electroporation 후 5 일 평가 사용 하 여. CD34 식 영향을 받는 동안, CD45 식 세포의 약 80%에서 분실 되었다. 200.000 편집된 기본 CD34 + 세포 했다 복고 orbitally 이식 NSG 쥐로 electroporation 후 6 시간. 골 수 및 비장 세포 이식 후 3 개월을 수확된 했다. 편집된 셀 (HLA-ABC 긍정적인, CD45 부정, 빨간색으로 강조 표시)만 취급 하는 sgRNA 샘플에 Cas9만 컨트롤 (그림 3C) 안에 감지 않습니다.

원하는 경우 두 sgRNAs 대상 시퀀스 근처 생성 삭제를 사용할 수 있습니다. 이 이렇게는 PCR와 편집 효율성의 빠른 견적에 대 한 허용 하 고 자주 중단 효율 높은 생산. 그림 3D DNMT3A의 exon 10 58 bp 삭제의 효율적인 생성을 보여줍니다. 200.000 편집된 CD34 + 세포 electroporation 후 6 시간 NSG 쥐에 이식 했다. 58 bp 삭제 명확 하 게 발견 되었다 engrafted NSG 쥐의 말 초 혈액에서 CD34 + 세포 장기 engraftment 기능 편집 확인 주사 (그림 3E) 후 5 개월.

Figure 1
그림 1: sgRNA RNPs를 생성 하는 빠르고 쉬운 접근. A) sgRNA Fwd 뇌관의 표현. SgRNA Fwd 뇌관 DNA oligonucleotide T7 발기인, protospacer 시퀀스 및 sgRNA 비 계는 중첩 시퀀스를 포함 하는. 에 3' 끝, 빨간색으로 강조 표시는 CRISPRscan에 sgRNA Fwd 뇌관 시퀀스에 추가 하는 "ATAGC" 시퀀스. B) PCR IVT 서식 파일을 얻기 위해 수행 오버랩의 도식 대표. SgRNA Fwd 뇌관 및 유니버설 비 계 계 뇌관의 겹치는 확장 및 PCR에 의해 증폭 수 있습니다. C) IVT 반응 및 sgRNA RNP 사전 complexing 설명 하는 만화. PCR 제품 정화 하 고는 IVT에 대 한 템플릿으로 사용. IVT (프로토콜 참조) 여러 복제에 사용할 수 있는 sgRNAs의 높은 금액을 생성 합니다. sgRNA RNPs는 IVT를 이전에 구입한 Cas9 단백질 정화 sgRNA 잠복기 생성 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 마우스 조 혈 조상 세포에서 효율적인 유전자 장애. A) Cas9 단백질 함께 GFP (GFP sg1)를 대상으로 하는 sgRNA는 murine c로 electroporated-키트 + HSPCs GFP, 표현 및 분석 cytometry electroporation 후 24 시간. B) GFP s g 1의 다른 금액은 Cas9 단백질 및 electroporated의 1 µ g에 complexed. 작은 200 ng GFP s g 1의 효율적으로 녹지 GFP 식. C) T7EI 분석 결과 A b에서 사용 하는 셀에서 절연 하는 genomic DNA에서 수행 1: 4에서 1 희석 PCR amplicon 스패닝 Cas9 sgRNA 분열 사이트 버퍼 2 고 열 cycler에서 천천히 교배 x. 교배 시킨된 조각 다음 1.25 U의 T7 endonuclease와 소화 했다 37 ° c.에서 10 분 동안 내가 소화 조각 polyacrylamide 젤 전기 이동 법으로 분리 되었다. 밴드 농도 각 레인의 밴드 농도 그려서 ImageJ 소프트웨어를 사용 하 여 분석 되었다. % 분열 uncleaved 밴드에 쪼개진된 밴드의 농도의 비율에 의해 계산 되었다. D) c-키트 + HSPCs tdTomato을 표현 하는 쥐에서 분리 했다 Cas9 단백질에 complexed tdTomato에 대 한 sgRNA와 electroporated. Cytometry 수행 electroporation 공개 셀의 약 74 %tdTomato 삭제 후 24 시간. R26 = Rosa26. * p < 0.05, * * p < 0.01, * * * p < 0.001. 이 그림에서 Gundry 적응 되었습니다. 6 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: 인간 조 혈 모 세포에서 효율적인 유전자 장애. A) 3 sgRNAs CD45 타겟팅 (CD45 sg1, sg2, sg3) 설계 하 고 급성 골수성 백혈병 HL60 세포 라인에서 테스트 (electroporation 조건에 대 한 프로토콜 참조). Cytometry는 electroporation 후 5 일을 수행 했다. CD45 sg1 3 sgRNAs (코 효율 98%) 중 가장 효율적인 선정 됐다. B) 혈액 CD34 + HSPCs CD45 s g 1을 사용 하 여 코드 CD45 기본 인간의 코. CD45 손실 세포의 약 80%에서 감지할 수 있습니다. 참고 CD34 식은 편집한 후 변경 되지 않습니다. C) 편집한 인간의 HSPCs를 효율적으로 NSG 쥐로 engrafted 될 수 있습니다. 인간의 nucleated 세포 표시 정상적인 HLA + CD45 + 표현 형이 Cas9 전용 engrafted 쥐, 쥐 CD45-s g 1과 engrafted CD34 + 세포, 두 HLA 취급 하는 반면 + CD45 + 및 HLA + CD45 인구 인간의 CD45 코 셀의 engraftment를 나타내는 관찰 된다. D) 2 %agarose 젤 2 sgRNAs (이중 가이드 방식) 3 다른 탯 줄 혈액 (CB1, CB2, CB3)에서 인간 HSPCs에 DNMT3A 의 exon 10에에서 의해 생성 된 58 bp 삭제를 보여주는. PCR는 electroporation 후 3 일을 수행 했다. E) 2 %agarose 젤 NSG 쥐로 이식 후 5 개월 58 bp 삭제의 지 속성을 보여주는. 이 그림에서 Gundry 적응 되었습니다. 6 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Oligonucleotide 시퀀스 참고
유니버설 계 비 뇌관 gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct 위한 범용 역 뇌관 겹치는 PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서
hDNMT3A Ex10 s g 1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서
GFP s g 1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서
tdTomato s g 1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd 오버랩 PCR 뇌관 순서

표 1: 실험 및 유니버설 계 뇌관에서 사용 하는 sgRNA Fwd 뇌관의 시퀀스 완료.

Discussion

이 상세한 프로토콜에서 설명 RNP 접근 효율적인 유전자 녹아웃을 마우스 및 인간의 기본 조 혈 모 세포 또한 현 탁 액 셀 라인에서 수 있습니다. 매우 높은 코 효율성 자주 얻을 수 있습니다, 하지만 몇 가지 중요 한 변수 고려 될 필요가 있다. 첫째, 적절 한 exon 선택 효율적인 indel 법인 유전자 녹아웃을 해당 보장의 핵심 이다. Exon 선택에 관련 된 두 가지 중요 한 요소는 성적표 내 isoforms 및 exon 위치에 걸쳐 보존 있습니다. Isoform 식 패턴 세포 유형 변수는, 종류를 표적으로 한다 exons 사이 변형 되지 않은 셀 셀에 걸쳐 진 코를 바란다면 그래서. Isoform 패턴 q PCR 또는 RNA 시퀀싱 데이터를 사용 하 여 확인할 수 있습니다. Exon 성적표 내 위치, 터미널에서 frameshift 돌연변이로 초기 exons를 대상 하는 것이 좋습니다 또는 penultimate exon 난센스 중재 붕괴10, 소설 또는 알 수 없는 기능 보다는 진정한 null 단백질 생산을 탈출 수 있습니다.

결정은 indel 주파수 코 효율성을 예측 하 고 실험의 생물 학적 결과 제대로 해석 하는 중요 한 단계입니다. Endonucleases 분석 (예: 측량 분석 결과) 상대적으로 쉽고 빠르게 수행 되 고의 이점이 있다. 그러나, 그들은 중요 한 배경 신호 때문에 정확 하지 않을 수 경향이 및 결과 재현 하기 어려운 경우가 많습니다. 또한, 그들은 indels 생성 (예: 삽입 및 삭제의 길이) 실험에서의 품질 정보를 제공 하지 않습니다. 생어 시퀀싱 endonuclease 분석에 유용한 대안을 제공 합니다. 조 수11 (https://tide.nki.nl/) 같은 플랫폼 도움이 생어 흔적을 분해 하 고 또한 개별 indels의 주파수를 제공 하면서 유전자 장애 효율의 정확한 견적을 생성. 주요 단점은 높은-품질 생어 시퀀싱 추적에 절대 의존입니다. 높은 처리량 amplicon 시퀀싱 이러한 문제의 대부분을 극복 했다. Amplicon 라이브러리는 매우 낮은 DNA 입력 시작 준비 될 수 있다 그리고 높은 범위 신뢰할 수 있는 결과 보장 합니다. Amplicon 시퀀싱 비용을 줄이기 위해, 우리가 일반적으로 스파이크 amplicon 라이브러리에 큰 시퀀싱 실행 (예: RNA 시퀀싱)의 전체 읽기 1-1.5%만을 사용 하 여에. 마지막으로, 확인 하 고 성공적인 녹아웃, 우리 강하게 서쪽 오 점 하 여 단백질 수준을 평가 하는 것이 좋습니다 또는 flow cytometry, 가능 하면.

앞에서 설명한 대로 여기에 제시 된 방법을 빠르고 간단 이며 유전자 쥐와 인간 HSPCs에 노크를 공부 하는 새로운 도구를 나타냅니다. 우리의 프로토콜 유전자 녹아웃 electroporation 팁 기반 시스템에 대 한 지침을 제공 한다, 다른 시스템 매우 효과적인12,13하 설명 되 있다.

두 가지 주요 제한 RNP 접근에 대해 인정을 해야 합니다. 첫째, 우리의 그룹에 의해 설명 된 대로 시험관으로 HSPCs electroporated의 sgRNAs를 복사할 손상 될 수 있습니다 크게 electroporation에 의해 조건에 최적의6하는 경우에 특히. 필요한 경우, 상업적으로 합성된 sgRNAs (즉 제거 생체 외에서 전사)이이 문제를 극복할 수 있습니다. 이러한 시간 덜 비싼 되고있다 고 여러 공급 업체에서 구입할 수 있습니다. 이 시나리오에서 녹음 방송 생체 외에서 효능, 화면에 sgRNA의 풀을 생성 하는 데 사용할 수 하 고 가장 효율적인 sgRNA(s) 합성에 대 한 선택할 수 있습니다. RNP 접근의 두 번째 주요 한계는 바이러스-기반 접근에서 성공적으로 transfected 세포를 추적 하는 무 능력. 그러나, 높은 고 효율과 빠른 편집 Cas9 sgRNA RNPs와 함께 얻은 많은 실험 시나리오에서 이러한 단점을 보다 큽니다 수 있습니다. 높은 처리량 amplicon 시퀀싱을 사용 하 여 정확 하 게 각 실험에서 중단 효율성을 결정 하는 것이 좋습니다. 관심사의 유전자의 녹아웃 증식 형 (즉 감소 하거나 확산 야생-타입 셀에 비해 증가)을 부여 하는 것으로 예상 된다, 만약 여러 시간 점에서 indel 빈도 결정 수 있도록 평가 여부 코 셀 농축 (즉 indel 빈도 증가 시간이 지남에) 수술 또는 outcompeted는 (. indel 주파수는 시간이 지나면서 감소).

유전자 기능의 손실의 생물 학적 효과 이해 하는 vivo에서 또는 생체 외에서 실험을 수행 하려면 적절 한 컨트롤을 필요 합니다. 앞서 언급 했 듯이, 생체 외에서 복사할 sgRNAs 세포에 독성이 있을 수 있습니다, 특히 주 조상 세포6. 또한, Cas9 단백질에 의해 발생 하는 DNA 이중 가닥 나누기 유전자 독립적인 안티 증식 응답14를 발생할 수 있습니다. 따라서, 우리 자주 CRISPR 실험에서 다양 한 제어 sgRNAs 사용 하 고 세포 유형으로 표현 되는 두 번째 대상 유전자에 세포 표면 마커는 것이 좋습니다.

Cytokines의 존재 인간 HSPCs의 단기 문화 유전자 장애 효율성6 증가 하 고 코 높은 효율을 달성 하는 데 필요한. 우리 문화의 electroporation6전에 이상적인 기간이 될 36-48 시간을 발견 했다. Electroporation, 다음 셀이 될 수 있습니다 더 교양 마음에 유지는 더 이상 문화 multilineage engraftment 용량 손실의 위험이 높은. 따라서, 우리가 일반적으로 수행 이식 6 후 시간 electroporation 결코 electroporation 후 24 시간 이후에.

CRISPR/Cas9는 극적으로 과학자의 편집 기능을 성공적으로 포유류 세포의 게놈을 향상 했다. 주 조 혈 조상 세포에서 유전자 장애를 더 실현 가능한 만들기 신속 하 게 HSPCs 및 혈액 질환 분야에서 과학적 지식을 강화 전망 이다. 중요 한 것은, 여기에 설명 된 프로토콜은 또한 동시에 높은 효율, 복잡 한 유전 풍경, leukemic 질병에서 자주 볼 수의 모델링에 대 한 수 있도록 여러 개의 녹아웃을 생성할 수 있습니다.

여기에 설명 된 프로토콜 유전자 장애에 초점을 맞추고 있다, 하지만 그들은 쉽게 유전자 노크에서 실험에 대 한 적응 수 있습니다. 이 수행할 수 있습니다 단일 가닥 oligonucleotide 템플릿 homology 감독 수리6,13 (HDR)의 공동 배달을 통해 또는 셀 게시물 electroporation 변환 AAV6 벡터를 포함 하는 homology 템플릿12. 복구 또는 HSPCs에 있는 특정 돌연변이 소개 하는 기능 유전자 치료와 암 드라이버 돌연변이 AML 및 기타 혈액 질환에서의 확장 된 연구에 대 한 새로운 치료 전략을 촉진 한다. 동안에 인간 HSPCs HDR 성공적인6,,1213, 마우스 HSPCs이 전략6을 사용 하 여 편집 하기 어려운 되었습니다. 인간의에 고 마우스 HSPCs에 특히 HDR 프로토콜의 최적화에는 보다 구체적인 편집 및 생 태그를 사용 하 여 편집 된 셀을 추적 하는 도구 개발 수 있게 된다.

마지막으로, 그것 또한 돌연변이 이득의 기능 대립 유전자의 선 천 성 및 인수 조 혈 장애에 대 한 잠재적인 치료 접근을 대표할 수 있었다 구상입니다. 이 시나리오에서는 DNA 무료로 접근 가능한 통합 변환을 홍보할 수 있는 피하기 위하여 조언 된다. 또한, "치고 실행" 접근 원치 않는 오프 대상 효과의 가능성을 감소 시킨다. 악성 및 비 악성 혈액 질환의 치료에 새로운 길을 열 것 이라고 특정 전달 시스템을 개발 하기 위해서는 더 많은 노력이 필요 합니다.

Disclosures

공개 충돌의 관심

Acknowledgments

이 작품은 암 예방에 의해 지원 되었다 및 암 연구, 에드워드 P. 에반스 재단 및 NIH (DK092883, CA183252, CA125123, P50CA126752, 가브리엘의 천사 재단 (RP160283, RP140001, 및 R1201), 텍사스의 연구소 연구 CA193235, 그리고 DK107413)입니다. M.C.G.는 학생 과학자에 대 한 베일 러를 지지 하는 연구에 의해 지원 됩니다. Cytometry 베일 러의과 대학에 NIH (연구 자원을 부여 알레르기 및 전염 성 질병 AI036211, 및 국립 암 연구소 P30CA125123의 S10RR024574, 국립 연구소에 대 한 국립 센터)에 의해 부분적으로 지원 되었다 Cytometry 고 셀 코어 정렬입니다.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
CRISPR/Cas9에 의해 Murine 인간과 조 혈 조상 세포의 고효율 유전자 장애
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter