Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Hoogefficiënte Gene verstoring van lymfkliertest en menselijke hematopoïetische voorlopercellen door CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

Een protocol voor snelle CRISPR/Cas9-gemedieerde gene verstoring van muis en mens primaire hematopoietische cellen wordt beschreven in dit artikel. Cas9-sgRNA ribonucleoproteins worden ingevoerd via electroporation met sgRNAs gegenereerd via in vitro transcriptie en commerciële Cas9. Hoge bewerken rendementen worden bereikt met beperkte tijd en de financiële kosten.

Abstract

Ontwikkelingen op het gebied van hematopoietische stamcellen (HSCs) hebben geholpen door methoden om genetisch ingenieur primaire voorlopercellen evenals diermodellen. Volledige gene ablatie in HSCs vereist de generatie van knock-out muizen waaruit HSCs kunnen worden geïsoleerd en gene ablatie in primaire menselijke HSCs was niet mogelijk. Virale transductie kan worden gebruikt voor een knock-down aanpak, maar deze variabele werkzaamheid te lijden. In algemeen, genetische manipulatie van menselijke en muis hematopoietische cellen werd gehinderd door lage efficiëntie en uitgebreide tijd en kosten verplichtingen. Onlangs, CRISPR/Cas9 heeft dramatisch uitgebreid de mogelijkheid om ingenieur van het DNA van zoogdiercellen. Echter heeft de toepassing van CRISPR/Cas9 op hematopoietische cellen zijn uitdagend, voornamelijk als gevolg van hun lage transfectie rendementen, de toxiciteit van plasmide-gebaseerde benaderingen en de langzame doorlooptijd van virus gebaseerde protocollen.

In dit artikel vindt u een snelle methode voor het uitvoeren van CRISPR/Cas9-gemedieerde gene bewerken in lymfkliertest en menselijke hematopoietische stamcellen en voorlopercellen cellen met knockout efficiëntie van maximaal 90%. Deze aanpak maakt gebruik van een ribonucleoprotein (RNP) levering strategie met een gestroomlijnde workflow voor drie dagen. Het gebruik van Cas9-sgRNA-RNP voorziet in een hit-and-run aanpak, invoering van geen exogene opeenvolgingen van DNA in het genoom van bewerkte cellen en vermindering van de off-target effecten. De RNP gebaseerde methode is snel en eenvoudig: het vereist geen klonen van sgRNAs, virus voorbereiding of chemische wijziging van specifieke sgRNA. Met dit protocol, moeten wetenschappers zitten kundig voor met succes het genereren van uitsparingen van een gen van belang in primaire hematopoietische cellen binnen een week, met inbegrip van stilstandstijden voor oligonucleotide synthese. Deze aanpak kan een veel bredere groep gebruikers aan te passen van dit protocol voor hun behoeften.

Introduction

De komst van CRISPR/Cas9 is radicaal vereenvoudigd gene bewerken in cellen van zoogdieren. Vroege CRISPR/Cas9 protocollen gebruikt plasmide of virus gebaseerde levering van Cas9 eiwit en sgRNA1,2,3. Deze benaderingen bleek revolutionair voor de ontwikkeling van cellulaire en dierlijke modellen en ook met succes zijn toegepast op primaire hematopoietische stamcellen en voorlopercellen cellen (HSPCs)4,5. Deze methoden hebben echter een aantal nadelen. Ten eerste blijft gen verstoring efficiëntie vaak minder dan 50%4,5. Hoewel dit voldoende is voor het genereren van knock-out (KO) klonen in cellijnen, maakt de noodzaak om op korte termijn cultuur HSPCs niet vatbaar is voor een dergelijke strategie. Ten tweede, de eis voor het klonen van de hoeveelheid sgRNAs die kunnen worden getest in één experimenten en genereert grote, moeilijk te transfect constructies beperkt. Ten derde, deze benaderingen dwingen wetenschappers te vertragen doorlooptijden.

Om deze beperkingen te overwinnen, onze groep ontwikkelde en publiceerde onlangs een alternatieve benadering van de CRISPR/Cas9 in HSPCs met behulp van Cas9-sgRNA ribonucleoproteins (RNPs)-op basis van levering6. In deze strategie, de ruwe onderdelen van CRISPR (Cas9 eiwit en in vitro getranscribeerd sgRNA) zijn pre-complexvorm en rechtstreeks geleverd in de doelcellen via electroporation (Figuur 1). De halfwaardetijd van het Cas9-sgRNA-RNP complex is korter dan de tijd die plasmide of virale nucleic zuur wordt omgezet, de af-target rate is lager in vergelijking met begin benaderingen7. Bovendien voegt de RNP aanpak het voordeel van het elimineren van elke bron van exogene DNA, die willekeurig in de target cel genoom leidt tot cellulaire transformatie kan integreren.

Dit protocol is gebaseerd op een gestroomlijnde workflow voor RNP gebaseerde gene verstoring experimenten, zoals wordt weergegeven in Figuur 1. De eerste stap is ontwerpen en bestellen van inleidingen voor elke sgRNA. Deze primers worden gebruikt om het maken van sgRNA DNA sjablonen die worden gebruikt voor in vitro transcriptie (IVT) voor het verkrijgen van de sgRNAs. Gezuiverde sgRNAs worden vervolgens geïncubeerd met eerder gekochte Cas9 eiwit, op formulier Cas9-sgRNA RNP complexen. Tenslotte zijn de pre-complexvorm Cas9-sgRNA RNPs electroporated in cellen. Na electroporation, bewerken van efficiëntie kan worden getest en in vitro/in vivo experimenten kunnen gestart worden, afhankelijk van de behoeften. Hieronder een uitgebreide beschrijving van deze innoverende experimentele aanpak kan worden gevonden.

Protocol

Het protocol volgt de richtlijnen van Baylor College of Medicine menselijke ethische commissie. Alle experimentele procedures uitgevoerd op muizen zijn door Baylor College van geneeskunde institutionele Animal Care en gebruik Comité goedgekeurd.

1. sgRNA Fwd Design

  1. Navigeer naar http://www.crisprscan.org/?page=track,8 , om te beginnen met het ontwerpen van sgRNAs van belang.
  2. Klik op de "Muis" of "Menselijke" knop afhankelijk van het celtype van belang.
  3. Voer het gen van belang in het zoekvak UCSC en druk op go.
  4. Zoom in en verplaatsen naar het gebied van het gen (dwz. een specifieke exon) dat is van belang voor doel.
    Opmerking: Om verstoring van de efficiënte gene verdient het richten van de vroegste exon(s) aanwezig in alle getranscribeerde isoforms in uw specifieke celtype.
  5. Zorgen dat de potentiële sgRNA doel sequenties worden vermeld onder een "CRISPRscan voorspellingen op genen (CDS)" rubriek.
  6. Zoek en klik op een doel-reeks met een relatief hoge score en enkele uit-doelstellingen (gemarkeerd in helder groen). De volledige volgorde weergegeven onder de sectie "Oligo sequence" Kopieer en plak deze in een tekstdocument. "ATAGC" toevoegen aan de 3' einde van de reeks. Zodra voltooid, plaatsen van de bestelling voor de volledige reeks.
    Opmerking: Voor elke doelgroep sequentie, CRISPRscan8 biedt een "geïntegreerde" voorwaartse sgRNA primer waarin de T7 promotor, de protospacer (target)-reeks en de volgorde van de overlapping universele steiger (Zie figuur 1A). Een volledige reeks bestaat uit 56 of 57 nucleotiden afhankelijk van de lengte van de protospacer.

2. sgRNA synthese van DNA-sjabloon

  1. Los en vul de sgRNA Fwd en universele Rev primer (zie tabel 1 voor de volledige sequentie). Met het oog op een eindconcentratie van 10 µM, volg de instructies van de fabrikant op hoe verdund inleidingen tot 100 µM, dan het maken van een 1:10 verdunning met water nuclease-vrij.
  2. Voor het uitvoeren van overlappende PCR (Zie figuur 1B), mix het volgende in PCR strip buizen: 2 µL voorste sgRNA primer (10 µM), 2 µL universele Rev steiger primer (HPLC gezuiverd) (10 µM), 10 µL High fidelity polymerase van DNA master mix (2 x) en 6 µL nuclease-gratis water.
  3. De PCR uitvoeren met het volgende programma: 95 ° C gedurende 3 min, 98 ° C gedurende 5 s, 60 ° C gedurende 5 s, 72 ° C gedurende 10 s, ga naar 2 voor 6 cycli, 72 ° C gedurende 1 min, 4 ° C voor eeuwig.
  4. Het zuiveren van het PCR-product met behulp van DNA zuivering kolommen (zie tabel of Materials). Volg de instructies van de fabrikant en elueer met 11,5 µL van elutie buffer.
  5. Het meten van de concentratie van de PCR producten op een spectrofotometer. Het instrument met elutie buffer leeg.
    Opmerking: De DNA-concentratie moet tussen 50 ~ en ~ 120 ng/µL.

3. in Vitro transcriptie van sgRNA

  1. Meng de volgende onderdelen in PCR strip buizen (reagentia worden geleverd in de kit RNA synthese): 4 µL van geëlueerd DNA, 4 µL van dNTPs, 1 µL van 10 x reactie Buffer en 1 µL van T7 RNA polymerase enzym mix.
  2. Incubeer de monsters bij 37 ° C gedurende ten minste 4 uur.
  3. Toepassing van het reinigingsmiddel RNase Schakel RNase uit gehandschoende handen.
  4. Brengen van elk monster RNA tot een totaal volume van 50 µL met nuclease-gratis water (eerste stap van RNA zuivering instructies van de fabrikant).
  5. Doorgaan met RNA zuivering instructies van de fabrikant en elueer in 50 µL van kit-voorwaarde van de nuclease-gratis water.
  6. Het meten van de concentratie van de eluted sgRNA op een spectrofotometer. Leeg het instrument met nuclease-gratis water.
    Opmerking: De verwachte opbrengst na zuivering is 50-80 µg RNA (dat wil zeggen de concentratie van 1.0-1.5 µg/µL).
  7. Het gezuiverde sgRNA onmiddellijk gebruik of bewaar in porties van 2-4 µL bij-80 ° C voor de lange termijn.

4. HSPC isolatie en cultuur

  1. Lymfkliertest HSPCs isolatie en cultuur
    Opmerking: Mannelijke en vrouwelijke Ubc-GFP muizen (JAX004353) en Rosa26-LSL-tdTomato (JAX007914), gekruist met Vav-iCre (JAX008610) 2-6 maanden van leeftijd werden gebruikt om het verkrijgen van de resultaten die hieronder worden weergegeven.
    1. Euthanaseren narcose muizen door cervicale dislocatie.
      Opmerking: Twee opgeleide personen moeten onafhankelijk controleren of succesvolle euthanasie door op te merken van een gebrek aan ademhaling en hartslag voor ten minste 5 min. Verwijder de huid van de dieren.
    2. Ontleden zijn verbeend, dijbeen en iliacale toppen van muizen en verwijder alle spier- en bindweefsel rond de ontleed botten. Plaats intact botten in een weefselkweek schotel op ijs met HBSS aangevuld met 2% FBS (HBSS +). Verplaatsen naar een laminaire flow hood zodra al de botten zijn schoongemaakt en overgedragen aan de weefselkweek schotel.
    3. Overdracht gereinigd botten te steriel mortel, met 2 mL ijskoud HBSS + per 3 beenderen. Met behulp van de stamper, crush botten in botfragmenten, het vrijgeven van beenmerg van binnen. Blijven pestling tot botten stopt kraken onder de stamper.
    4. Supernatant van de mortel en filter in een conische buis van 50 mL, met behulp van een 40 µm cel zeef verzamelen. Spoel de resterende botfragmenten met 5 mL ijskoud HBSS + en filter in de dezelfde 50 mL conische buis met behulp van de dezelfde 40 µm zeef.
    5. Het wassen van de cellen tweemaal door topping uit de buis met ijskoude HBSS + en centrifugeren bij 400 x g gedurende 7 min. negeren het supernatant.
    6. Na de tweede wash resuspendeer de pellet cel in 20 mL ijs koud PBS. Levensvatbare cellen tellen met uitsluiting van de trypan-blauw9.
    7. Incubeer 1 x 108 levensvatbare cellen per 1 mL ijskoud HBSS + met biotine-geconjugeerde antilichaam van de c-kit bij 1:100 verdunning voor 45 min op ijs.
    8. De cellen met ijskoude HBSS + wassen door centrifugatie bij 400 x g gedurende 7 minuten en het supernatant te verwijderen.
    9. Incubeer de cellen met magnetische kralen anti-Biotine instructies van de fabrikant.
    10. Isoleren van c-kit positieve cellen met behulp van magnetische kolommen of magnetische-geactiveerde cel sorteerders instructies van de fabrikant. Verzamelen van c-kit positieve cellen in 15 mL conische buisjes.
    11. De cellen tweemaal met PBS door topping uit de conische buis 15 mL wassen en centrifugeren bij 400 x g gedurende 7 min. Verwijder het supernatant. Bereken het totale aantal levensvatbare cellen door trypan blauwe uitsluiting9tussen de twee wasbeurten.
    12. Resuspendeer c-kit + cellen bij een concentratie van maximaal 106 viablecells per 100 µL cultuurmedium voor lymfkliertest HSPCs aangevuld met 2% FBS, 50 ng/mL muis stamcel factor (SCF), 50 ng/mL muis thrombopoietin (TPO), 10 ng/mL muis IL-3 en 10 ng/mL muis IL-6.
    13. Incubeer de cellen bij 37 ° C, 5% CO2 gedurende ten minste 1 uur tot een maximum van 24 h vóór de electroporation.
  2. Menselijke HSPCs isolatie en cultuur
    Opmerking: Deze stappen moeten worden uitgevoerd in een laminaire flow-kap.
    1. Beenmerg/koord bloedcellen door een zeef van 40 µm cel filteren.
    2. Verdunnen 1:2 de gefilterde beenmerg/koord bloed cellen met PBS aangevuld met 1 mM EDTA (PBS/EDTA).
    3. Breng 15 mL van de kleurovergang medium dichtheid in een conische buis van 50 mL. Giet voorzichtig 30 mL van de verdunde beenmerg/navelstrengbloed op de dichtheid kleurovergang middellange oppervlak. Als het volume van de celsuspensie groter dan 30 mL is bereiden meerdere buizen.
      Opmerking: Zorg ervoor dat de interface tussen het bloed en de dichtheid kleurovergang medium zo scherp mogelijk te houden.
    4. Draai de buizen bij 750 x g gedurende 30 min met geen vertraging.
    5. Verzamel de mononucleaire cellaag detecteerbare op medium interface en overdracht aan een schone 50 mL conische buis. Opvullen van de buis met PBS/EDTA en draaien de cellen bij 280 g gedurende 15 min. negeren het supernatant.
    6. De cellen tweemaal in PBS/EDTA spinnen bij 400 x g gedurende 7 minuten en teruggooi het supernatant wassen.
    7. Incubeer de mononucleaire cellen met magnetische kralen anti-CD34 instructies van de fabrikant.
    8. Isoleren CD34 + cellen met behulp van magnetische kolommen of magnetische-geactiveerde cel sorteerders instructies van de fabrikant. Verzamelen CD34 + cellen in 15 mL conische buisjes.
    9. Wash verzameld CD34 + cellen tweemaal door topping uit de buis met PBS en spinnen bij 400 x g gedurende 7 minuten en teruggooi het supernatant. Bereken het totale aantal levensvatbare cellen door trypan blauwe uitsluiting9tussen de twee wasbeurten.
    10. Resuspendeer de cellen in een kweekvloeistof aangevuld met 100 ng/mL menselijke SCF, 100 ng/mL menselijke FLT3 ligand (FLT3L), 100 ng/mL menselijke TPO bij een concentratie van ~2.5 x 105 levensvatbare cellen / ml. cultuur geïsoleerd CD34 + cellen bij 37 ° C, 5% CO2 gedurende 24 uur aan een maximaal 48 uur voorafgaande naar electroporation.
      Opmerking: Controleren voorafgaand aan electroporation zuiverheid van verrijkte CD34 + bevolking door stroom cytometry.

5. Electroporation

Opmerking: Het volgende protocol is geoptimaliseerd voor 10 µL electroporation uiteinden. Alle stappen moeten worden uitgevoerd in een laminaire flow-kap.

  1. Cellen tellen trypan blauwe uitsluiting9. Verzamelen van 2 x 105 levensvatbare cellen per repliceren (bijvoorbeeld verzamelen 6 x 105 cellen voor 3 electroporations).
  2. Wassen cellen tweemaal met PBS, spinnen bij 300 x g gedurende 7 minuten en zorgvuldig verwijderen het supernatant.
  3. Parallel, opstellen Cas9-sgRNA-RNP complexen door broeden in PCR buizen voor 20-30 min op RT 1,5 µg Cas9 met 1 microgram van totale sgRNA voor elke repliceren, behalve het enige besturingselement van Cas9.
    Opmerking: Cas9 eiwit wordt geleverd met 10 µg/µl concentratie. Om ervoor te zorgen nauwkeurige pipetteren, verdunnen 1:10 de totale hoeveelheid van Cas9 proteïne nodig met nuclease-gratis water (bijvoorbeeld voor 10 electroporations nemen 1 µl van Cas9 eiwit en Verdun het met 9 µL van nuclease-gratis water en Incubeer 1 µl van verdunde Cas9 per repliceren. Afhankelijk van de concentratie van de sgRNA, moet het totale volume van Cas9 en sgRNA bestaan tussen de 1,7 en 2 µl per repliceren. Als met behulp van twee sgRNAs broeden 500 ng van elke sgRNA per repliceren; als 3 gebruikt sgRNAs broeden 330 ng van elke sgRNA per repliceren, enzovoort.
  4. Bereken het totale volume van resuspensie Buffer T nodig door te vermenigvuldigen met het aantal totaal 10 µL repliceert nodig (bijvoorbeeld 30 µL voor 3 wordt gerepliceerd). Resuspendeer Ingehuld cellen met de berekende hoeveelheid Buffer T. ervoor zorgen dat de uiteindelijke concentratie van de celsuspensie 2 x 107 cellen/mL.
  5. Aliquot 10 µL van de geresuspendeerde cellen/repliceren in elke PCR-buis met de pre-complexvorm sgRNA/Cas9 RNP (bv. voor een drievoud aliquoot 30 μL van celsuspensie in een PCR-buis met pre-complexvorm Cas9-sgRNA).
  6. Instellen het electroporation systeem inschakelen van het instrument en voeg 3 mL buffer E in een cuvet electroporation, en schuif de cuvette in de meetcel houder.
  7. Stel de gewenste electroporation criteria op apparaat: menselijke HSPCs (1600 V, 10 ms, 3 pulsen) of muis HSPCs (1700 V, 20 ms, 1 puls).
    Opmerking: Indien gewenst, vóór het uitvoeren van experimenten op CD34 + HSPCs, sgRNA-efficiëntie kan worden getest op acute myeloïde leukemie (AML) cellijnen (bijvoorbeeld HL60) met behulp van dezelfde strategie (gebruik antibiotica-vrij medium voor AML cellijnen) met de volgende electroporation voorwaarden: Buffer R, 1350 V, 35 ms, 1 puls.
  8. De electroporation wordt uitgevoerd met een speciale electroporation Pipet, die heeft een klauw die op het uiteinde van de pipet electroporation zakken. Houd de pipet electroporation, uitbreiden van de klauw, grijpen de schijf binnen het uiteinde van de pipet en stevig druk op de pipet naar veilige de tip.
  9. Pipetteer van de monster op en neer 10 keer te mengen. Neem 10 µL, ervoor dat zich geen bubbels, en het uiteinde van de pipet direct invoegen in de elektrolytische buffer in de electroporation cuvette. Probeer niet te raken van de muren van de Cuvet. Druk op "start" op het scherm. Nadat het bericht 'voltooid' wordt weergegeven, verwijdert u de pipet en afzien van inhoud in putje met nieuwe HSPC kweekmedium.
  10. Herhaal voor alle monsters. Verandering Pipetteer tips tussen monsters, alleen indien nodig.

Representative Results

Het doel van dit protocol is voor het uitvoeren van gene knock-out (KO) in muizen en menselijke HSPCs met behulp van Cas9-sgRNA RNPs. De werkstroom is gemakkelijk en snel en zorgt voor de voltooiing van experimenten in minder dan een week van experimenteel design tot beoordeling van de efficiëntie van de KO.

Vergeleken met de plasmide of virus-gebaseerde benaderingen, het succes van onze protocol bouwt voort op de combinatie van sgRNA RNPs en electroporation. Deze strategie klonen-gratis verkort aanzienlijk de tijd die nodig is om de onderdelen te transfect. Bovendien electroporation zorgt voor Transfectie tot 95% van de cellen, het maximaliseren van de levering van de RNPs.-sgRNAs kunnen synthetized in het lab via in vitro transcriptie (IVT), terwijl het gezuiverde Cas9 eiwit kan worden gekocht bij verschillende bedrijven ( Zie protocol). sgRNA DNA sjablonen voor IVT worden verkregen met het uitvoeren van een korte PCR met behulp van de sgRNA Fwd primer (figuur 1A, B) en de universele steigerwerk Rev primer (figuur 1B - Zie Protocol). Het PCR-product wordt vervolgens gebruikt als een sjabloon voor de IVT (Figuur 1 c). Cas9-sgRNA RNP complexen worden gegenereerd voor 15-30 minuten aan het broeden de sgRNAs en de Cas9 (Figuur 1 c). Ten slotte, zijn sgRNA RNPs electroporated in cellen. Bewerkte HSPCs kunnen vervolgens worden gebruikt voor het uitvoeren van zowel in vitro en in vivo experimenten.

Verstoring van het gen in cellen van de muis

Om aan te tonen van de doeltreffendheid van de Cas9-sgRNA-RNP electroporation strategie, c-kit + HSPCs geïsoleerd van muizen overal uiting van GFP of tdTomato zijn electroporated met sgRNA tegen GFP of tdTomato. Onder de drie sgRNA ontworpen tegen GFP, GFP sg1 efficiëntst, uitgevoerd ongeveer 70-75% verstoring van GFP expressie zoals bepaald door de stroom cytometry (figuur 2A, B) exposeren. Om te kwantificeren de gene verstoring frequentie op genomisch niveau, genomic DNA van de cellen van de electroporated werd geïsoleerd en T7 endonuclease ik gebaseerde (T7EI) test werd uitgevoerd. Zoals blijkt uit figuur 2C, gedetecteerd T7EI assay omhoog tot 60% indel vorming. Merk op dat T7EI assays neigen te onderschatten de frequenties van microdeleties. We hebben ook sgRNA tegen tdTomato en electroporated HSPCs uiten van tdTomato uit de Rosa26 locus gemeld. Zoals blijkt uit figuur 2D, tdTomato sg1 efficiënt ablated worden van de expressie van tdTomato.

Verstoring van het gen in menselijke cellen

Hier, wordt efficiënte verstoring verkregen met een enkele sgRNA aanpak gericht op CD45, een cel-oppervlakte marker uitgedrukt op hematopoietische cellen, getoond. Drie sgRNAs dat targeting verschillende exons van CD45 waren ontworpen (CD45 sg1, sg2 en sg3). De efficiëntie van de sgRNAs werd getest in de HL60 AML cellijn (figuur 3A). Eiwit KO werd beoordeeld door stroom cytometry 5 dagen na electroporation. CD45 sg1 was het meest efficiënte (98% KO rendement - figuur 3A), en werd gebruikt voor verdere experimenten. Figuur 3B toont CD45 KO in primaire menselijke CD34 + voorlopercellen met behulp van CD45 sg1, beoordeeld door stroom cytometry 5 dagen na electroporation. Terwijl CD34 expressie onaangetast was, was CD45 expressie verloren in ongeveer 80% van de cellen. 200.000 bewerkte primaire CD34 + cellen werden retro-orbitally 6 uur na electroporation in NSG muizen getransplanteerd. Beenmerg en milt cellen werden gekapt 3 maanden na de transplantatie. Bewerkte cellen (HLA-ABC positieve, negatieve CD45, gemarkeerd in het rood) zijn detecteerbaar alleen in monsters van sgRNA behandeld en niet in Cas9 alleen besturingselementen (Figuur 3 c).

Indien gewenst, kan twee sgRNAs gericht op in de buurt van sequenties worden gebruikt voor het genereren van verwijderingen. Deze aanpak zorgt voor een snelle raming van de bewerken efficiëntie met een PCR en produceert vaak hogere efficiëntie van de verstoring. Figuur 3D toont de efficiënte generatie van een 58 bp verwijdering in exon 10 van DNMT3A. 200.000 bewerkte CD34 + cellen werden 6 uur na electroporation in NSG muizen getransplanteerd. De 58 bp verwijdering is duidelijk aangetroffen in het perifere bloed van werk NSG muizen 5 maanden na injecties (figuur 3E) bevestigen de redactie van CD34 + cellen met langdurige engraftment mogelijkheden.

Figure 1
Figuur 1: de aanpak van het snel en gemakkelijk voor het genereren van sgRNA RNPs. A) vertegenwoordiging van de sgRNA Fwd primer. De sgRNA Fwd primer is een DNA-oligonucleotide met de T7 promotor, de volgorde van de protospacer en de volgorde van een overlapping met de sgRNA steiger. Op de 3' is einde, gemarkeerd in het rood, de volgorde van de "ATAGC" die moet worden toegevoegd aan de sgRNA Fwd primer reeks verkregen op CRISPRscan. B) schematische weergave van de overlapping PCR uitgevoerd voor de IVT sjabloon. De overlap tussen de sgRNA Fwd primer en de Universal steiger Rev primer zorgt voor de uitbreiding en de versterking door PCR. C) met een beschrijving van de reactie van de IVT en de sgRNA RNP pre-complexvormers Cartoon. Het PCR-product is gezuiverd en gebruikt als een sjabloon voor de IVT. IVT genereert een hoog gehalte aan sgRNAs die kunnen worden gebruikt in meerdere wordt gerepliceerd (zie protocol). sgRNA RNPs worden gegenereerd de gezuiverd van IVT en de eerder gekochte Cas9 proteïne sgRNA aan het broeden. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2: efficiënte gene verstoring van hematopoïetische voorlopercellen van muis. A) een sgRNA dat targeting GFP (GFP sg1) samen met Cas9 eiwit was electroporated in lymfkliertest c-kit + HSPCs GFP uitdrukken, en geanalyseerd door stroom cytometry 24 uur na electroporation. B) verschillende hoeveelheid GFP sg1 was complexvorm met 1 microgram van Cas9 eiwit en electroporated. Zo weinig als 200 ng van GFP sg1 efficiënt ablated worden GFP expressie. C) T7EI-test uitgevoerd op genomic DNA afgezonderd van cellen die gebruikt worden in A-B. PCR amplicon verspreid over de breukzijde van de Cas9-sgRNA was verdund 1:4 in 1 x Buffer 2 en gehybridiseerde langzaam in een thermische cycler. Gehybridiseerde fragmenten werden vervolgens verteerd met 1,25 U van T7 endonuclease ik gedurende 10 minuten bij 37 ° C. Verteerd fragmenten werden gescheiden door polyacrylamide gelelektroforese. Band intensiteiten zijn geanalyseerd met behulp van ImageJ software door het uitzetten van de band intensiteiten voor elke rijstrook. % splitsingsproducten werd berekend door de verhouding van de intensiteiten van de gekloofd bands te uncleaved banden. D) c-kit + HSPCs geïsoleerd van muizen uiting van tdTomato was electroporated met Cas9 eiwit complexvorm met sgRNA tegen tdTomato. Stroom cytometry uitgevoerd 24 uur nadat electroporation geopenbaard dat ongeveer 74% van de cellen verwijderd tdTomato. R26 = Rosa26. * p < 0,05, ** p < 0,01, *** p < 0,001. Dit percentage is aangepast van Gundry et al.zijn. 6 Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3: efficiënte gene verstoring in menselijke hematopoietische cellen. A) drie sgRNAs gericht op CD45 (CD45 sg1, sg2 en de sg3) werden ontworpen en getest in de lijn van de cel HL60 AML (zie protocol electroporation voorwaarden). Stroom cytometry werd 5 dagen na electroporation uitgevoerd. CD45 sg1 werd geselecteerd als de meest efficiënte onder de drie sgRNAs (KO efficiëntie 98%). B) CD45 KO in primaire menselijk bloed CD34 + HSPCs met behulp van CD45 sg1 aansluitsnoer. CD45 verlies kan worden opgespoord in ongeveer 80% van de cellen. Merk op dat CD34 expressie ongewijzigd nadat u hebt bewerkt. C) Edited menselijke HSPCs efficiënt kunnen worden geaccepteerd in de NSG muizen. Menselijke genucleëerde cellen weer de normale HLA +/ CD45 + fenotype in alleen-Cas9 geaccepteerd muizen, terwijl in muizen geaccepteerd met CD45-sg1 behandeld CD34 + cellen, beide HLA +/ CD45 + en HLA +/ CD45-populaties worden waargenomen die engraftment van menselijke CD45 KO cellen aangeeft. D) 2% agarose gel tonen een 58 bp schrapping gegenereerd door 2 sgRNAs (dual gids benadering) in exon 10 van DNMT3A in menselijke HSPCs uit 3 verschillende navelstrengbloed (CB1 CB2 en CB3). PCR werd 3 dagen na de electroporation uitgevoerd. E) 2% agarose gel aan te tonen de persistentie van de 58 bp verwijdering 5 maanden na transplantatie in NSG muizen. Dit percentage is aangepast van Gundry et al. 6 Klik hier voor een grotere versie van dit cijfer.

Oligonucleotide Volgorde Opmerking
Universele Rev steiger primer gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Universele omgekeerde primer voor overlappen PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd primer volgorde voor overlapping PCR

Tabel 1: Voltooien van sequenties van sgRNA Fwd inleidingen gebruikt in de experimenten en Universal Rev primer.

Discussion

In dit gedetailleerde protocol beschreven aanpak van de RNP kunt efficiënt gene knock-out in zowel muis als menselijke primaire hematopoietische cellen ook net als Luchtvering cellijnen. Hoewel zeer hoge KO rendementen vaak verkregen worden, verschillende kritische variabelen moeten worden overwogen. Eerst, keuze van de juiste exon is de sleutel in het garanderen dat efficiënt indel opneming correspondeert met gene knock-out. Twee belangrijke factoren met betrekking tot de keuze van de exon zijn behoud over isoforms en exon positie binnen afschriften. Isovorm-expressiepatronen zijn variabele over celtypes, dus als gene KO over celtypes wordt gewenst, exons die invariant tussen cel typen moeten worden gericht. Isovorm patronen kunnen worden geverifieerd met behulp van q-PCR of RNA-sequencing gegevens. Voor het standpunt van de exon in Transcripten, het is het beste te richten op vroege exons als frameshift mutaties in de terminal of voorlaatste exon onzin-gemedieerde verval10, produceren eiwitten met roman of onbekende functies in plaats van echte Null-waarden kan ontsnappen.

Het bepalen van de indel is frequentie een kritieke stap te schatten van de KO-efficiëntie, te correct interpreteren de biologische uitkomst van het experiment. Enzym assays (bijvoorbeeld landmeter assay) hebben het voordeel dat ze relatief snel en gemakkelijk uit te voeren. Echter ze hebben de neiging te onnauwkeurig als gevolg van aanzienlijke achtergrond signalen en de resultaten zijn vaak moeilijk te reproduceren. Bovendien geven ze geen informatie over de kwaliteit van microdeleties gegenereerd (bijvoorbeeld lengte invoegingen en verwijderingen) in het experiment. Sanger sequencing biedt een waardevol alternatief voor het endonuclease testen. Platforms zoals TIDE11 (https://tide.nki.nl/) helpen te ontleden sanger sporen en nauwkeurige schattingen van de verstoring van de allèlique-efficiëntie, terwijl ook het verstrekken van de frequenties van individuele microdeleties te produceren. Het grote nadeel is een absolute afhankelijkheid van kwalitatief hoogwaardige Sanger sequencing sporen. High-throughput amplicon sequencing overwint de meeste van deze kwesties. Amplicon bibliotheken kunnen worden voorbereid starten met zeer lage DNA-ingangen en de hoge dekking zorgt voor betrouwbare resultaten. Ter vermindering van de kosten van de amplicon rangschikking, spike we meestal in amplicon bibliotheken in grotere sequencing loopt (b.v. RNA-sequencing) met behulp van slechts 1-1,5% van de totale luidt als volgt. Ten slotte, om te bevestigen succesvolle knock-out, we sterk aanbevelen eiwitniveaus beoordeling door westelijke vlekken of stroom cytometry, indien mogelijk.

Zoals eerder is beschreven, de methode die hier gepresenteerd is snel en ongecompliceerd en vertegenwoordigt een nieuwe tool om te studeren gene knock out in muizen en menselijke HSPCs. Terwijl ons protocol instructies voor het gen knock-out met een tip gebaseerde electroporation systeem bevat, hebben andere systemen aangetoond zeer effectieve12,,13.

Twee belangrijke beperkingen moeten worden erkend met betrekking tot de RNP-aanpak. Ten eerste, zoals beschreven door onze fractie, de levensvatbaarheid van de HSPCs electroporated met in-vitro getranscribeerd sgRNAs aanzienlijk kan worden aangetast door electroporation, vooral wanneer de omstandigheden niet optimaal6zijn. Indien nodig, kan commercieel samengestelde sgRNAs (d.w.z. afschaffing in vitro transcriptie) dit probleem opgelost. Deze worden steeds minder duur met tijd en kunnen worden gekocht bij verschillende leveranciers. In dit scenario, in vitro transcriptie kan worden gebruikt voor het genereren van een pool van sgRNA aan het scherm voor werkzaamheid, en vervolgens de meest efficiënte sgRNA(s) voor synthese kan worden geselecteerd. De tweede belangrijke beperking van de RNP aanpak is het onvermogen om bij te houden met succes transfected cellen, zoals virale gebaseerde benaderingen. Echter, de hoge KO efficiëntie en snelle bewerken verkregen met Cas9-sgRNA RNPs kunnen opwegen tegen deze nadelen in vele experimentele scenario's. Het is raadzaam om precies bepalen de verstoring van de efficiëntie van elk experiment met high-throughput amplicon sequencing. Als de knock-out van het gen van belang wordt verwacht om te verlenen een proliferatieve fenotype (d.w.z. verlaagd of verhoogd in vergelijking met wild-type cellen proliferatie), bepaling van de frequentie van de indel op meerdere tijdstippen kan men beoordelen of KO cellen verrijking (d.w.z. indel frequentie toeneemt na verloop van tijd) ondergaan of worden samengehouden (dwz. indel frequentie afneemt na verloop van tijd).

Uitvoeren van in vivo of in vitro experimenten om te begrijpen van de biologische effecten van verlies van de genfunctie vereist de nodige controles. Zoals eerder genoemd, in vitro transcriptie sgRNAs kan giftig voor de cellen, met name primaire progenitor cells6. Bovendien kunnen de DNA dubbele-strand einden veroorzaakt door Cas9 eiwit gene onafhankelijke anti-proliferatieve reactie14veroorzaken. Dus, we vaak gebruik van een aantal besturingselement sgRNAs in CRISPR experimenten en aanbevelen van een cel oppervlakte marker uitgedrukt op uw celtype, alsook een tweede doel-gen dat niet wordt uitgedrukt.

Op korte termijn cultuur van menselijke HSPCs in aanwezigheid van cytokines verhoogt de efficiëntie van gene verstoring6 en noodzakelijk is ter verwezenlijking van hoogrenderende KO. We hebben 36-48 uur de ideale periode van cultuur vóór electroporation6gevonden. Na electroporation, kunnen de cellen verder gekweekte houdend in mening dat hoe langer de cultuur hoe hoger het risico van multilineage engraftment capaciteit verliezen. Dus voeren wij meestal transplantaties 6 uur na electroporation en nooit later dan 24 uur na electroporation.

CRISPR/Cas9 is het vermogen van wetenschappers om met succes het bewerken van het genoom van zoogdiercellen dramatisch verbeterd. Gene verstoring meer haalbaar maken in primaire hematopoïetische voorlopercellen is voorspeld dat de wetenschappelijke kennis op het gebied van HSPCs en hematologic ziekten snel te vergroten. Nog belangrijker is, maakt het protocol beschreven hier het ook mogelijk om gelijktijdig meerdere uitsparingen te genereren met een hoog rendement, waardoor voor de modellering van de complexe genetische landschappen, vaak gezien in leukemische ziekten.

Hoewel de hierin beschreven protocollen zijn gericht op de verstoring van het gen, kunnen zij gemakkelijk aan te passen voor gene knock-in experimenten. Dit kan worden bereikt via de co levering van single-stranded oligonucleotide sjablonen voor homologie geleide reparatie6,13 (HDR) of via de signaaltransductie van cellen post-electroporation met AAV6 vectoren met de homologie sjabloon12. De mogelijkheid om te herstellen of in te voeren van specifieke mutaties in HSPCs zal de nieuwe therapeutische strategieën voor gentherapie en de uitgebreide studie van kanker stuurprogramma mutaties in AML en andere hematologic ziekten vergemakkelijken. Terwijl HDR in menselijke HSPCs al succesvolle6,12,13, muis HSPCs moeilijk geweest te bewerken met behulp van deze strategie-6. Optimalisatie van HDR protocollen in mens en vooral in de HSPCs van de muis kunnen meer specifieke bewerken en de ontwikkeling van instrumenten voor het bijhouden van bewerkte cellen met behulp van endogene tagging.

Het is tot slot ook voor ogen dat verstoring van mutant winst-van-functie allelen een potentiële therapeutische aanpak voor aangeboren en verworven hematopoietische stoornissen vertegenwoordigen kon. In dit scenario, wordt een DNA-vrije benadering geadviseerd om te voorkomen dat mogelijke integraties die transformatie kunnen bevorderen. Bovendien, de "hit and run" aanpak vermindert de mogelijkheid van ongewenste effecten van de af-target. Meer inspanning is nodig teneinde specifieke levering systemen die nieuwe mogelijkheden voor de behandeling van maligne en niet-kwaadaardige hematologic ziekten openen zou.

Disclosures

Geen belangenconflict openbaar te maken

Acknowledgments

Dit werk werd gesteund door de kankerpreventie en onderzoek instituut van Texas (RP160283, RP140001 en R1201), van de Gabrielle Angel Foundation voor kankeronderzoek, de Edward P. Evans Foundation en de NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235, en DK107413). M.C.G. wordt ondersteund door Baylor onderzoek pleit voor Student wetenschappers. Stroom cytometry was slechts gedeeltelijk ondersteund door de NIH (nationaal centrum voor onderzoeksmiddelen verlenen S10RR024574, Nationaal Instituut van allergie en besmettelijke ziekten-AI036211, en nationale kanker instituut P30CA125123) voor het Baylor College of Medicine Cytometry en cel sorteren van Core.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Hoogefficiënte Gene verstoring van lymfkliertest en menselijke hematopoïetische voorlopercellen door CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter