Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Svært effektiv Gene avbrudd i Murine og menneskelig blodkreft stamfar celler av CRISPR/Cas9

doi: 10.3791/57278 Published: April 10, 2018
* These authors contributed equally

Summary

En protokoll for rask CRISPR/Cas9-mediert genet avbrudd i musen og menneskelige primære blodkreft cellene er beskrevet i denne artikkelen. Cas9-sgRNA ribonucleoproteins blir introdusert via electroporation sgRNAs generert gjennom i vitro transkripsjon og kommersielle Cas9. Høy redigering effektivitet oppnås med begrenset tid og finansielle kostnader.

Abstract

Fremskritt innen blodkreft stamcelletransplantasjon (HSCs) har blitt hjulpet av metoder å genetisk primære progenitor celler som dyremodeller. Komplett genet ablasjon i HSCs nødvendig generering av knockout mus som HSCs kan være isolert, og gene ablasjon i primære menneskelige HSCs ikke var mulig. Viral signaltransduksjon kan brukes for sammenleggbare tilnærminger, men disse led av variabel effekt. Generelt, genetisk manipulasjon av human og mus blodkreft cellene ble hindret av lav effektivitet og omfattende tid og kostnader forpliktelser. Nylig har CRISPR/Cas9 dramatisk utvidet muligheten til å ingeniør DNA av pattedyrceller. Men har anvendelsen av CRISPR/Cas9 til blodkreft cellene vært utfordrende, hovedsakelig på grunn av deres lave transfection effektivitet, toksisitet av plasmider tilnærminger og langsom tiden av virus-baserte protokoller.

En rask metode for å utføre CRISPR/Cas9-mediert genet redigering i murine og menneskelig blodkreft stilk og stamfar celler med knockout effektivitet på opptil 90% tilbys i denne artikkelen. Denne tilnærmingen benytter en ribonucleoprotein (RNP) levering strategi med en strømlinjeformet arbeidsflyt for tre dager. Bruk av Cas9-sgRNA RNP gir en hit-and-run tilnærming, introduserer ingen eksogene DNA-sekvenser i genomet redigerte celler og redusere off-målet effekter. Metoden RNP-baserte er rask og enkel: det krever ikke kloning av sgRNAs, virus forberedelse eller bestemte sgRNA kjemisk endring. Med denne protokollen kunne forskere kunne generere knockouts av en genet av interesse i primære blodkreft cellene innen en uke, inkludert nedetid for oligonucleotide syntese. Denne tilnærmingen gjør en mye bredere gruppe av brukere å tilpasse denne protokollen for deres behov.

Introduction

Bruk av CRISPR/Cas9 har radikalt forenklet genet redigering i pattedyrceller. Tidlig CRISPR/Cas9-protokoller brukes plasmider eller virus-basert levering Cas9 protein og sgRNA1,2,3. Disse viste revolusjonerende for utvikling av mobilnettet og dyr og er også vellykket brukt til primære blodkreft stilk og stamfar celler (HSPCs)4,5. Disse metodene har imidlertid en rekke ulemper. Først fortsatt gen avbrudd effektivitet ofte under 50%4,5. Mens dette er tilstrekkelig for å generere knockout (KO) kloner i cellelinjer, gjør behovet for kortsiktige kultur HSPCs ikke mottakelig for slik strategi. Det andre begrenser kravet for kloning mengden av sgRNAs som kan testes i enkelt eksperimenter og genererer stor, vanskelig å transfect konstruksjoner. Tredje tvinge disse tilnærmingene forskere å bremse behandlingstid.

For å overvinne disse begrensningene, vår gruppe utviklet og nylig publisert en alternativ CRISPR/Cas9-tilnærming i HSPCs med Cas9-sgRNA ribonucleoproteins (RNPs)-baserte levering6. I denne strategien, rå komponenter i CRISPR (Cas9 protein og i vitro transkribert sgRNA) er pre-kompleksbundet og direkte levert til målet celler via electroporation (figur 1). Halveringstiden av Cas9-sgRNA RNP komplekset er kortere enn det plasmider eller viral nukleinsyre er transkribert, off-målet prisen er lavere sammenlignet med tidlig tilnærminger7. Videre legger RNP tilnærming til fordel for å eliminere alle kilder til eksogene DNA, som tilfeldig kan integrere i målet cellen genomet førte til mobilnettet transformasjon.

Denne protokollen er basert på en strømlinjeformet arbeidsflyt for RNP-basert genet avbrudd eksperimenter, som vist i figur 1. Det første trinnet er å designe og bestilling primere for hver sgRNA. Disse veiledningene benyttes for å gjøre sgRNA DNA maler som brukes for i vitro transkripsjon (PES) til å få sgRNAs. Renset sgRNAs er deretter inkubert med tidligere kjøpt Cas9 protein, til skjemaet Cas9-sgRNA RNP komplekser. Endelig er pre-kompleksbundet Cas9-sgRNA RNPs electroporated i celler. Etter electroporation, redigere effektivitet kan testes og i vitro/i vivo eksperimenter kan startes, avhengig av behov. Under en detaljert beskrivelse av denne nyskapende eksperimentelle tilnærming kan bli funnet.

Protocol

Protokollen følger retningslinjene for Baylor College of Medicine menneskelige etikk. Alle eksperimentelle prosedyrer utført på mus er godkjent av Baylor College of Medicine institusjonelle Animal Care og bruk komiteen.

1. sgRNA Fwd Design

  1. Naviger til http://www.crisprscan.org/?page=track8 for å begynne å utforme sgRNAs rundt.
  2. Klikk på "Mus" eller "Menneskelig" knappen avhengig celle av interesse.
  3. Angi genet av interesse i søkeboksen UCSC og klikk på go.
  4. Zoome inn og flytte til regionen genet (dvs. en bestemt ekson) som er av interesse for målet.
    Merk: Å oppnå effektiv genet avbrudd anbefales målretting den tidligste exon(s) i alle transkribert isoformene i din bestemt celle type.
  5. Kontroller at potensielle sgRNA målet sekvensene er oppført under en "CRISPRscan spådommer på gener (CDS)" overskrift.
  6. Finn og klikk på en lsekvens med en relativt høy score og noen av mål (uthevet i lys grønn). Kopier hele sekvensen vises under delen "Oligo sequence" og lim det inn i et tekstdokument. Legge til "ATAGC" 3 slutten av sekvensen. En gang fullført, legge inn bestillingen for full-lengde sekvenser.
    Merk: For hver målet, CRISPRscan8 gir en "integrert" frem sgRNA primer som inkluderer T7 arrangøren, protospacer (mål) sekvensen og universell stillaset overlapping sekvensen (se figur 1A). En full lengde sekvens består av 56 eller 57 nukleotider avhengig av lengden på protospacer.

2. sgRNA DNA mal-syntese

  1. Oppløse og fortynne sgRNA Fwd og universell Rev primer (se tabell 1 for det fullstendige orden). For å få en 10 µM siste konsentrasjon, følger produsenten instruksjon om hvordan du fortynne primere for 100 µM, så gjøre en 1:10 fortynning med nuclease-fritt vann.
  2. Utføre overlappende PCR (se figur 1B), blanding følgende PCR stripe rør: 2 µL frem sgRNA primer (10 µM), 2 µL Universal Rev stillaset primer (HPLC renset) (10 µM), 10 µL Hi-Fi DNA polymerase master mix (2 x) og 6 µL nuclease-fritt vann.
  3. Kjøre PCR med følgende program: 95 ° C i 3 minutter, 98 ° C i 5 s, 60 ° C i 5 s, 72 ° C for 10 s, gå til 2 for 6 sykluser, 72 ° C i 1 minutt, 4 ° C alltid.
  4. Rense PCR produktet bruker DNA rensing kolonner (se tabell av materialer). Følg instruksjonene fra produsenten og elute med 11.5 µL av elueringsbufferen.
  5. Måle konsentrasjonen av PCR produktene på et spektrofotometer. Tomme instrumentet med elueringsbufferen.
    Merk: DNA konsentrasjonen bør være mellom ~ 50 og ~ 120 ng/µL.

3. in Vitro transkripsjon av sgRNA

  1. Bland følgende komponenter i PCR stripe rør (reagenser er gitt i RNA syntese kit): 4 µL elut DNA, 4 µL av dNTPs, 1 µL av 10 x reaksjon Buffer og 1 µL T7 RNA polymerase enzym mix.
  2. Inkuber prøvene ved 37 ° C i minst 4 timer.
  3. Bruke RNase rengjøringsmiddel for å fjerne RNase fra hansker hender.
  4. Bringe hver RNA utvalg til et totalt volum på 50 µL med nuclease-fritt vann (første trinn av RNA rensing følge instruksjonene fra produsenten).
  5. Fortsett med RNA rensing følge instruksjonene fra produsenten og elute i 50 µL kit gitt nuclease uten vann.
  6. Måle konsentrasjonen av eluted sgRNA på et spektrofotometer. Tomme instrumentet med nuclease-fritt vann.
    Merk: Forventet avkastning etter rensing er 50-80 µg av RNA (dvs. konsentrasjon av 1.0-1.5 µg/µL).
  7. Bruke den renset sgRNA umiddelbart eller lagrer i dele 2-4 µL-80 ° c på lang sikt.

4. HSPC isolasjon og kultur

  1. Murine HSPCs isolasjon og kultur
    Merk: Mannlige og kvinnelige Ubc-GFP mus (JAX004353) og Rosa26-LSL-tdTomato (JAX007914) krysset med Vav-iCre (JAX008610) på 2-6 måneders alder ble brukt til å få tak i resultatene nedenfor.
    1. Euthanize bedøvet musene gjennom livmorhalsen forvridning.
      Merk: To trente personer skal bekrefte vellykket euthanasia ved å merke mangelen åndedrett og hjerteslag i minst 5 min. Fjern skinnet fra dyrene.
    2. Analysere tibias, femurs og iliaca toppene av mus og fjerne alle muskler og bindevev rundt dissekert bein. Plasser intakt bein i en vev kultur parabol på is med HBSS med 2% FBS (HBSS +). Flytte til laminær strømning hette snarest al bein er rengjort og overført til vev kultur parabolen.
    3. Overføre renset bein til sterilt mørtel, inneholder 2 mL iskalde HBSS + per 3 bein. Bruker pistil, knuse bein i beinfragmenter, slippe marg fra innenfor. Fortsett pestling til bein stopper sprengning under pistil.
    4. Samle nedbryting fra mørtel og filteret i en 50-mL konisk rør med en 40 µm celle sil. Skyll de gjenværende bein fragmentene med 5 mL iskalde HBSS + og filter i samme 50 mL konisk rør med samme 40 µm silen.
    5. Vask cellene to ganger av topping av røret med iskald HBSS + og sentrifugering 400 x g for 7 min. Forkast nedbryting.
    6. Etter andre vask resuspend celle pellet i 20 mL av is kaldt PBS. Telle levedyktige cellers trypan-blå utelukkelse9.
    7. Inkuber 1 x 108 levedyktig celler per 1 mL iskalde HBSS + med biotin-konjugerte c-kit antistoff på 1: 100 fortynning for 45 min på is.
    8. Vask cellene med iskald HBSS + sentrifugering 400 x g i 7 min og forkaster nedbryting.
    9. Inkuber cellene med anti-biotin magnetiske perler følge instruksjonene fra produsenten.
    10. Isolere c-kit positive celler ved hjelp av magnetiske kolonner eller magnetisk-aktivert celle sorters følge instruksjonene fra produsenten. Samle c-kit positive celler i 15 mL konisk rør.
    11. Vask cellene to ganger med PBS av topping av 15-mL konisk røret og sentrifugering 400 x g for 7 min. forkaste nedbryting. Mellom de to vasker beregne antall levedyktige cellers ved trypan blå utelukkelse9.
    12. Resuspend c-kit + celler i en konsentrasjon av opptil 106 viablecells per 100 µL av kultur medium for murine HSPCs med 2% FBS, 50 ng/mL mus stamceller faktor (SCF), 50 ng/mL musen thrombopoietin (TPO), 10 ng/mL musen IL-3 og 10 ng/mL musen IL-6.
    13. Inkuber cellene på 37 ° C, 5% CO2 minst 1t opptil 24 timer før electroporation.
  2. Menneskelige HSPCs isolasjon og kultur
    Merk: Disse trinnene må utføres i laminær strømning hette.
    1. Filtrere benmarg/ledningen blodceller gjennom en 40 µm celle sil.
    2. Fortynne 1:2 filtrerte benmarg/ledningen blod celler med PBS med 1 mM EDTA (PBS/EDTA).
    3. Dispensere 15 mL av tetthet gradert medium i en 50-mL konisk rør. Forsiktig helle 30 mL utvannet benmarg/ledningen blod på tetthet gradert middels overflaten. Hvis volumet av cellen suspensjon er større enn 30 mL forberede flere rør.
      Merk: Sørg for å holde grensesnittet mellom blod og tetthet gradert mediet så skarp som mulig.
    4. Spinne rørene på 750 x g i 30 min med ingen retardasjon.
    5. Samle mononukleære celle laget synlig på mediet grensesnittet og overføre til en ren 50 mL konisk tube. Fylle opp røret med PBS/EDTA og spinne cellene på 280 g i 15 min. Forkast nedbryting.
    6. Vask cellene to ganger i PBS/EDTA spinning på 400 x g i 7 min og forkaster nedbryting.
    7. Inkuber mononukleære celler med anti-CD34 magnetiske perler følge instruksjonene fra produsenten.
    8. Isolere CD34 + celler ved hjelp av magnetiske kolonner eller magnetisk-aktivert celle sorters følge instruksjonene fra produsenten. Samle CD34 + celler i 15 mL konisk rør.
    9. Vask samlet CD34 + celler to ganger av topping av røret med PBS og spinning på 400 x g i 7 min og forkaster nedbryting. Mellom de to vasker beregne antall levedyktige cellers ved trypan blå utelukkelse9.
    10. Resuspend cellene i kultur medium med 100 ng/mL menneskelige SCF, 100 ng/mL menneskelige FLT3 ligand (FLT3L), 100 ng/mL menneskelige TPO i en konsentrasjon av ~2.5 x 105 levedyktige cellers / ml. kultur isolert CD34 + celler ved 37 ° C, 5% CO2 24 h til et maksimalt 48 timer før til electroporation.
      Merk: Sjekk renhet av beriket CD34 + befolkning av flowcytometri før electroporation.

5. Electroporation

Merk: Følgende protokollen er optimalisert for 10 µL electroporation tips. Alle trinnene bør utføres i laminær strømning hette.

  1. Telle celler trypan blå utelukkelse9. Samle 2 x 105 levedyktig celler per replikere (f.eks samle 6 x 105 celler for 3 electroporations).
  2. Vask celler to ganger med PBS, spinning på 300 x g i 7 min og nøye fjerne nedbryting.
  3. Parallelt, forberede Cas9-sgRNA RNP komplekser av incubating inne PCR rør for 20-30 minutter til RT 1.5 µg Cas9 med 1 µg av totale sgRNA for hver replikere, bortsett fra den Cas9 eneste kontrollen.
    Merk: Cas9 protein tilbys på 10 µg/µl konsentrasjon. For å sikre nøyaktig pipettering, fortynnes 1:10 den totale mengden Cas9 protein trengs med nuclease-fritt vann (f.eks for 10 electroporations ta 1 µl Cas9 protein og fortynn den med 9 µl nuclease uten vann og ruge 1 µl av fortynnet Cas9 per replikere. Avhengig av konsentrasjonen av sgRNA, skal det totale volumet av Cas9 og sgRNA bestå mellom 1,7 og 2 µl per replikere. Hvis bruker to sgRNAs ruge 500 ng av hver sgRNA per replikere; Hvis bruker 3 sgRNAs ruge 330 ng av hver sgRNA per replikere og så videre.
  4. Beregne det totale volumet av rørets Buffer T nødvendig ved å multiplisere 10 µL av totalt antall gjentak nødvendig (f.eks 30 µL for 3 gjentak). Resuspend pelleted celler med den beregnede mengden Buffer T. Kontroller at siste konsentrasjonen av cellen suspensjon er 2 x 107 celler/mL.
  5. Aliquot 10 µL av resuspended celler/kopiere inn hver PCR røret med den pre-kompleksbundet sgRNA/Cas9 RNP (f.eks. for en tre eksemplarer aliquot 30 μL celle suspensjon i et PCR rør som inneholder pre-kompleksbundet Cas9-sgRNA).
  6. Definere electroporation systemet slå på apparatet og legge 3 mL buffer E i en electroporation cuvette, og skyv cuvette inn cuvette abonnenten.
  7. Angi de ønskede electroporation betingelsene for enheten: menneskelig HSPCs (1600 V, 10 ms, 3 pulser) eller mus HSPCs (1700 V, 20 ms og 1 puls).
    Merk: Hvis ønskelig, før du utfører eksperimenter på CD34 + HSPCs, sgRNA effektivitet kan testes på akutt myelogen leukemi (AML) linjer (f.eks HL60) med samme strategi (bruk antibiotika-fri medium for AML cellelinjer) med følgende electroporation: Buffer R 1350 V, 35 ms, 1 puls.
  8. Electroporation utføres med en spesiell electroporation pipette, som har en klo som låsene på electroporation pipette spissen. Hold electroporation pipette, utvide claw, ta disketten innenfor pipette spissen og deretter trykk bestemt Pipetter til sikker spissen.
  9. Pipetter prøven opp og ned 10 ganger å blande. Ta ut 10 µL, gjør at det ikke er noen bobler, og stikk pipette direkte inn i elektrolytisk buffer i electroporation cuvette. Prøv ikke å røre veggene i cuvette. Trykk "start" på skjermen. Etter "komplett" meldingen vises, Fjern pipette, og dispensere innholdet i godt med nytt HSPC kultur medium.
  10. Gjenta for alle prøvene. Endre pipette tips mellom prøvene, bare hvis det er nødvendig.

Representative Results

Målet med denne protokollen er å utføre genet knockout (KO) i musen og menneskelige HSPCs ved hjelp av Cas9-sgRNA RNPs. Arbeidsflyten er enkel og rask og tillater gjennomføring av eksperimenter i mindre enn en uke fra experimental design til vurdering av KO effektivitet.

Sammenlignet med plasmider - eller virus-baserte tilnærminger, bygger suksessen til våre protokollen på kombinasjonen av sgRNA RNPs og electroporation. Denne kloning-fri strategien betydelig redusere tiden det tar å få komponentene transfect. Videre electroporation tillater transfection på opptil 95% av celler, maksimere levering av RNPs. sgRNAs kan være synthetized i laboratoriet gjennom i vitro transkripsjon (PES), mens renset Cas9 protein kan kjøpes fra flere selskaper ( se protokollen). sgRNA DNA maler for IVT hentes utfører en kort PCR bruker sgRNA Fwd primer (figur 1A, B) og universal stillas Rev primer (figur 1B - se protokoll). PCR produktet brukes deretter som en mal for IVT (figur 1 c). Cas9-sgRNA RNP komplekser genereres rugende i 15-30 minutter i sgRNAs og Cas9 (figur 1 c). Endelig er sgRNA RNPs electroporated i celler. Redigerte HSPCs kan deretter brukes til å utføre både i vitro og vivo eksperimenter.

Gene avbrudd i musen celler

Å vise effekten av den Cas9-sgRNA RNP electroporation strategien, c-kit + HSPCs isolert fra mus overalt uttrykke GFP eller tdTomato har vært electroporated med sgRNA mot GFP eller tdTomato. Blant de tre sgRNA konstruert mot GFP, GFP sg1 utført mest effektivt, viser ca 70-75% avbrudd GFP uttrykk som bestemmes av flowcytometri (figur 2A, B). T7 endonuclease-basert (T7EI) analysen ble utført for å kvantifisere genet avbrudd frekvensen på genomisk nivå, genomisk DNA fra electroporated cellene var isolert. Som vist i figur 2C, oppdaget T7EI analysen opp 60% indel-formasjonen. Merk at T7EI analyser pleier å undervurdere frekvenser av indeler. Vi har også genereres sgRNA mot tdTomato og electroporated HSPCs uttrykke tdTomato fra Rosa26 locus. Som vist i figur 2D, ablated tdTomato sg1 effektivt uttrykk for tdTomato.

Gene avbrudd i menneskelige celler

Effektiv avbrudd med en enkelt sgRNA tilnærming målretting CD45, en celle overflaten markør på blodkreft celler, vises her. Tre sgRNAs målretting ulike exons av CD45 var designet (CD45 sg1, sg2 og sg3). Effektiviteten av sgRNAs ble testet i HL60 AML cellen linje (figur 3A). Protein KO ble vurdert av flowcytometri 5 dager etter electroporation. CD45 sg1 var den mest effektive (98% KO effektiviteten - figur 3A) og ble brukt for videre studier. Figur 3B viser CD45 KO i primære menneskelige CD34 + stamfar celler med CD45 sg1, vurdert av flowcytometri 5 dager etter electroporation. Mens CD34 uttrykk var upåvirket, var CD45 uttrykk tapt i ca 80% av cellene. 200.000 redigerte primære CD34 + celler ble retro-orbitally transplantert inn NSG mus 6 timer etter electroporation. Benmargen og milten celler ble høstet 3 måneder etter transplantasjon. Redigerte celler (HLA-ABC positive, CD45 negativ, uthevet i rødt) er synlig i sgRNA behandlet prøver og ikke Cas9 bare kontroller (Figur 3 c).

Eventuelt to sgRNAs målretting i nærheten sekvenser kan brukes til å generere slettinger. Denne tilnærmingen gir en rask anslå redigering effektiviteten med en PCR og ofte produserer høyere avbrudd effektivitet. Figur 3D viser effektiv generering av 58 bp sletting i ekson 10 av DNMT3A. 200.000 redigerte CD34 + celler ble transplantert inn NSG mus 6 timer etter electroporation. 58 bp slettingen var tydelig oppdaget i perifert blod engrafted NSG mus 5 måneder etter injeksjoner (figur 3E) bekrefter redigering av CD34 + celler med langsiktige engraftment evner.

Figure 1
Figur 1: rask og enkel tilnærming til å generere sgRNA RNPs. A) representasjon av sgRNA Fwd primer. SgRNA Fwd primer er en DNA oligonucleotide som inneholder T7 arrangøren, protospacer sekvensen og en overlapping sekvens med sgRNA stillaset. På 3' er slutten, uthevet i rødt, "ATAGC" sekvensen som skal legges til sgRNA Fwd primer sekvensen innhentet på CRISPRscan. B) skjematisk fremstilling av overlappingen PCR utført for å få malen IVT. Overlappingen mellom sgRNA Fwd primer og Universal stillaset Rev primer gir filtypen og forsterkning av PCR. C) tegneserie som beskriver IVT reaksjonen og sgRNA RNP pre-complexing. PCR produktet er renset og brukes som en mal for IVT. IVT genererer en stor mengde sgRNAs som kan brukes i flere replikat (se protokollen). sgRNA RNPs genereres rugende sgRNA renset fra IVT og tidligere kjøpt Cas9 protein. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: effektiv genet avbrudd i musen blodkreft stamfar celler. A) en sgRNA rettet mot GFP (GFP sg1) sammen med Cas9 protein var electroporated i murine c-kit + HSPCs uttrykke GFP og analysert av flowcytometri 24 timer etter electroporation. B) forskjellige mengden GFP sg1 var kompleksbundet med 1 µg av Cas9 protein og electroporated. Så lite som 200 ng av GFP sg1 effektivt ablated GFP uttrykk. C) T7EI analysen utført på genomisk DNA isolert fra celler brukes i AB. PCR amplicon som spenner over Cas9-sgRNA cleavage området ble utvannet 1:4 i 1 x Buffer 2 og hybridisert langsomt i en termisk cycler. Hybridisert fragmenter ble deretter fordøyd med 1,25 U T7 endonuclease jeg i 10 minutter på 37 ° C. Fordøyd fragmenter ble skilt av polyakrylamid gel geleelektroforese. Bandet intensiteter ble analysert bruker ImageJ programvare ved å plotte bandet intensiteter på hver fil. % cleavage ble beregnet av forholdet mellom intensiteten av de cleaved bandene uncleaved band. D) c-kit + HSPCs isolert fra mus uttrykke tdTomato var electroporated med Cas9 protein kompleksbundet med sgRNA mot tdTomato. Flowcytometri utført 24 timer etter electroporation avslørt at ca 74% av celler slettet tdTomato. R26 = Rosa26. * p < 0,05, ** p < 0,01, *** p < 0,001. Dette tallet er tilpasset fra Gundry et al. 6 Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: effektiv genet avbrudd i menneskelig blodkreft cellene. A) tre sgRNAs målretting CD45 (CD45 sg1, sg2 og sg3) ble utviklet og testet i HL60 AML celle linjen (se protokollen for electroporation forhold). Flowcytometri ble utført 5 dager etter electroporation. CD45 sg1 ble valgt som den mest effektive blant de tre sgRNAs (KO effektivitet 98%). B) CD45 KO i primære menneskelige ledningen blod CD34 + HSPCs bruker CD45 sg1. CD45 tap kan oppdages i omtrent 80% av cellene. Note det CD34 uttrykket er uendret etter redigering. C) redigert menneskelige HSPCs kan være effektivt engrafted til NSG mus. Menneskelige kjerne celler vises i normal HLA / CD45 + fenotypen i bare Cas9-engrafted mus, mens i mus engrafted med CD45-sg1 behandlet CD34 + celler, begge HLA / CD45 + og HLA / CD45 bestander er observert som viser engraftment av menneskelige CD45 KO celler. D) 2% agarose gel viser 58 bp slettingen generert av 2 sgRNAs (to guide tilnærming) i ekson 10 av DNMT3A i menneskelig HSPCs fra 3 forskjellige ledningen blod (CB1 CB2 og CB3). PCR ble utført 3 dager etter electroporation. E) 2% agarose gel demonstrere for 58 bp slettingen 5 måneder etter transplantasjon i NSG mus. Dette tallet er tilpasset fra Gundry et al. 6 Klikk her for å se en større versjon av dette tallet.

Oligonucleotide Sekvens Merk
Universell Rev stillaset primer gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgct Universell omvendt grunning for overlapper PCR
hCD45 sgRNA 1 taatacgactcactataGGTGCTGGTGTTGGGCGCACgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR
hCD45 sgRNA 2 taatacgactcactataGGGAGCAAGTGAGGATCCTCgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR
hCD45 sgRNA 3 taatacgactcactataGGGATGCTTGTTCCCTTCAGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR
hDNMT3A Ex10 sg1 taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR
hDNMT3A Ex10 sg2 taatacgactcactataGGGTGGCCAGCAGCCGCGCGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR
Rosa26 sgRNA taatacgactcactataGGACACTGCCAAGGCCGTGGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR
GFP sg1 taatacgactcactataGGGCGAGGAGCTGTTCACCGgttttagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR
tdTomato sg1 taatacgactcactataGGGGTACAGGCGCTCGGTGGgtttaagagctagaaatagc sgRNA Fwd primer sekvens for overlapping PCR

Tabell 1: Fullføre sekvenser av sgRNA Fwd primere brukes i eksperimenter og Universal Rev primer.

Discussion

RNP-tilnærming som er beskrevet i denne detaljert protokollen kan effektiv genet knockout i både mus og primære blodkreft menneskeceller så vel som i suspensjon linjer. Selv om svært høy KO effektivitet er ofte oppnådd, må flere viktige variabler vurderes. Først riktig ekson valg er nøkkelen garantere at effektiv indel innlemmelse tilsvarer genet knockout. To viktige faktorer knyttet til ekson valg er bevaring over isoformene og ekson posisjon innenfor transkripsjoner. Isoformen uttrykk mønstre er variable over celletyper, så hvis genet KO over celletyper, exons som er konstant mellom cellen typer bør rettes. Isoformen mønstre kan verifiseres ved hjelp av q PCR eller RNA-sekvensering data. Ekson posisjon i transkripsjoner, er det best å målrette tidlig exons som frameshift mutasjoner i terminalen eller nest siste ekson kan unnslippe nonsense formidlet decay10, produserer proteiner med roman eller ukjente funksjoner i stedet for sann nullverdier.

Bestemme indel er frekvensen en avgjørende skritt å anslå KO effektiviteten og å tolke riktig biologiske resultatet av eksperimentet. Endonucleases analyser (f.eks landmåler analysen) har fordelen av å være relativt rask og lett å utføre. Men de pleier å være unøyaktig på grunn av betydelig bakgrunn signaler og resultatene er ofte vanskelig å gjengi. Dessuten, de ikke gir informasjon om kvaliteten på indeler generert (f.eks lengden på innsettinger og slettinger) i eksperimentet. Sanger sekvensering er et nyttig alternativ til endonuclease analyser. Plattformer som TIDEVANNET11 (https://tide.nki.nl/) hjelpe bryte ned sanger spor og produsere nøyaktig anslag allel avbrudd effektivitet, samtidig gir frekvenser av personlige indeler. Den store ulempen er en absolutt avhengighet av høy kvalitet Sanger sekvensering spor. Høy gjennomstrømming amplicon sekvensering overvinner disse problemstillingene. Amplicon biblioteker kan tilberedes med svært lav DNA innganger og den høye dekningen sikrer pålitelige resultater. For å redusere kostnadene ved amplicon sekvensering, spiker vi vanligvis i amplicon biblioteker i større sekvensering kjører (f.eks RNA-sekvensering) med bare 1-1,5% av den totale lest. Til slutt, for å bekrefte vellykket knockout, vi sterkt anbefale vurdere protein nivå av vestlige blots eller flow cytometri, når det er mulig.

Som beskrevet tidligere, metoden som presenteres her er rask og enkel og representerer et nytt verktøy for å studere genet slå ut i musen og menneskelige HSPCs. Mens våre protokollen gir instruksjoner for genet knockout med en tips-baserte electroporation, har andre systemer vist seg for å være svært effektiv12,13.

To store begrensninger må anerkjennes når det gjelder RNP tilnærming. Først som beskrevet av vår gruppe, levedyktigheten til HSPCs electroporated med in vitro transkribert sgRNAs kan bli betydelig svekket av electroporation, særlig når forholdene ikke er optimale6. Hvis nødvendig, kan kommersielt syntetisk sgRNAs (dvs. eliminere i vitro transkripsjon) overvinne dette problemet. Disse blir billigere med tiden og kan kjøpes fra flere leverandører. I dette scenariet i vitro transkripsjon kan brukes til å generere en pool av sgRNA til skjermen for effekt, og den mest effektive sgRNA(s) kan velges for syntese. Andre store begrensning av RNP tilnærming er manglende evne til å spore vellykket transfekterte celler, som viral tilnærminger. Men kan høy KO effektivitet og rask redigering med Cas9-sgRNA RNPs oppveie disse ulempene i mange eksperimentelle scenarier. Vi anbefaler å bruke høy gjennomstrømming amplicon sekvensering å nøyaktig bestemme avbrudd effektiviteten i hvert eksperiment. Hvis knock-out av genet av interesse er forventet å tildele en proliferativ fenotypen (dvs. en redusert eller økt spredning sammenlignet med vill-type celler), bestemme indel frekvensen på flere tidspunkt tillater en å vurdere om KO celler gjennomgå berikelse (dvs. indel frekvens øker over tid) eller er outcompeted (dvs. indel frekvens reduseres over tid).

Utfører i vivo eller i vitro eksperimenter for å forstå de biologiske virkningene av tap av gen funksjon krever riktige kontroller. Som tidligere nevnt, i vitro transkribert sgRNAs kan være giftig for celler, spesielt primære stamfar celler6. I tillegg kan DNA dobbel-strand bryter forårsaket av Cas9 protein forårsake genet uavhengige anti-proliferativ svar14. Derfor vi ofte bruker en rekke kontroll sgRNAs CRISPR eksperimenter og anbefaler en celle overflaten markør på din celle type som et andre mål gen som ikke er uttrykt.

Kortsiktige kultur for menneskelig HSPCs i nærvær av cytokiner øker genet avbrudd effektivitet6 og er nødvendig for å oppnå høy virkningsgrad KO. Vi har funnet 36-48 timer å være den ideelle perioden kultur før electroporation-6. Etter electroporation, cellene kan være mer kultivert holde i tankene at jo lenger kulturen jo høyere risiko for å miste multilineage engraftment kapasitet. Derfor utføre vi vanligvis transplantasjoner 6 timer etter electroporation og aldri senere enn 24 timer etter electroporation.

CRISPR/Cas9 har forbedret evne til forskere for å kunne redigere genomet av pattedyrceller. Gjør genet avbrudd mer gjennomførbart i primære blodkreft stamfar celler er spådd å raskt forbedre vitenskapelig kunnskap innen HSPCs og hematologic sykdommer. Viktigere, gjør protokollen beskrevet her det også mulig samtidig generere flere fortrenging med høy effektivitet, tillater modellering av komplekse genetiske landskap, ofte sett i leukemic sykdommer.

Selv om protokollene beskrevet her er fokusert på genet avbrudd, kan de lett tilpasses for genet banke i eksperimenter. Dette kan gjøres via co levering av enkelt-strandet oligonucleotide maler for homologi-rettet reparasjon6,13 (HDR) eller Albin på celler innlegg-electroporation med AAV6 vektorer som inneholder den homologi mal12. Evnen til å reparere eller introdusere spesifikke mutasjoner i genet HSPCs vil lette nye strategier for genterapi og utvidet studiet av kreft driveren mutasjoner i AML og andre hematologic sykdommer. Mens HDR i menneskelig HSPCs har vært vellykket6,12,13, mus HSPCs vært vanskelig å redigere bruker denne strategien6. Optimalisering av HDR protokoller menneskelig og spesielt musen HSPCs vil muliggjøre mer redigering og utvikling av verktøy for å spore redigerte celler ved hjelp av endogene merking.

Til slutt, det er også tenkt at forstyrrelse av mutant gevinst-av-funksjon alleler kan representere en potensiell terapeutisk tilnærming til medfødt og ervervet blodkreft lidelser. I dette scenariet anbefales en DNA-fri tilnærming for å unngå mulig integrasjoner som kan fremme transformasjon. Videre reduserer "hit og løpe" tilnærmingen muligheten for uønsket off-målet virkninger. Mer innsats er nødvendig for å utvikle bestemte leveringssystemer som åpner nye muligheter for behandling av ondsinnethet og ikke-ondartet hematologic sykdommer.

Disclosures

Noen interessekonflikt avsløre

Acknowledgments

Dette arbeidet ble støttet av kreftforebygging og forskning Institutt for Texas (RP160283, RP140001 og R1201), Gabrielle Angel Foundation for kreftforskning, Edward P. Evans grunnlaget og NIH (DK092883, CA183252, CA125123, P50CA126752, CA193235, og DK107413). M.C.G. støttes av Baylor forskning talsmenn for Student forskere. Flowcytometri ble delvis støttet av NIH (National Center for forskning tilskudd S10RR024574, National Institute of Allergy og smittsomme sykdommer AI036211, og National Cancer Institute P30CA125123) for Baylor College of Medicine Cytometri og sortering Core-cellen.

Materials

Name Company Catalog Number Comments
Tissue culture plates according to cell numbers
1.5 ml Eppendorf microtubes Sigma Z606340-1000EA
50ml Falcon tubes Corning 352070
Nuclease Free Water - DEPC treated ThermoFisher Scientific AM9915G
KAPA HiFi HotStart ReadyMix (2X) KAPA Biosystems KK2600
MinElute PCR purification Kit Qiagen 28004
RNAse Zap RNAse Decontamination Solution ThermoFisher Scientific AM9780
RNA Clean and Concentrator-25 Zymo R1017
HiScribe T7 High Yield RNA Synthesis Kit New England Biolabs E2040S
Alt-R S.p. Cas9 Nuclease 3NLS, 100 µg IDT 1074181
40 mm Cell Strainers VWR 352340
Dulbecco's Phosphate Buffered Saline (PBS) GenDEPOT CA008-050
Fetal Bovine Serum (FBS), Regular Corning 35010CV
AutoMACS Pro Separator or MACS manual Cell Separation columns Miltenyi
Neon Transfection System Device ThermoFisher Scientific
Neon Transfection System 10mL kit ThermoFisher Scientific MPK1025 For larger numbers of cells (see protocol) Neon Transfection System 100 mL kit (# MPK10025) can be used
Name Company Catalog Number Comments
UltraPure 0.5M EDTA, pH 8.0 ThermoFisher Scientific 15575020 For human experiments only
Lymphoprep Stem Cell Technologies 7851 For human experiments only
CD34 MicroBead Kit UltraPure human Miltenyi Biotec 130-100-453 For human experiments only
Stem Span SFEM II Stem Cell Technologies 9605 For human experiments only
Recombinant Human SCF Miltenyi Biotec 130-096-695 For human experiments only
Recombinant Human TPO Miltenyi Biotec 130-094-013 For human experiments only
Recombinant Human FLT3L Miltenyi Biotec 130-096-479 For human experiments only
Name Company Catalog Number Comments
Mouse dissection tools For mouse experiments only
Mortar and Pestle For mouse experiments only
Hank's Balanced Salt Solution (HBSS) Gibco 14170112 For mouse experiments only
Biotin-conjugated anti c-kit antibody eBioscience 13-1171-82 For mouse experiments only
Anti-Biotin MicroBeads Miltenyi Biotec 130-090-485 For mouse experiments only
X VIVO-15, with L-Glutamine, Genatmycin and Phenol Red Lonza 04-418Q For mouse experiments only
Mouse IL-6 Peprotech 216-16 For mouse experiments only
Mouse TPO Peprotech 315-14 For mouse experiments only
Mouse IL-3 Peprotech 213-13 For mouse experiments only
Mouse SCF Peprotech 250-03 For mouse experiments only

DOWNLOAD MATERIALS LIST

References

  1. Jinek, M., et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, 816-821 (2012).
  2. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, 1262-1278 (2014).
  3. Sternberg, S. H., Doudna, J. A. Expanding the Biologist's Toolkit with CRISPR-Cas9. Mol Cell. 58, 568-574 (2015).
  4. Heckl, D., et al. Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Nat Biotechnol. 32, 941-946 (2014).
  5. Mandal, P. K., et al. Efficient ablation of genes in human hematopoietic stem and effector cells using CRISPR/Cas9. Cell stem cell. 15, 643-652 (2014).
  6. Gundry, M. C., et al. Highly Efficient Genome Editing of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. Cell Rep. 17, 1453-1461 (2016).
  7. Kim, S., Kim, D., Cho, S. W., Kim, J., Kim, J. S. Highly efficient RNA-guided genome editing in human cells via delivery of purified Cas9 ribonucleoproteins. Genome Res. 24, 1012-1019 (2014).
  8. Moreno-Mateos, M. A., et al. CRISPRscan: designing highly efficient sgRNAs for CRISPR-Cas9 targeting in vivo. Nature methods. 12, 982-988 (2015).
  9. Strober, W. Trypan Blue Exclusion Test of Cell Viability. Current protocols in immunology. 111, A3 B 1-3 (2015).
  10. Lykke-Andersen, S., Jensen, T. H. Nonsense-mediated mRNA decay: an intricate machinery that shapes transcriptomes. Nat Rev Mol Cell Biol. 16, 665-677 (2015).
  11. Brinkman, E. K., Chen, T., Amendola, M., van Steensel, B. Easy quantitative assessment of genome editing by sequence trace decomposition. Nucleic Acids Res. 42, e168 (2014).
  12. Dever, D. P., et al. CRISPR/Cas9 beta-globin gene targeting in human haematopoietic stem cells. Nature. 539, 384-389 (2016).
  13. DeWitt, M. A., et al. Selection-free genome editing of the sickle mutation in human adult hematopoietic stem/progenitor cells. Sci Transl Med. 8, 360ra134 (2016).
  14. Aguirre, A. J., et al. Genomic Copy Number Dictates a Gene-Independent Cell Response to CRISPR/Cas9 Targeting. Cancer Discov. 6, 914-929 (2016).
Svært effektiv Gene avbrudd i Murine og menneskelig blodkreft stamfar celler av CRISPR/Cas9
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).More

Brunetti, L., Gundry, M. C., Kitano, A., Nakada, D., Goodell, M. A. Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9. J. Vis. Exp. (134), e57278, doi:10.3791/57278 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter