Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

مروج التقاط مرحبا c: عالية الاستبانة، وعلى نطاق الجينوم التنميط التفاعلات المروج

doi: 10.3791/57320 Published: June 28, 2018
* These authors contributed equally

Summary

العناصر التنظيمية الحمض النووي، مثل القدرة على، التحكم في التعبير الجيني عن طريق الاتصال فعلياً بمروجي الجينات المستهدفة، غالباً من خلال التفاعلات صبغية طويلة المدى تمتد مسافات كبيرة الجينوم. مروج التقاط مرحبا-ج (شارتر-ج) يعرف التفاعلات الهامة بين المروجين والمناطق البعيدة، وتمكين تعيين تسلسل التنظيمية المحتملة للجينات المستهدفة.

Abstract

منظمة ثلاثية الأبعاد للجينوم مرتبط بوظيفتها. على سبيل المثال، التحكم العناصر التنظيمية مثل القدرة على النسخي الزمانية التعبير عن الجينات المستهدفة من خلال الاتصال الجسدي، غالباً ما سد مسافات كبيرة (في بعض الحالات مئات من كيلوبس) الجينوم وتجاوز الجينات القريبة. الجينوم البشري المرافئ القدرة على 1 مليون المقدرة، الغالبية العظمى منها يكون معروف الأهداف الجينات. ومن ثم تعيين المناطق التنظيمية البعيدة للجينات المستهدفة أمر حاسم لفهم التحكم التعبير الجيني. قمنا بتطوير المروج التقاط مرحبا-ج (شارتر-ج) لتمكين الكشف عن الجينوم على نطاق المنظومة لمناطق التفاعل المروج البعيدة (المتحقق)، لكل من المروجين في تجربة واحدة. في شارتر-ج، هي على وجه التحديد أثري مكتبات C مرحبا معقدة للغاية لتسلسل منظم من خلال اختيار الهجين في الحل مع آلاف الطعم بيوتينيلاتيد الحمض النووي الريبي مكملة لينتهي من كافة الأجزاء المحتوية على مروج تقييد. ويهدف إلى تسلسلات المروج ثم سحب لأسفل وشركائها التفاعل المتكرر مثل القدرة وغيرها من العناصر التنظيمية المحتملة. بعد الفائق إقران نهاية التسلسل، يتم تطبيق اختبار إحصائية لكل جزء متصلة المروج تقييد تحديد الكبير المتحقق على مستوى جزء التقييد. وقد استخدمنا شارتر-C لتوليد أطلس التفاعلات المروج البعيدة المدى في عشرات من الإنسان وأنواع الخلايا الماوس. أسهمت هذه الخرائط إينتيراكتومي المروج إلى فهم أكبر لمراقبة التعبير الجيني الثدييات بتعيين المناطق التنظيمية المفترضة للجينات المستهدفة والكشف عن شبكات التفاعل المروج المكانية التفضيلية-المروج. هذه المعلومات أيضا له أهمية عالية لفهم الأمراض الوراثية البشرية، وتحديد الجينات الأمراض المحتملة، عن طريق ربط غير الترميز المرتبطة بالمرض تسلسل المتغيرات في أو بالقرب من تسلسلات تحكم للجينات المستهدفة.

Introduction

تتراكم الأدلة تشير إلى أن منظمة ثلاثية الأبعاد للجينوم دوراً هاما فنية في مجموعة من العمليات النووية، بما في ذلك الجينات التنشيط1،2،3، القمع4 ،،من56،،من78، ممارسو9،10، إصلاح الحمض النووي11، الحمض النووي النسخ المتماثل12،13، و الشيخوخة الخلوية14. وتوجد معززات البعيدة القرب المكاني من المروجين أنها تنظم15،،من1617، هو أمر ضروري لتحكم تعبير الجينات الزمانية المناسبة. إظهار الحذف محسن أن معززات القاصي ضروريان للجينات المستهدفة النسخ19،18،20،21،22، و 'القسري حلقات الكروماتين' يوضح أن الربط هندسيا بين محسن وعلى مروج المستهدفة في محور سداسي البروم ثنائي الفينيل كاف لحملة التنشيط النسخي23. علاوة على ذلك، يمكن أن يؤدي الجينوم ترتيبات جديدة التي تجلب الجينات تحت سيطرة القدرة على حمل خارج الرحم في تنشيط الجينات غير مناسب ومرض24،،من2526. وتوضح هذه الأمثلة معا، أن التفاعلات المروج-محسن ضرورية للتحكم في الجينات وتتطلب تنظيم محكم لضمان التعبير الجيني المناسب. الإنسان ومورثات الماوس يقدر كل المرفأ القدرة على حوالي 1 مليون. للغالبية العظمى من هذه المنشطات، الجينات المستهدفة غير معروفة، وهي غير مفهومة 'قواعد الاشتباك' بين المروجين ومحسنات. تعيين القدرة على النسخي للجينات المستهدفة وبالتالي يظل تحديا كبيرا في فك رموز تحكم تعبير الجينات الثدييات.

كانت ثورة فهمنا للهندسة المعمارية ثلاثية الأبعاد الجينوم بإدخال ج 327 (التقاط تكيف كروموسوم) وعن المتغيرات28،29،،من3031 . أقوى من هذه التقنيات، مرحبا-ج (إنتاجية عالية كروموسوم تكيف التقاط) يهدف إلى تحديد فرقة كاملة من التفاعلات الكروموسومات داخل سكان خلية. المكتبات ج، عادة ما تولد من ملايين خلايا، ومعقدة للغاية مع منتجات ربط مستقل11 ما يقدر 10 بين شظايا ~ 4 كيلوبايت في المجين البشري32. كنتيجة لذلك، تحديد موثوق بها واستنساخه من التفاعلات بين تقييد الفردية وشظايا (مثل تلك التي تحتوي على مروج أو محسن) من البيانات مرحبا-ج لا مجديا إلا إذا مكتبات C مرحبا يتعرضون لتسلسل عميق جداً، هي ليست حلاً اقتصاديا لمختبرات إعداد مكتبات C مرحبا بشكل روتيني. للالتفاف على هذا القصور، قمنا بتطوير المروج التقاط مرحبا-ج لإثراء عملية ربط المنتجات المحتوية على مروج من مكتبات مرحبا-ج على وجه التحديد. ركزنا على المروجين لسببين. أولاً، أظهرت الاتصالات المروج-محسن أن تكون حاسمة بالنسبة لمستويات التعبير الجيني السليم في العديد من الدراسات (انظر المراجع أعلاه)، وثانيا، كما دعاة ثابتة إلى حد كبير بين أنواع الخلايا، يمكن استخدام نفس نظام التقاط الطعم باستجواب الدوائر التنظيمية عبر عدة أنواع الخلايا والظروف. لدينا نهج يعتمد على التهجين بالحل من مكتبات C مرحبا مع عشرات آلاف 120mers بيوتينيلاتيد الحمض النووي الريبي مكملة مرحبا-ج ربط المنتجات المحتوية على مروج والتقاط اللاحقة على الخرز المغناطيسي المغلفة ستريبتافيدين. هذه النتائج في مكتبات شارتر-ج مع تخفيض كثير التعقيد مكتبة مرحبا-C الأصلية، يركز فقط على تحديد الأجزاء التي هي متصلة للمروجين على ترددات عالية إلى حد كبير بالمقارنة.

وقد استخدمنا شارتر-ج في عدد من الإنسان وأنواع الخلايا الماوس للمساهمة في فهم أفضل لمراقبة التعبير الجيني بالكشف عن مناطق التفاعل المروج البعيدة المدى مع الوظيفة التنظيمية المفترضة، فضلا عن غير عشوائية المروج المروج جهات الاتصال في مساحة ثلاثية الأبعاد من النواة. الدراسات بتعيين مئات آلاف اتصالات المروج-محسن عبر عديدة الخلية أنواع33،34،35،36،،من3738، 39، حددت منظمة الجينوم المكانية "بوليكومب قمعية معقدة" بوساطة في الخلايا الجذعية الجنينية الماوس7، أظهرت الأسلاك على نطاق واسع للمروج إينتيراكتوميس خلال التمايز الخلوي37، 38 , 39، والمرتبطة غير الترميز المرتبطة بالمرض تسلسل المتغيرات للجينات المروجين35.

شارتر ج أسلوباً مثاليا لخريطة الفرقة على نطاق الجينوم تسلسل الحمض النووي التفاعل مع المروجين. النهج ذات الصلة، مثل التقاط مرحبا-ج مناطق الجينوم المستمر (انظر المناقشة) هي الأسلوب المفضل الحصول على ملفات ذات دقة عالية التفاعل لمناطق مختارة الجينوم. شارتر-C و C مرحبا التقاط متشابهة جداً تجريبية لوجهة (والفرق الوحيد هو اختيار نظام التقاط)، حيث أن المبادئ التوجيهية التي نقدمها ومشورة قابلة للتطبيق لكلا النهجين. هنا، فإننا نقدم وصفاً مفصلاً شارتر-C. نحن الخطوط العريضة للأساس المنطقي وتصميم تجربة شارتر-ج، يوفر بروتوكول جيل مكتبة شارتر-C خطوة بخطوة، وتوضح كيف يمكن رصد نوعية شارتر ج المكتبات في مختلف الخطوات في البروتوكول أن تسفر عن بيانات عالية الجودة.

Protocol

1-فورمالدهايد التثبيت

  1. خلية إعداد: ابدأ مع حد أدنى من 2 × 107 خلايا كل تجربة.
    1. للخلايا التي نمت في الثقافة، ريسوسبيند الخلايا في الثقافة المتوسطة. السابقين فيفو الخلايا، ريسوسبيند في 1 × تعديل النسر المتوسطة (دميم دولبيكو)، وتستكمل مع 10% (المجلد/المجلد) المصل البقري الجنين (FBS).
    2. للخلايا ملتصقة، إزالة الثقافة المتوسطة وإضافة مل 30.625 متوسطة جديدة مع 10% (المجلد/المجلد) FBS في درجة حرارة الغرفة (RT؛ 20-25 درجة مئوية).
    3. لتعليق الخلايا، جمع والطرد المركزي خلايا في 400 x ز و 20 درجة مئوية للحد الأدنى 3 إزالة المادة طافية وإعادة تعليق خلية بيليه في مل 30.625 في المتوسط بنسبة 10 في المائة (المجلد/المجلد) FBS في الرايت
    4. للأنسجة الصلبة، استخدم التربسين (0.05% إلى 2.5% النهائي التركيز، تبعاً لنوع الخلية) أو دونس المجانسة للحصول على تعليق خلية مفردة. وبعد هذه الخطوة الإضافية، يعامل الخلايا مثل خلايا تعليق.
  2. إضافة مل 4.375 من 16% خالية من الميثانول بارافورمالدهيد (امبول مفتوحة فقط قبل الاستخدام) بتركيز نهائي 2% (المجلد/المجلد). إصلاح 10 دقيقة في الرايت مع خلط لطيف على الروك.
    تنبيه: بارافورمالدهيد مادة كيميائية خطرة. اتباع الأنظمة الصحية والسلامة المناسبة.
  3. آرو الرد بإضافة 5 مل جليكاين المثلج م 1-طازج. المزيج لمدة 5 دقائق مع هزاز لطيف في RT، واحتضان ثم على الجليد لمدة 15 دقيقة مع عكس عرضية.
  4. أغسل وجمع الخلايا الثابتة.
    1. للخلايا ملتصقة، إزالة المادة طافية، أضف 10 مل 1 المثلج × برنامج تلفزيوني الأس الهيدروجيني 7.4 على لوحة الجدار وإزالته. أضف 1 مل من المثلج 1 × برنامج تلفزيوني الأس الهيدروجيني 7.4، جمع الخلايا باستخدام مكشطة الخلية ونقل في أنبوب 50 مل. كرر مرتين لجمع الخلايا أكبر عدد ممكن. إضافة برنامج تلفزيوني المثلج إلى الحجم النهائي 50 مل.
    2. لتعليق الخلايا، خلايا أجهزة الطرد المركزي في غ 760 x و 4 درجة مئوية لمدة 5 دقائق، إزالة المادة طافية، وإعادة تعليق خلية بيليه في 50 مل من المثلج PBS الأس الهيدروجيني 7.4.
  5. الطرد المركزي خلايا في 400 x ز و 4 درجة مئوية لمدة 10 دقائق وإزالة المادة طافية بعناية. يمكن أن يكون بيليه الخلية الإضافية المجمدة في النتروجين السائل وتخزينها في وقت لاحق في-80 درجة مئوية لعدة أشهر.

2. تحلل الخلية

  1. إعادة تعليق خلية بيليه في 50 مل من المخزن المؤقت لتحلل المثلج-طازج (10 ملم تريس-HCl pH 8، 0.2% (المجلد/المجلد) CA إيجيبال-630، 10 مم كلوريد الصوديوم، ومثبطات البروتياز قرص واحد كوكتيل) وخلط. احتضان على الجليد لمدة 30 دقيقة، ويخلط أحياناً بالعكس. الطرد المركزي الأنوية في 760 x ز و 4 درجة مئوية لمدة 5 دقائق وإزالة المادة طافية.

3- هينديي الهضم

  1. أغسل نواة الخلية مع المخزن المؤقت لتقييد x 1.25 2. إعادة تعليق خلية بيليه في 1 مل من المخزن المؤقت لتقييد المثلج 1.25 x 2، ونقل في أنبوب 1.5 مل. تدور الأنوية في 760 x ز و 4 درجة مئوية لمدة 5 دقائق وإزالة المادة طافية.
  2. إعادة تعليق خلية بيليه في عام 1790 ميليلتر من 1.25 المخزن المؤقت لتقييد x 2. إجراء 5 مختبرين، كل منها يحتوي على خلايا 5 مليون في 358 ميليلتر من 1.25 × تقييد المخزن المؤقت 2.
  3. إضافة ميليلتر 11 10% (wt/المجلد) الحزب الديمقراطي الصربي في قاسمة ويهز في 950 ثورات لكل دقيقة (لفة في الدقيقة) لمدة 30 دقيقة عند 37 درجة مئوية في ثيرموميكسير. في حالة ظهور كتل الخلية، ننأى بها بيبيتينج، تجنب الفقاعات.
  4. إضافة ميليلتر 75% 10 X-100 تريتون (المجلد/المجلد) الواحدة وقاسمه ويهز في 950 لفة في الدقيقة و 37 درجة مئوية لمدة 15 دقيقة في ثيرموميكسير. في حالة ظهور كتل الخلية، ننأى بها بيبيتينج، تجنب الفقاعات.
  5. إضافة ميليلتر 12 من 100 يو/ميليلتر هينديي 100 (1 200 وحدة في المجموع) الواحدة وقاسمه واحتضان في 37 درجة مئوية بين عشية وضحاها (O/N) بينما تهز 950 لفة في الدقيقة في ثيرموميكسير.
    1. لمراقبة الهضم، نقل 25 ميكروليتر من عينة (5 ميليلتر من كل قاسمة) في أنبوب جديد قبل إضافة الإنزيم (التحكم بعسر الهضم) وكرر نفس الإجراء بعد إضافة الإنزيم (التحكم بهضمها). احتضان كل أنابيب بنفس الطريقة كمكتبة C مرحبا.
  6. في صباح اليوم التالي، إضافة 5 ميليلتر من 100 يو/ميليلتر هينديي (500 وحدة في المجموع) الواحدة وقاسمه واحتضان في 37 درجة مئوية ح 2 بينما تهز 950 لفة في الدقيقة في ثيرموميكسير.
  7. مراقبة الهضم: للضوابط هضمها وعسر الهضم (انظر 3.5.1)، القيام بعكس التشعب (الخطوة 6)، واستخراج الفينول: كلوروفورم وترسيب الحمض النووي (الخطوة 7).
    1. تصميم زوج من أجهزة الإشعال التي تمتد عبر موقع ديي هين. في نفس المنطقة، وتصميم زوج آخر من الإشعال لا تمتد إلى موقع ديي هين. تصميم كبسولة تفجير لبكر الكمية (Q-PCR) باستخدام Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) والمعلمات التالية:
      حجم التمهيدي: 20 الأمثل (الحد الأدنى: 18، بحد أقصى: 27)؛ Tm التمهيدي: 60 الأمثل (الحد الأدنى: 57، بحد أقصى: 63)؛ التمهيدي CG % المحتوى: الحد الأدنى: 20، كحد أقصى: 80؛ حجم Amplicon: bp RT-PCR ~ 100 (لبكر التقليدية ~ 300 bp)؛ ميسبريمينج المكتبة: الإنسان (الإنسان كبسولة تفجير) أو القوارض وبسيطة (كبسولة تفجير الماوس).
    2. إجراء PCR Q للحصول على 4 يعني Cts (عتبة دورة): التصوير المقطعي [D; ح]، التي تم الحصول عليها من العينة هضمها [د] مع الزوج من أجهزة الإشعال التي تمتد عبر موقع ديي هين[ح]؛ Ct [د؛--]، والتي تم الحصول عليها من العينة هضمها [د] مع الزوج من أجهزة الإشعال لا تمتد إلى موقع ديي هين[--]؛ Ct [يو؛ ح]، التي تم الحصول عليها من العينة عسر الهضم [U] مع الزوج من أجهزة الإشعال التي تمتد عبر موقع ديي هين؛ Ct [U؛--]، والتي تم الحصول عليها من العينة عسر الهضم مع الزوج من أجهزة الإشعال لا تمتد إلى موقع ديي هين[--] [يو]. حساب النسبة المئوية الهضم ك: الهضم % = 100-100/2(Ct[D,H]-Ct[D,-])-(Ct[U,H]-Ct[U,-]).

4-بيوتينيليشن لتقييد جزء يتدلى

  1. إعداد مزيج الرئيسي بيوتينيليشن: 30.6 ميليلتر من 10 × تقييد المخزن المؤقت 2، 10.2 ميليلتر من ح2س (البيولوجيا الجزيئية الصف)، 7.65 ميليلتر من دكتب 10 ملم و 7.65 ميليلتر من دجتب 10 ملم، 7.65 ميليلتر من دتتب 10 ملم، 191.25 ميليلتر من 0.4 مم البيوتين-14-داتب وميليلتر 51 من يو/مليلتر 5,000 دنا بوليميريز أنا (كبير جزء كلينوو).
  2. إضافة 60 ميليلتر من مزيج بيوتينيليشن الرئيسي في مزيج الكوة، واحتضان في 37 درجة مئوية ح 1 الهز 700 لفة في الدقيقة (ثيرموميكسير) ل 5 ق، كل 30 ثانية. بعد ح 1، مكان مختبرين على الجليد.

5-في نواة عملية ربط

  1. إعداد مزيج الرئيسي ربط: 510 ميليلتر من 10 × T4 الحمض النووي ليجاسى المخزن المؤقت، 51 ميليلتر من 10 ملغ/مل ألبومين المصل البقري (BSA 100 x)، 1754.4 ميليلتر من الماء (البيولوجيا الجزيئية الصف)، و 127.5 ميليلتر من 1 يو/ميليلتر T4 الحمض النووي ليجاسى (انظر الجدول للمواد).
  2. إضافة ميليلتر 479 من مزيج الرئيسي ربط كل مزيج اليكووت واحتضان في 16 درجة مئوية ل 4 ح تهز 700 لفة في الدقيقة 5 s كل دقيقة 2 في ثيرموميكسير.
  3. احتضان 30 دقيقة في الرايت

6-التشعب عكس

  1. الجمع بين جميع مختبرين في أنبوب الطرد مركزي 50 مل (مناسبة للطرد المركزي عالية السرعة).
  2. إضافة 62.5 ميليلتر من 10 ملغ/مل رناسي A، مزيج، واحتضان لمدة 30 دقيقة عند 37 درجة مئوية.
  3. إضافة 300 ميليلتر من 10 ملغ/مل بروتيناز ك، مزيج، واحتضان لمدة 30 دقيقة عند 37 درجة مئوية.
  4. تبني رد فعل O/N (أو على الأقل 4 ح) عند 65 درجة مئوية. في صباح اليوم التالي، إضافة 300 ميليلتر من 10 ملغ/مل ك بروتيناز، مزيج، واحتضان ح 1 في 65 درجة مئوية.

7. تنقية الحمض النووي

  1. إضافة ميليلتر 4337.5 TLE المخزن المؤقت (10 ملم تريس-HCl pH 8.0؛ 0.1 مم يدتا pH 8.0) ومزيج.
  2. إضافة 1 حجم (10 مل) الفينول حموضة 8.0، دوامة 10 s، وأجهزة الطرد المركزي إلى أنبوب 50 مل جديدة في RT و 20,000 x ز لمل 9 نقل 3 كحد أدنى للمرحلة العليا (مائي).
    تنبيه: الفينول مادة كيميائية خطرة. اتباع الأنظمة الصحية والسلامة المناسبة.
  3. إضافة 2 مل TLE المخزن المؤقت إلى المرحلة المائية المتبقية، ودوامه لنقل 10 s وأجهزة الطرد المركزي في الرايت و 20,000 x ز للحد الأدنى 3 2.5 مل المرحلة مائي في أنبوب جديد من الخطوة 7-2، مما يجعل حجم النهائي مل 11.5. تجاهل الأنبوبة المحتوية على المرحلة الدنيا (العضوية).
  4. إضافة المجلد 1 (11.5 مل) الكحول الفينول: كلوروفورم: إيسواميل (25:24:1)، ودوامه 10 s، وأجهزة الطرد المركزي إلى أنبوب 50 مل جديدة في RT و 20,000 x ز لمل نقل 11 دقيقة 3 المرحلة العليا (مائي). كرر الخطوة 7، 3. سوف يكون حجم العينة الكلية الآن 13.5 مل.
  5. إضافة 1.35 مل م 3 الصوديوم خلات pH 5.2 و 33.75 مل من الجليد الباردة 100 ٪ الإيثانول، مزيج، واحتضان في-80 درجة مئوية لمدة 45 دقيقة، أو بدلاً من ذلك بين عشية وضحاها في-20 درجة مئوية.
  6. الطرد المركزي في 4 درجات مئوية و 20,000 x ز لمدة 10 دقائق وإزالة المادة طافية، وإعادة تعليق بيليه في 1 مل إيثانول (المجلد/المجلد) 70%-طازج ونقل إلى أنبوب جديد.
  7. الطرد المركزي في 4 درجات مئوية وسرعة كاملة لمدة 3 دقيقة في أجهزة الطرد مركزي benchtop، ثم إزالة المادة طافية.
  8. إعادة تعليق بيليه في 1 مل من الجليد الباردة 70% إيثانول (المجلد/المجلد)، وكرر الخطوة 7.7. الجاف لبيليه في 37 درجة مئوية لمدة 10 دقائق وإعادة تعليق في ميليلتر 650 TLE المخزن المؤقت. تحديد العائد الحمض النووي باستخدام تحليل القائم على الأسفار لتحديد كمية الحمض النووي المزدوج-الذين تقطعت بهم السبل.
    ملاحظة: البروتوكول يمكن أن يكون مؤقتاً هنا بالأداة تجميد وتخزين العينة في-80 درجة مئوية لعدة أشهر أو عند-20 درجة مئوية لفترة أقصر من الوقت.

8-ضوابط الجودة

  1. مراقبة سلامة مكتبة وربط بالتفريد الحمض النووي. تشغيل 200 نانوغرام من مكتبة في جل x TBE [اغروس]/1 0.8 في المائة. يجب تشغيل الحمض النووي كعصابة ما يزيد على 10 كيلو بايت.
  2. الكشف عن نوع الخلية المعروفة ثابتة قصيرة وطويلة المدى التفاعلات ببكر التقليدية. استخدام 100 نانوغرام من قالب الحمض النووي كل تفاعل PCR. تصميم كبسولة تفجير PCR قريبة ونحو مواقع التقييد اتباع الإرشادات المذكورة أعلاه (انظر 3.7.1). تسلسلات التمهيدي لمراقبة نوعية الماوس والبشرية مرحبا-ج المكتبات المذكورة في الجدول 1.
  3. التعبئة وربط عنصر التحكم: قص بها جل الأشرطة التي تحتوي على أمبليكونس من التحكم 8.2 وهلام-استخراج الحمض النووي، واستخدام الحمض النووي كقالب ل 4 ردود PCR الفردية مع تركيبات التمهيدي متطابقة.
    1. تنقية أمبليكونس باستخدام مجموعة أدوات تنقية بكر وقياس تركيز الحمض النووي.
    2. إعداد أربعة ردود فعل الهضم (هينديي [أ] ني [ب] و هينديي + ني [ج] ولا إنزيم [د]) لكل أمبليكون بحجم نهائي في 15 ميليلتر: 500 نانوغرام أمبليكون، ميليلتر 1.5 من 10 × تقييد المخزن المؤقت 2.1، 0.15 ميليلتر من 10 ملغ/مل ألبومين المصل البقري (BSA 100 x) ، و 0.1 ميليلتر (10 وحدات) إنزيم (هينديي [أ]، ونهيي [ب]، ديي هين+ المياه نهيي [ج] أو [د]).
    3. هضم ح 1 في 37 درجة مئوية، ثم قم بتشغيل الهضم ردود الفعل على جل x TBE [اغروس]/1 1.5% (wt/المجلد).

9. تجزؤ الحمض الخلوي الصبغي

  1. نقل 50.5 ميكروغرام من العينة في أنبوب جديد وإضافة TLE المخزن المؤقت إلى وحدة تخزين نهائي لتقسيم العينة ميليلتر. 655 في قارورة سونيكيشن 5 (انظر الجدول للمواد) بإضافة 130 ميليلتر من مكتبة (10 ميكروغرام) لكل قنينة. إمالة إلى حجم ~ 400 bp في الترا-سونيكاتور (انظر الجدول للمواد) باستخدام المعلمات التالية: عامل واجب: 10%؛ ذروة السلطة الحادث (w): 140؛ دورات لكل الاندفاع: 200؛ الوقت: 55 ثانية.
  2. جمع عينة سونيكاتيد في أنبوب جديد 2 مل.

10-على الوجهين سبري-حبة حجم التحديد

  1. الحل حبة "ميكس سبري" (تجميد المرحلة الصلبة عكسها) جيدا بعكس، نقل 1.85 مل من محلول حبة لأنبوب جديد وإحلال RT لمدة 15 دقيقة.
  2. إضافة 350 ميليلتر من الماء (البيولوجيا الجزيئية الصف) للعينة (الحجم النهائي مل 1).
  3. إضافة 600 ميليلتر من حل حبة سبري للعينة (الحجم الإجمالي 1.6 مل؛ ونسبة حل سبري للحمض النووي: 0.6 إلى 1) واحتضانها لمدة 5 دقائق في RT، وتدور عينة في الطرد مركزي benchtop ل s 2 – 3 لجمع العينة.
  4. فتح الغطاء ووضع العينة في موقف الفصل المغناطيسي لمدة 5 دقائق، نقل واضحة طافية في أنبوب جديد وتجاهل الخرز.
  5. تركز الخرز سبري لحجم التحديد الخطوة الثانية: نقل 930 ميليلتر من سبري الخرز في أنبوب جديد، وضع في موقف الفصل المغناطيسي لمدة 5 دقائق وتجاهل واضح طافية. إعادة تعليق الخرز في ميليلتر 310 سبري حبة الحل.
  6. إضافة 300 ميليلتر من مركزة سبري الخرز (الخطوة 10.5) للعينة (الحجم الإجمالي 1.9 مل؛ ونسبة سبري حل للحمض النووي الآن 0.9 إلى 1) واحتضان في RT لمدة 5 دقائق، وعينه تدور في الطرد مركزي benchtop ل s. 2 – 3 بعناية فتح الغطاء ، ضع الأنبوبة في موقف الفصل المغناطيسي لمدة 5 دقائق، وتجاهل المادة طافية.
  7. أضف 1 مل إيثانول 70% طازجة (المجلد/المجلد) إلى أنبوب العينة حول الموقف الفاصل المغناطيسي، واحتضان 30 ثانية، وتجاهل المادة طافية. كرر مرتين.
  8. حبات جافة في 37 درجة مئوية في ثيرموميكسير (غطاء أنبوب مفتوحة) لأي أكثر من 5 دقيقة إضافة 300 ميليلتر من المخزن المؤقت TLE للعينة، مزيج، واحتضان لمدة 10 دقائق في درجة حرارة الغرفة.
  9. تدور عينة في أجهزة الطرد مركزي benchtop ل s 2 – 3، وفتح الغطاء ومكان الأنبوب على فصل المغناطيسية الوقوف لدقيقة 5 نقل إلغاء المادة طافية في أنبوب جديد وتجاهل الخرز.

11-البيوتين/Streptavidin المنسدلة لربط المنتجات

  1. تجهيز المخازن المؤقتة: 1 × السل المخزن المؤقت (5 ملم تريس-HCl pH 8.0؛ يدتا 0.5 مم؛ 1 م كلوريد الصوديوم 0.05% 20 توين)؛ 2 × المخزن المؤقت للتجارب النووية (10 ملم تريس-HCl pH 8.0; 1 مم يدتا كلوريد الصوديوم م 2)؛ 1 x NTB العازلة (5 ملم تريس-HCl pH 8.0؛ يدتا 0.5 ملم 1 م كلوريد الصوديوم).
  2. إضافة 200 ميليلتر من حبات المغناطيسي إلى جانب ستريبتافيدين (انظر الجدول للمواد) في أنبوب جديد ووضعه في موقف الفصل المغناطيسي لمدة 1 دقيقة وإزالة المادة طافية.
  3. أغسل حبات مرتين مع 500 ميليلتر 1 x تيرابايت المخزن المؤقت.
    1. لكل خطوة الغسيل خلال البيوتين سحب لأسفل ونهاية إصلاح وإزالة البيوتين في نهايات الحمض النووي غير متصلة، وتراجع داتب، وخطوات عملية ربط محول، إعادة تعليق الخرز في المخزن المؤقت للمقابلة، وتناوب على RT و 15 دورة في الدقيقة لمدة 3 دقائق، تدور الأنبوب في أجهزة الطرد مركزي benchtop 2 – 3 ثانية، وضع الأنبوب في موقف الفصل المغناطيسي لمدة 3 دقائق وإزالة المادة طافية.
  4. إعادة تعليق الخرز في 300 ميليلتر من المخزن المؤقت x NTB 2. مزيج الخرز والعينة (الحجم الإجمالي 600 ميليلتر) واحتضان في RT لمدة 15 دقيقة على عجلة دوارة 3 لفة في الدقيقة.
  5. استعادة الخرز على الوقوف الفصل المغناطيسي لمدة 3 دقائق وإزالة المادة طافية واضحة. أغسل حبات مرتين في 500 ميليلتر من المخزن المؤقت x NTB 1 أولاً ثم في 200 ميليلتر x 1 ربط المخزن المؤقت. إعادة تعليق الخرز في 50 ميليلتر x 10 ربط المخزن المؤقت.

12-وضع حد لإصلاح وإزالة من البيوتين في نهايات الحمض النووي غير متصلة

  1. الجمع بين العينة (50 ميليلتر في المجموع) مع 50 ميليلتر من 2.5 مم دنتب ميكس (12.5 ميليلتر من 10 مم لكل دنتب)، 18.1 ميليلتر من 3,000 يو/مليلتر T4 دنا بوليميريز، 18.1 ميليلتر من 10,000 بنك T4 U/mL، 3.7 ميليلتر من 5,000 يو/مليلتر دنا بوليميريز تجزئة أنا الكبيرة (كلينوو) ، و 360.1 ميليلتر من H2o.
  2. خلط واحتضان في 20 درجة مئوية ح 1، تهز 5 s 700 لفة في الدقيقة كل دقيقة 2 في ثيرموميكسير.
  3. استعادة الخرز حول الموقف الفاصل المغناطيسي وإزالة المادة طافية واضحة، وتغسل حبات مرتين في 500 ميليلتر من 1 x السل المخزن المؤقت.
  4. أغسل حبات في 500 ميليلتر من المخزن المؤقت x NTB 1، تليها غسل واحد في 500 ميليلتر من 1 x TLE.
  5. استعادة الخرز حول الموقف الفاصل المغناطيسي وإزالة المادة طافية واضحة، وإعادة تعليق الخرز في ميليلتر 415 1 x TLE المخزن المؤقت.

13-داتب المخلفات

  1. الجمع بين العينة (415 ميليلتر) مع 50 ميليلتر من 10 × تقييد المخزن المؤقت 2، 5 ميليلتر من داتب 10 ملم، و 30 ميليلتر من 5 كلينوو U/ميليلتر أكسو-ناقص.
  2. خلط واحتضان في 37 درجة مئوية مدة 30 دقيقة، تهز 5 s 700 لفة في الدقيقة كل دقيقة 2 في ثيرموميكسير.
  3. استعادة الخرز حول الموقف الفاصل المغناطيسي وإزالة المادة طافية واضحة، وتغسل حبات مرتين في 500 ميليلتر من 1 x السل المخزن المؤقت.
  4. أغسل حبات في 500 ميليلتر من المخزن المؤقت x NTB 1.

14. ربط محول

  1. أغسل حبات في 200 ميليلتر من 1 × ربط رد فعل المخزن المؤقت (انظر الجدول للمواد).
  2. إعادة تعليق الخرز في 200 ميليلتر من ربط x 1 رد فعل المخزن المؤقت. إضافة 4 ميليلتر من ليجاسى الحمض النووي (انظر الجدول للمواد) وتعتيق ميليلتر 16 من 15 ميكرون قبل محولات PE (قبل يصلب محولات PE بخلط كميات متساوية من محول PE 1 ومحول PE 2 (سواء في 30 ميكرومتر) وتفرخ لبضع دقائق في RT). تبني على RT لمدة 15 دقيقة.
  3. استعادة الخرز حول الموقف الفاصل المغناطيسي وإزالة المادة طافية واضحة، وتغسل حبات مرتين في 500 ميليلتر من 1 x السل المخزن المؤقت.
  4. أغسل حبات في 500 ميليلتر من المخزن المؤقت x NTB 1. الخرز ثم، يغسل في 100 ميليلتر من 1 × تقييد المخزن المؤقت 2، إعادة تعليق الخرز في 50 ميليلتر من 1 × تقييد المخزن المؤقت 2، ونقل في أنبوب جديد.

15-مرحبا-مكتبة C التضخيم

  1. إعداد مزيج PCR الرئيسي: 100 ميليلتر من 5 x Phusion العازلة؛ 6 ميليلتر من 25 ميكرومتر PE PCR التمهيدي 1.0؛ 6 ميليلتر من 25 ميكرومتر PE PCR التمهيدي 2.0؛ 14 ميليلتر من دنتب ميكس (10 ملم في كل)؛ 6 ميليلتر من بوليميريز فوسيون؛ ميليلتر 318 ح2o.
  2. مزيج PCR مزيج الرئيسي مع الخرز (500 ميليلتر في المجموع)، تقسيم في مختبرين 10 من 50 ميليلتر، وتضخيم بالاسترداد باستخدام الشروط التالية:
    30s عند 98 درجة مئوية
    7 دورات من: 10 s عند 98 درجة مئوية؛ 30 ثانية عند 65 درجة مئوية؛ 30 ثانية في 72 درجة مئوية
    7 دقيقة عند 72 درجة مئوية
  3. جمع ردود الفعل بكر في أنبوب جديد، واستعادة الخرز على موقف الفصل المغناطيسي، ونقل طافية (500 ميليلتر) في أنبوب جديد.
  4. تنقية الحمض النووي مكتبة استخدام الخرز سبري.
    1. سبري مزيج الخرز، نقل 460 ميليلتر من الخرز في أنبوب جديد، ويقدم RT في 15 دقيقة إضافة 450 ميليلتر من حبات سبري إلى ردود الفعل بكر (الحجم النهائي 950 ميليلتر) واحتضانها لمدة 5 دقائق في الرايت وتدور عينة في الطرد مركزي benchtop ل s 2 – 3 لجمع العينة.
    2. فتح الغطاء ووضع العينة في موقف الفصل المغناطيسي لمدة 5 دقائق وإزالة المادة طافية.
    3. حفظ الخرز حول الموقف الفاصل المغناطيسي، أضف 1 مل إيثانول 70% (المجلد/المجلد) عينة الأنبوبة على مساحة واضحة من الخرز، ترك 30 ثانية، وتجاهل المادة طافية.
    4. كرر الخطوة 15.4.3 أكثر من مرتين.
    5. جاف الخرز عند 37 درجة مئوية في ثيرموميكسير (غطاء أنبوب مفتوحة) لمدة لا تزيد عن 5 دقائق.
    6. إضافة ميليلتر 51 TLE المخزن المؤقت للعينة، مزيج، واحتضان لمدة 10 دقيقة عند 37 درجة مئوية، هز 950 لفة في الدقيقة في ثيرموميكسير.
    7. تدور عينة في أجهزة الطرد مركزي benchtop ل s 2 – 3، وفتح الغطاء ومكان الأنبوب على فصل المغناطيسية الوقوف لدقيقة 5 نقل إلغاء المادة طافية في أنبوب جديد وتجاهل الخرز.
    8. قياس تركيز مكتبة C مرحبا. بعد 7 جولات من [بكر] تضخيم، أن نحصل بشكل روتيني 500 – 1,500 نانوغرام من مكتبة مرحبا-ج.

16-الهجين الالتقاط في الحل

ملاحظة: مانع والمخزن المؤقت (SHS1-4) الحلول أدناه من سوريسيليكت كيت (انظر الجدول للمواد).

  1. نغ نقل 500 إلى 1 ميكروغرام من مكتبة مرحبا-C في أنبوب جديد وتتبخر العينة في فراغ المكثف (انظر الجدول للمواد؛ 45 درجة مئوية وضغط الفراغ: مستوى 30.0، المنحدر 5) حتى الجاف.
  2. إعادة تعليق تبخر مرحبا-ج المكتبة عن طريق إضافة 3.6 ميليلتر من ح2س (الصف البيولوجيا الجزيئية)، 2.5 ميليلتر من مانع 1، 2.5 ميليلتر من مانع 2، وميليلتر 0.6 من مانع مخصصة.
  3. نقل العينة في بئر شريط أنبوب بكر جديد والوثيق مع قطاع كاب بكر ووضع على الجليد. التسمية ك "د" (للحمض النووي ج).
  4. إعداد المخزن المؤقت التهجين: 12.5 ميليلتر من المخزن المؤقت SHS1؛ 0.5 ميليلتر من المخزن المؤقت SHS2؛ 5 ميليلتر من المخزن المؤقت SHS3؛ 6.5 ميليلتر من SHS4 المخزن المؤقت.
  5. احتضان عند 65 درجة مئوية لمدة 5 دقائق في ثيرموميكسير. نقل في بئر شريط أنبوب بكر جديد والوثيق مع قطاع كاب بكر والحفاظ على تسمية الرايت ك "ح" (التهجين المخزن المؤقت).
  6. في بئر شريط أنبوب بكر جديد، مزيج 5 ميليلتر من بيوتينيلاتيد 100 نانوغرام/ميليلتر تحقيقات الجيش الملكي النيبالي (مخزن في-80 درجة مئوية وذوبان الجليد على الجليد فقط قبل الاستخدام)؛ 0.5 ميليلتر من سرناسي ب (رناسي المانع) و 1.5 ميليلتر من ح2س (البيولوجيا الجزيئية الصف).
  7. إغلاق قطاع أنابيب PCR مع قطاع كاب PCR ومكاناً في الجليد. التسمية ك "R" (للحمض النووي الريبي).
  8. قم بإعداد الجهاز PCR باستخدام المعلمات التالية:
    5 دقيقة عند 95 درجة مئوية؛ ح 25 عند 65 درجة مئوية؛ غطاء ساخنة؛ حجم رد الفعل بكر 29 ميليلتر.
    ملاحظة: المضي قدما بالسرعة الممكنة خلال جميع الإجراءات أثناء تشغيل الجهاز PCR تفاديا لتبخر العينة.
  9. وضع قطاع الأنبوب "د" PCR في الجهاز PCR وإغلاق غطاء جهاز PCR، وبدء تفاعل PCR. عندما يصل البرنامج بكر إلى 65 درجة مئوية، فتح غطاء الجهاز بكر وقطاع الأنبوب "ح" PCR في الجهاز PCR. إغلاق غطاء جهاز PCR واحتضانها للحد الأدنى 3 فتح غطاء الجهاز بكر، مكان الأنبوب "R" PCR الشريط على جهاز PCR، وإغلاق الجهاز PCR.
  10. بعد 2 دقيقة، فتح غطاء الجهاز بكر وجميع شرائط أنبوب PCR. نقل 13 ميليلتر من جيدا "ح" إلى جيدا "R"، ثم جميع حجم جيدا "د" إلى جيدا "R". بيبيت صعودا وهبوطاً 3 مرات لخلط رد فعل، أغلق قطاع أنابيب PCR، وإزالة "H" و "دال" PCR أنبوب الشرائط، وإغلاق غطاء جهاز PCR. تبني رد الفعل عند 65 درجة مئوية ح 24.

17-العزلة المروج الشظايا التي تحتوي على منتجات عملية ربط

ملاحظة: يوصي باتخاذ الخطوات التالية يجب القيام به مع مجموعة محول سوريسيليكت ومكتبة (انظر الجدول للبركة).

  1. قبل الحارة 1.5 مل أغسل المخزن المؤقت 2 كل عينة على 65 درجة مئوية في وقت مبكر.
  2. إضافة 60 ميليلتر من ستريبتافيدين-إلى جانب الخرز المغناطيسي (انظر الجدول للمواد) في أنبوب جديد ووضع في موقف الفصل المغناطيسي لمدة 1 دقيقة وإزالة المادة طافية.
  3. أغسل حبات ثلاث مرات مع ميليلتر 200 1 × ربط المخزن المؤقت.
    ملاحظة: لكل خطوة الغسيل أثناء عزلة التقاط ما بعد عملية ربط المنتجات المحتوية على المروج، إعادة تعليق الخرز في المخزن المؤقت للمقابلة، وتناوب لمدة 3 دقيقة في الرايت و 15 دورة في الدقيقة في عجلة دوارة، بهدوء تدور الأنبوب في benchtop أجهزة الطرد مركزي عن 2 – 3 ثانية لجمع عينة، ومكان الوقوف الأنبوب على فصل المغناطيسية 3 دقيقة، وإزالة المادة طافية.
  4. إعادة تعليق الخرز في 200 ميليلتر من 1 × ربط المخزن المؤقت. فتح الجهاز بكر وقطاع أنابيب PCR (بينما يزال قيد التشغيل البرنامج PCR) ونقل رد فعل التهجين في الأنبوب مع الخرز المغناطيسية. تبني على RT لمدة 30 دقيقة على عجلة دوارة 3 لفة في الدقيقة.
  5. استعادة الخرز حول الموقف الفاصل المغنطيسي وإزالة المادة طافية واضحة. إعادة تعليق الخرز إلى 500 ميليلتر ليغسل المخزن المؤقت 1، مزيج، واحتضان لمدة 15 دقيقة عند 20 درجة مئوية بينما تهز 950 لفة في الدقيقة في ثيرموميكسير.
  6. استعادة الخرز على الوقوف الفصل المغناطيسي لمدة 3 دقائق وإزالة المادة طافية واضحة. إعادة تعليق الخرز إلى 500 ميليلتر من المخزن المؤقت للمياه والصرف الصحي 2 وخلط واحتضان 10 دقيقة عند 65 درجة مئوية بينما تهز 950 لفة في الدقيقة في ثيرموميكسير. كرر الخطوة 17.5 أكثر مرتين.
  7. استعادة الخرز حول الموقف الفاصل المغنطيسي وإزالة المادة طافية واضحة وإعادة تعليق الخرز في 200 ميليلتر من 1 × تقييد المخزن المؤقت 2. استعادة الخرز حول الموقف الفاصل المغنطيسي وإزالة المادة طافية وإعادة تعليق الخرز في 30 ميليلتر من 1 × تقييد المخزن المؤقت 2.

18-شارتر جيم مكتبة التضخيم

  1. إعداد مزيج PCR الرئيسي: 60 ميليلتر من 5 x PCR العازلة (فوسيون المخزن المؤقت)، 3.6 ميليلتر من 25 ميكرومتر PE PCR التمهيدي 1.0، 3.6 ميليلتر من 25 ميكرومتر PE PCR التمهيدي 2.0، 8.4 ميليلتر دنتب ميكس (10 ملم في كل) وميليلتر 3.6 من بوليميريز فوسيون 190.8 ميليلتر من H2o.
  2. مزيج PCR مزيج الرئيسي مع الخرز (300 ميليلتر في المجموع)، تقسيم في مختبرين 6 50 ميليلتر، وتضخيم PCR استخدام الشروط التالية:
    30 ثانية عند 98 درجة مئوية
    4 دورات من: 10 s عند 98 درجة مئوية، 30 ثانية عند 65 درجة مئوية، 30 s عند 72 درجة مئوية
    7 دقيقة عند 72 درجة مئوية
  3. جمع جميع ردود الفعل PCR في أنبوب جديد واستعادة الخرز في المغناطيس، ونقل المادة طافية (300 ميليلتر؛ يحتوي على مكتبة شارتر-ج) في لأنبوب جديد.
  4. تنقية المكتبة شارتر-C باستخدام الخرز سبري، اتباع الخطوات الموضحة أعلاه تحت مقاس 15.4 بوصة.
  5. قياس تركيز مكتبة C شارتر.

Representative Results

وقد استخدمت المروج التقاط مرحبا-ج لإثراء الماوس7،34،،من3639 و البشرية33،35،37،38 ج مرحبا المكتبات من أجل التفاعلات بين المروج. وصف بروتوكول مماثل (يدعى هيكاب) مجموعة ساندبيرغ40. ويبين الشكل 1A سير العمل التخطيطي للمروج التقاط مرحبا جيم. يتم إنشاء مكتبات C مرحبا في البروتوكول هو موضح هنا، استخدام ربط في نواة41، الذي ينتج إلى حد كبير تخفيض عدد المنتجات ربط زائفة42. شارتر-c، الماوس معقدة للغاية أو البشرية مرحبا-C مكتبات يتعرضون التهجين بالحل والقبض استخدام الكشف بيوتينيلاتيد 39,021 22,225 الماوس المحتوية على مروج هنديي تقييد أجزاء مكملة، أو 37,608 بيوتينيلاتيد الكشف استهداف 22,076 البشرية التي تحتوي على مروج تقييد هنديي الشظايا، على التوالي. يمكن استهداف المروج التي تحتوي على شظايا التقييد في أحد أو كلا طرفي بالفردية بيوتينيلاتيد الكشف (الشكل 1B). ووجدنا أن القبض على حد سواء وينتهي تحسين التغطية من المروجين الفردية (الشكل 1؛ ما يلي تسلسل الخام) تقريبا شقين، كما هو متوقع. وهكذا، كلما ممكن (أي، في مناطق غير المتكررة)، نحن ننصح باستخدام الكشف بيوتينيلاتيد مكملة لكلا طرفي جزء من تقييد لالتقاطها.

لتقييم نوعية المكتبة شارتر-ج في مرحلة مبكرة أثناء إعداد المكتبة، نقوم بعنصري تحكم بعد ربط الحمض النووي وتنقية، كما هو موضح سابقا31. الأول استخدام أزواج التمهيدي محددة لتضخيم عملية ربط المنتجات كما هو الحال في ج 327. أننا باستخدام أزواج التمهيدي (الجدول 1) إلى تضخيم منتجات ربط ثابتة طويلة المدى من نوع الخلية، مثل بين الجينات حركة ولها القدرة على معروفة تقع 2 ميغابايت تقريبا بعيداً (الشكل 2A) أو بين الجينات (محور Hist1 مفصولة 1.5 ميغابايت)، وبين المنطقتين تقع على مقربة من الخطية (مراقبة قصيرة المدى).

تجري مراقبة النوعية الثانية تحديد فعالية إدماج البيوتين أثناء التعبئة كلينوو بوساطة من قيود الموقع يتدلى مع البيوتين-داتب. نجاح كلينوو التعبئة والنتائج اللاحقة بلانت-نهاية ربط في الاختفاء الموقع القيد الأصلي بين جزيئات الحمض النووي لربط المنتج، وفي حالة هنديي في تشكيل موقع الاعتراف ني جديد (الشكل 2 ). نسبة هنديي ني هضمها ربط المنتج قراءات مباشرة البيوتين إدماج الكفاءة. سوف تظهر مكتبة C مرحبا رداءة مستوى عاليا من الهضم هنديي، بينما المكتبات عالية الجودة الهضم ني شبه كامل لربط المنتجات (الشكل 2).

بعد إعداد مكتبة مرحبا-ج (أي، بعد هدم البيوتين-streptavidin اختيار حجم منتجات ربط مرحبا-ج وربط محول وبكر قبل التقاط)، هو تقييم توزيع مكتبة C مرحبا النزاهة وحجم بيواناليزير (الشكل ج 2)-ينفذ نفس عنصر التحكم في نهاية إعداد مكتبة شارتر-ج (أي، بعد التقاط التهجين لربط المنتجات المحتوية على مروج وبكر التقاط ما بعد). تظهر مقارنة الملامح مرحبا-C وبيواناليزير شارتر-C كما هو متوقع، مكتبات C مرحبا تتركز أكثر بكثير من المكتبات شارتر ج المقابلة، لكن توزيع حجم المكتبات مشابهة جداً، مما يشير إلى أن القبض على خطوة في إدخال شارتر-ج لا تحيز حجم (الشكل 2، د).

بعد إقران نهاية التسلسل، يتم تعيينها في شارتر-ج على ما يلي، الخاضعة لسيطرة نوعية وتصفية باستخدام خط أنابيب HiCUP43. مكتبات شارتر ج عالية الجودة تحتوي على ما بين 70-90% 'أزواج صالحة' (أي ازدواج في نهاية تسلسل يقرأ بين اثنين من شظايا تقييد التي هي ليست المجاورة على خريطة الجينوم الخطية؛ الشكل 3 ألف، باء). استخدام ربط في نواة البروتوكول41،42، قراءة النسبة المئوية عبر أزواج (أي ازدواج في نهاية تسلسل يقرأ بين اثنين من شظايا تقييد الموجودة على الكروموسومات المختلفة) عادة ما تكون منخفضة، بين 5 و 25 في المائة، مما يعكس وجود كروموسوم الأقاليم، والتي تشير إلى نوعية جيدة من مكتبة. المقارنة المباشرة للنسبة المئوية من 'أزواج صالحة' بين مكتبات مرحبا-ج وعلى المكتبات شارتر-ج35المقابلة، تبين أنه في جميع الحالات أن النسبة المئوية لأزواج صالحة أعلى في مكتبات شارتر-C (الشكل 3B). ويقترن ذلك بانخفاض في النسبة المئوية لغير صالح 'نفس التجزئة الداخلية' يقرأ في شارتر-C (الشكل 3). ومن المتوقع، كما أن الخطوة التقاط يثري لربط المنتجات المحتوية على المروج، بل أيضا لتقييد جزء ينتهي، بسبب موقف أوليجوس القبض على التقييد عدد الأجزاء (انظر الشكل 1B).

بعد تصفية HiCUP، نحدد كفاءة الالتقاط. مكتبات شارتر-C تحتوي على ثلاثة أنواع من القراءات تسلسل صالح بعد تصفية HiCUP:
1.) المروج: يقرأ الجينوم (أي ما يلي بين جزء من القبض على مروج وجزء غير مروج تقييد هيندييي في أي مكان في الجينوم)
2.) المروج: المروج يقرأ (قراءة بين اثنين القبض على مروج الشظايا)
3.) الجينوم: يقرأ الجينوم (ربط المنتجات فيها أيا من الشركاء المنتج ربط خرائط للقبض على مروج الخلفية مرحبا-ج). يتم تجاهل هذه قبل تحليل المتلقين للمعلومات.

تحتوي مكتبات شارتر ج عالية الجودة التقاط الكفاءات (مجموع الفئتين 1 و 2 أعلاه) بين 65 – 90% (الشكل 3D). مقارنة مباشرة لمكتبات C مرحبا يظهر أن ينتج شارتر-ج ~ تخصيب 15-fold لمروج المنتجات المحتوية على ربط (الشكل 3D)، وفي بعض الحالات 17-fold. وهذا ما يقرب من الحد الأقصى الافتراضي (19.6-fold) الإثراء شارتر-c، الذي يعتمد على النسبة المئوية للشظايا تقييد الجينوم مشمولة بنظام التقاط. يمكن تحقيق المزيد من الإثراء بتصميم أنظمة التقاط تستهدف تقييد أقل شظايا44،،من4546.

ويبين تحليل إينتيراكتوميس المروج خلية نوع والنسب-خصوصية33،34،35، مع التغييرات وضوحاً خلال التمايز الخلوي37،38،39 . تظهر الأرقام 4 و 5 أمثلة ديناميات خصوصية وتمايز النسب في المروجين محددة. على سبيل المثال، وأعرب عن الاد مؤثرا في كافة الخلايا ولكن التعبير عن أوبريجولاتيد في اريثروبلاستس47. المروج الاد إجراء اتصالات عدة شظايا القاصي في كافة الخلايا المكونة للدم، ويشترك في التفاعلات الإضافية على وجه التحديد في erythroblasts (الشكل 4). إيل-8 يبين التفاعلات لا يعتد به إحصائيا في الخلايا ب، والتفاعلات قليلة جداً في خلايا تي، ولكن عشرات من التفاعلات في الخلايا من سلالة النقوي، بما في ذلك التفاعلات نوع الخلية المحددة في (وحيدات، العَدلات وميجاكاريوسيتيس الشكل 5). وتبين هذه الأمثلة كيف يمكن استخدام شارتر-C لكشف خلية من نوع إينتيراكتوميس محددة وتحديد مناطق المروج التفاعل مع القدرة التنظيمية.

Figure 1
الشكل 1 : مروج التقاط مرحبا-ج الأساس المنطقي والاستيلاء على بيت التصميم- (أ) سير العمل التخطيطي شارتر-جيم. في نواة عملية ربط مرحبا-ج41،42 (ط) تبعتها عملية التهجين بالحل مع الطعم بيوتينيلاتيد الحمض النووي الريبي (ثانيا) استهداف الشظايا تقييد جميع البشر (يصور هنا) أو الماوس مروجي الجينات (ثالثا). (ب) بيت التصميم شارتر-C. الجيش الملكي النيبالي بيوتينيلاتيد التقاط الطعوم (خطوط حمراء منحنية) مصممة ضد ينتهي شظايا تقييد المحتوية على مروج (رمادي؛ علما أن تسلسل المروج التي أنفسهم (أحمر) تستهدف فقط بالطعم التقاط رنا إذا يوجدون في تقييد ينتهي جزء). ربط المنتجات يتألف من الأجزاء المحتوية على مروج التقييد (رمادي) وتلك الشظايا تقييد التفاعل (الأصفر والأخضر) معزولة عن طريق التهجين تسلسل-التكامل بين الهدف الحمض النووي والجيش الملكي النيبالي الطعم واللاحقة المنسدلة البيوتين-ستريبتافيدين، كما هو مبين في (أ) (ج) مقارنة من شارتر-ج التقاط الكفاءة لتقييد الشظايا المحتوية على مروج مستهدفة من قبل الجيش الملكي النيبالي واحد الطعم التقاط مسبار مقابل المجسات التقاط اثنين الطعم الحمض النووي الريبي (انظر التخطيطي في ب). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 2
الشكل 2 : ضوابط الجودة قبل تسلسل شارتر-ج. (أ) ترك، التخطيطي للتجاور المكاني بين المروج، وشرطة التدخل السريع، أسفر عن منتج ربط مرحبا-C تتكون من جزء تقييد المحتوية على مروج (رمادي؛ تسلسل المروج باللون الأحمر) وجزء تقييد بير (أصفر). الحق، والحمض النووي هلام التفريد تظهر أمثلة لمنتجات ربط مرحبا-ج تضخيمه باستخدام أزواج التمهيدي محددة (كما هو مبين في التخطيطي على اليسار). غادر (ب) ، أمثلة لتقييد HindIII ونهيي ونهيي HindIII/هضم مرحبا-ج ربط المنتجات (منتجات PCR سيظهر في A). الحق، وتسلسل التخطيطي للحمض النووي بعد عقب فشل ربط مرحبا-ج (أعلى) أو التعبئة كلينوو دنتب الناجحة (أسفل) تقاطعات التقييد وربط اللاحقة. (ج) ممثل مرحبا-C مكتبة بيواناليزير الشخصية (تخفيف 1/5). (د) ممثل شارتر-C مكتبة بيواناليزير الشخصية (لا تمييع). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 3
الشكل 3 : ضوابط الجودة بعد انتهاء التسلسل شارتر-ج. (أ) قراءة مقارنة للنسبة المئوية تسلسل صالح أزواج بعد HiCUP43 المعالجة في مقابل شارتر ج المقابلة مكتبات مرحبا-ج (بيانات من جعفر et al., 201635). (ب) ممثل HiCUP شارتر-ج نتيجة عرض صالح قراءة أزواج، وفئات أخرى التسلسل التي يتم تجاهلها من قبل تحليل المتلقين للمعلومات (بيانات من جعفر et al., 201635). (ج) مقارنة بين النسبة المئوية 'جزء نفسه الداخلية' يقرأ بعد HiCUP المعالجة في مقابل شارتر ج المقابلة مكتبات مرحبا-ج (بيانات من جعفر et al., 201635). (د) مقارنة بين النسبة المئوية تسلسل يقرأ تنطوي المروج اصطاد شظايا (التقاط الكفاءة) في مقابل شارتر ج المقابلة مكتبات مرحبا-ج (بيانات من جعفر et al.، 201635). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 4
الشكل 4: الاد شارتر ج الشخصية في الخلايا المكونة للدم البشري- تظهر التفاعلات المروج لأنواع الخلايا النقوي الأقواس الزرقاء، وتظهر التفاعلات المروج لأنواع الخلايا اللمفاوية الأقواس الأرجواني. يتم الإشارة إلى التفاعلات اريثروبلاست الخاصة بالأسهم الحمراء (بيانات من جعفر et al., 201635). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 5
الشكل 5 : IL8 شارتر ج الشخصية في الخلايا المكونة للدم البشري- تظهر التفاعلات المروج لأنواع الخلايا النقوي الأقواس الزرقاء، وتظهر التفاعلات المروج لأنواع الخلايا اللمفاوية الأقواس الأرجواني. التفاعلات الخاصة الوحيدات المشار إليها بواسطة الأسهم الخضراء، والتفاعلات الخاصة العَدلات يشار إليها بالأسهم الحمراء، وهو مبين تفاعل megakaryocyte محددة بسهم براون (بيانات من جعفر et al., 201635). الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

البشرية
الاسم التسلسل كروموسوم ضفيرة بدء تشغيل GRCh38/hg38 نهاية GRCh38/hg38 تركيبات التمهيدي لاختبار التفاعلات ج 3، وإدماج البيوتين
النظام المنسق AHF64 ديكر جكاتجكاتاجككتكتجكتجتكتكتجااتك 11 + 116803960 116803991 تستخدم في تركيبة مع النظام المنسق AHF66 ديكر
hs AHF66 ديكر كتجتككاجتاكاتككتجتكاكااككك 11 + 116810219 116810248 تستخدم في تركيبة مع النظام المنسق AHF64 ديكر
محور حركة hs جاجاككجتاتجكاا 8 - 127733814 127733833 تستخدم في تركيبة مع النظام المنسق حركة +1820 أو hs حركة-538
hs حركة +1820 آآآتجكككاتتككتكتكك 8 + 129554527 129554547 تستخدم في تركيبة مع محور حركة hs
hs حركة-538 تجككتجاتجاتاجتجكتتك 8 - 127195696 127195716 تستخدم في تركيبة مع محور حركة hs
hs و HIST1 آجكاجاااجكاتاجكا 6 + 26207174 26207193 تستخدم في تركيبة مع hs HIST1 R
hs HIST1 R تكتججتجتججاكتتك 6 + 27771575 27771594 تستخدم في تركيبة مع النظام المنسق و HIST1
الماوس
التسلسل كروموسوم ضفيرة بدء تشغيل GRCm38/mm10 نهاية GRCm38/mm10 تركيبات التمهيدي لاختبار التفاعلات ج 3، وإدماج البيوتين
تكاتجاجتككككاكاتكتتج 8 + 84841090 84841111 تستخدم في تركيبة مع مم Calr2
كتجتججكاككاجاتجتجتاات 8 + 84848519 84848541 تستخدم في تركيبة مع مم Calr1
تاتكاججتجكككجتكاككتكاجك 6 + 125163098 125163123 تستخدم في تركيبة مع Gapdh4 ديكر
ججكتتتاتاجكاكجتاتااجت 6 + 125163774 125163799 تستخدم في تركيبة مع Gapdh3 ديكر
جاجاججاااجاجتجات 6 + 52212829 52212850 تستخدم في تركيبة مع مم Hoxa13
كاجكاتاتتجكتجاجاكج 6 - 52253490 52253511 تستخدم في تركيبة مع مم Hoxa7
ججتاتجتجتكاكتاكتج 13 + 23571284 23571305 تستخدم في تركيبة مع مم Hist1h3e أو مم Hist1h4i
ججتتجاتجاجتجتجاج 13 + 23566541 23566561 تستخدم في تركيبة مع مم Hist1h2ae
تججككااجككتاتاتجا 13 + 22043085 22043104 تستخدم في تركيبة مع مم Hist1h2ae

الجدول 1: تسلسل التمهيدي لمراقبة الجودة للإنسان ومكتبات الماوس مرحبا-ج.

Discussion

تصميم نمطي من المروج التقاط مرحبا-ج

مروج التقاط مرحبا-ج يهدف إلى إثراء المكتبات مرحبا-C للتفاعلات التي تشمل المروجين على وجه التحديد. وتشمل هذه التفاعلات مجموعة فرعية فقط من ربط منتجات موجودة في مكتبة مرحبا-ج.

يمكن بسهولة تعديل التقاط مرحبا-C لإثراء المكتبات مرحبا-C لأي منطقة الجينوم أو المناطق ذات الاهتمام بتغيير نظام التقاط. التقاط مناطق يمكن أن تكون أجزاء الجينوم المستمر44،45،46،48، القدرة التي تم تحديدها في شارتر-ج (35من 'عكس التقاط مرحبا-ج')، أو الدناز مواقع شديدة الحساسية49 . يمكن ضبط حجم نظام التقاط اعتماداً على نطاق تجريبي. على سبيل المثال، درايدن وآخرون. استهداف 519 الطعم الشظايا في ثلاثة الصحارى الجينات المرتبطة ب سرطان الثدي44. نظام التقاط من مارتن وآخرون. أهداف كلا الجزأين الجينوم المستمر ('"القبض على المنطقة"': 211 مناطق الجينوم في المجموع؛ و 2,131 تقييد الشظايا) وتحديد المروجين (المروجين الجين 3,857)45.

مكتبات سوريسيليكت متوفرة في نطاقات مختلفة الحجم: 1 كيلو بايت إلى 499 كيلو بايت (5,190 – 4,806)، 500 كيلو بايت إلى 2.9 ميغابايت (5,190 – 4,816)، و 3 ميغابايت إلى 5.9 ميغابايت (5,190 – 4,831). كما كل التقاط الفردية البيوتين-الجيش الملكي النيبالي هو 120 النيوكليوتيدات طويلة، التقاط هذه الأنظمة استيعاب أقصى قدر 4,158، و 24,166 و 49,166 الفردية التقاط تحقيقات، على التوالي. وهذا يتوافق مع 2,079 و 12,083 و 24,583 تقييد المستهدفة الشظايا، على التوالي (لاحظ أن الأرقام لتقييد الشظايا هي الحدود السفلية على أساس الافتراض بأنه يمكن تصميم اثنين التقاط الفردية المسابير لكل قيد جزء – في الواقع بسبب تكرار تسلسل هذا لن يكون الحال بالنسبة لكل تقييد تجزئة (انظر أيضا الشكل 1 باء، جيم)، أسفر عن عدد أكبر من شظايا تقييد استهدافها لعدد ثابت من المجسات التقاط المتاحة ).

البروتوكول هو موضح هنا يستند على استخدام إنزيم التقييد مع موقع اعتراف بي بي 6 للكشف عن تفاعلات طويلة المدى. استخدام إنزيم التقييد مع موقع اعتراف بي بي 4 للقرار أكبر من التفاعلات الدانية أكثر هو أيضا ممكن40،49.

قيودا من شارتر-ج

واحد الحد المتأصلة لكل كروموسوم تكيف التقاط فحوصات أن القرار يتحدد بإنزيم التقييد المستخدمة لإنشاء مكتبة. التفاعلات التي تحدث بين عناصر الحمض النووي الموجود في جزء القيد نفسه غير مرئية لفحوصات 'ج-نوع'. علاوة على ذلك، في شارتر-ج، في بعض الحالات أكثر من موقع بدء النسخ يمكن أن يكون موجوداً على جزء تقييد المحتوية على مروج نفسه، وإيواء المتحقق في بعض الحالات كلا علامات هيستون النشطة والقمعية، مما يجعل من الصعب تحديد الذي التنظيمية عناصر التوسط في التفاعلات، والتنبؤ بإخراج التفاعلات مروج التنظيمية. استخدام إنزيمات التقييد مع 4 مواقع الاعتراف بي بي يخفف من هذه المسألة ولكن يأتي على حساب إلى حد كبير زيادة تعقد مكتبة مرحبا-ج (مرحبا-ج المكتبات التي تم إنشاؤها مع bp 4 الاعتراف بموقع تقييد الإنزيمات 100 مرة على الأقل أكثر تعقيداً من مرحبا-ج المكتبات التي تم إنشاؤها مع الاعتراف بي بي 6 موقع تقييد الإنزيمات)، والتكاليف المتعلقة بتسلسل الجيل القادم.

قيد آخر أن البروتوكول شارتر-C الحالي يتطلب ملايين خلايا كبداية المواد، النافية لتحليل التفاعلات المروج في أنواع الخلايا النادرة. نسخة معدلة من شارتر-C لتمكين التحقيق جهات المروج في السكان خلية مع 10,000 إلى 100,000 الخلايا (على سبيل المثال الخلايا أثناء النمو الجنيني المبكر أو الخلايا الجذعية المكونة للدم) سيكون ذلك إضافة قيمة إلى الاستيلاء على ج صندوق الأدوات.

وأخيراً، مثل جميع الأساليب التي تعتمد على تثبيت فورمالدهايد، شارتر-ج السجلات فقط التفاعلات 'المجمدة' عند نقطة وقت التثبيت. وهكذا، لدراسة حركية وديناميات التفاعل المروج، أساليب مثل القرار فائقة خلية حية مجهرية مطلوبة جنبا إلى جنب مع جيم شارتر

أساليب تشريح المنظمة كروموسوم المكاني بدقة عالية

ويحظر الشاسعة تعقيد التفاعل الصبغية المكتبات تحديد منتجات التفاعل بين اثنين من شظايا قيود محددة مع دلالة إحصائية موثوق بها. وقد استخدمت التقاط تسلسل للتحايل على هذه المشكلة، إثراء مرحبا-ج33،34،،من4044 أو مكتبات51 50،ج 3 لتفاعلات معينة. والميزة الرئيسية لاستخدام مكتبات مكتبات ما يزيد على 3 ج ج مرحبا لخطوة تخصيب اليورانيوم أن يشمل مرحبا-ج، على عكس ج 3، خطوة تخصيب اليورانيوم لمنتجات ربط حقيقي. نتيجة لذلك، النسبة المئوية لقراءة صحيحة في مكتبات شارتر-C حوالي 10 إضعاف أعلى مما في التقاط-C يقرأ المكتبات50، التي تتضمن حوالي 5 – 8% صالحة بعد تصفية HiCUP. وقد مقارنة سالين et al. مباشرة ج القبض على هيكاب، الذي مثل شارتر ج يستخدم مكتبات C مرحبا لإثراء الالتقاط، خلافا لالتقاط-C الذي يستخدم مكتبات ج 3. واتساقا مع النتائج التي توصلنا إليها، وجدوا أن المكتبات التقاط-C هي تتألف أساسا من الشظايا الواصلة الأمم المتحدة40. وبالإضافة إلى ذلك، قد مكتبات هيكاب تعقيد أعلى من التقاط-C مكتبات40.

البديل من التقاط-ج، دعا جيل التقاط-ج52 (نغ التقاط-ج) يستخدم اليغو واحد كل نهاية جزء التقييد، كما حددت سابقا في شارتر-ج33،34، بدلاً من التداخل المسابر المستخدمة في النص الأصلي بروتوكول التقاط-ج50. هذا يؤدي إلى زيادة النسبة المئوية لصالح ما يلي مقارنة لالتقاط-ج متواضعة، لكن نغ التقاط-ج توظف جولتين متسلسلة من القبض على تخصيب اليورانيوم، ودورات عدد كبير نسبيا من بكر (دورات 20 إلى 24 في المجموع، مقارنة 11 دورات عادة شارتر-c)، الذي النتائج حتما في ارتفاع إعداد تسلسل تكرارات وانخفاض المكتبة تعقد. في تجارب للمحاكمة خلال الاستفادة المثلى من شارتر-ج، وجدنا أن النسبة المئوية لفريدة من نوعها (أي، لا تتكرر) قراءة أزواج كان فقط حوالي 15% عندما كنا 19 بكر دورات (13 دورات ما قبل التقاط + 6 دورات ما بعد التقاط؛ البيانات لا تظهر)، ومع ذلك عادة غلة الأمثل لعدد أقل من دورات بكر، 75 – 90% أزواج قراءة فريدة من نوعها. وهكذا، خفض عدد دورات بكر إلى حد كبير يزيد من كمية البيانات تسلسل الزاخر بالمعلومات.

يجمع أسلوب الأخيرة رقاقة مع مرحبا-ج إلى التركيز على التفاعلات الصبغية وساطة من بروتين محددة من الفائدة (هيتشيب53). الحيوانات الأليفة شيا54، الذي يستند إلى أساس منطقي مماثلة، بالمقارنة مع البيانات هيتشيب تحتوي على عدد أكبر من ما يلي تسلسل الزاخر بالمعلومات، مما يسمح للتفاعل العالي الثقة استدعاء53. أنها سوف تكون مثيرة جداً للاهتمام لمقارنة مباشرة هيتشيب المقابلة ومجموعات البيانات التقاط مرحبا-ج مرة تصبح متوفرة (على سبيل المثال هيتشيب استخدام جسم مضاد ضد Smc1a الوحدة كوسين53 مع التقاط مرحبا جيم لجميع Smc1a ملزمة التقييد الشظايا) جنبا إلى جنب. هو أحد الفرق الأصيل بين هذين النهجين أن التقاط مرحبا-ج لا تعتمد على إيمونوبريسيبيتيشن الكروماتين، وذلك هو قادر على استجواب التفاعلات صبغية بغض النظر عن شغل البروتين. وهذا يمكن مقارنة لمنظمة الجينوم ثلاثية الأبعاد في وجود أو عدم وجود عامل محدد ملزم، كما استخدمت لتحديد PRC1 كمنظم رئيسي للماوس ESC الجينوم المكانية العمارة7.

ج شارتر وجواس

الرابطة على نطاق الجينوم (جوس) وقد كشفت الدراسات أن أكثر من 95% من الأمراض المرتبطة بتسلسل المتغيرات تقع في مناطق غير ترميز الجينوم، في كثير من الأحيان مسافات كبيرة للجينات ترميز البروتين55. غالباً ما تكون المتغيرات جوس وجدت بالقرب من الدناز أنا مواقع شديدة الحساسية، ومن السمات مميزة لتسلسل مع النشاط التنظيمي المحتملة. شارتر-C و C مرحبا التقاط قد استخدمت على نطاق واسع لربط المروجين لمواضع الخطر جوس ضالعة في سرطان الثدي44،48من سرطان القولون والمستقيم وأمراض المناعة الذاتية35،،من4546. دراسة شارتر سي 17 الخلية المكونة للدم البشري المختلفة عشر وجدت أنواع بطانات المرتبطة بأمراض المناعة الذاتية قد أثري في المتحقق في الخلايا اللمفاوية، بينما كان تسلسل المتغيرات المرتبطة بسمات محددة الصفائح الدموية وخلايا الدم الحمراء في الأغلب في الضامة واريثروبلاستس، على التوالي35،56. وهكذا، المروج محددة نوع الأنسجة إينتيراكتوميس كشف عنها شارتر سي قد تساعد على فهم الوظيفة غير الترميز المرتبطة بالمرض تسلسل المتغيرات وتحديد جينات المرض محتملة جديدة للتدخل العلاجي.

خصائص مناطق التفاعل المروج

ربط عدة أسطر من الأدلة إينتيراكتوميس المروج للتحكم في التعبير الجيني. أولاً، أظهرت العديد من الدراسات شارتر-ج أن مناطق الجينوم التفاعل مع المروجين للجينات (عالية) أعرب هي أثري في العلامات المرتبطة بالنشاط محسن، مثل أسيتيليشن H3K27 و p300 ملزم33،34 , 37-وجدنا علاقة متبادلة إيجابية بين مستوى التعبير الجيني والعدد من القدرة على التفاعل، مما يوحي بأن الآثار المضافة تؤدي القدرة على التعبير الجيني زيادة المستويات34،35. ثانيا، تحدث بشكل طبيعي التعبير يتم إثراء الصفات الكمية المكاني (اقتلس) في المتحقق المتصلة بالجينات نفس التعبير الذي يتأثر اقتلس35. ثالثا، بإدماج الرحلة57 وبيانات شارتر-ج، وجد كيرنز et al. أن رحلة مراسل الجينات رسم الخرائط المتحقق في بتوليدا الماوس تظهر مراسل أقوى التعبير الجيني من الجينات مراسل في مواقع التكامل في المناطق غير مروج التفاعل 58، مما يشير إلى أن تمتلك المتحقق النسخي نشاط تنظيمي. وتوحي هذه النتائج معا، أن إينتيراكتوميس المروج التي كشف عنها شارتر-C في الماوس ومختلف أنواع الخلايا البشرية وتشمل الوحدات التنظيمية الرئيسية للتحكم في التعبير الجيني.

تجدر الإشارة إلى أن القدرة على تمثل فقط نسبة ضئيلة (~ 20 ٪) من جميع المتحقق كشف عنها شارتر-ج33،34. يمكن أن يكون المتحقق الأدوار الهيكلية أو طوبولوجي بدلاً من مباشرة المهام التنظيمية النسخي. ومع ذلك، هناك أيضا أدلة أن شارتر-C قد كشف عناصر الحمض النووي مع الوظيفة التنظيمية التي لا تأوي علامات محسن الكلاسيكية. وفي خط خلية اللمفاوية بشرية، وجد المروج BRD7 للتفاعل مع منطقة تخلو من علامات محسن التي اتضح أن تمتلك النشاط محسن في فحوصات الجينات مراسل33. العناصر التنظيمية ذات خصائص مماثلة قد تكون أكثر وفرة من يقدر حاليا. على سبيل المثال، علامات شاشة المستندة إلى كريسبر للحمض النووي العناصر المحددة غير موسومة التنظيمية العناصر التنظيمية (آريس) التحكم في التعبير الجيني ولكنها خالية من محسن59.

وفي حالات أخرى، أظهرت المتحقق إيواء علامات الكروماتين المرتبطة بالقمع النسخي. شارك المتحقق والمروجين المتفاعلة ملزمة ب PRC1 في بتوليدا الماوس في شبكة واسعة النطاق المكاني مكبوتة الجينات تحمل القمعية مناسبة H3K27me37. في الخلايا البشرية ليمفوبلاستويد، وقمع عنصر بعيدة التفاعل مع المروج BCL6 التحوير مراسل الجينات التعبير33، مما يوحي بأنها قد تعمل على قمع النسخ BCL6 في سياقه الأصلي.

المتحقق في إثراء لشغل البروتين عازل الكروماتين كتكف في بتوليدا ونيكس البشرية37 قد تمثل فئة أخرى من المتحقق. جماعياً، توحي هذه النتائج أن المتحقق إيواء مجموعة من الجينات الأنشطة التنظيمية بعد تتسم وظيفيا.

Disclosures

ليس لها علاقة بالكشف عن المؤلف.

Acknowledgments

ونحن نشكر ماليشيفا فاليرييا لقراءة نقدية من المخطوطات ومساعدة الخبراء في الشكل 1. تم دعم هذا العمل بمجلس البحوث الطبية، والمملكة المتحدة (MR/L007150/1) والمملكة المتحدة التكنولوجيا الأحيائية ومجلس بحوث العلوم البيولوجية، المملكة المتحدة (BB/J004480/1).

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Fetal bovine serum (FBS) sterile filtered Sigma  F9665
Low-retention filter tips  Starlab S1180-3810, S1180-1810, S1180-8810 and S1182-1830
10x PBS pH 7.4 Life Technologies 70011-036
Molecular biology grade water Sigma-Aldrich W4502
1 M Tris-HCl pH 8.0 Life Technologies 15568-025
IGEPAL CA-630  Sigma-Aldrich I8896
5 M NaCl  Life Technologies 24740-011
Protease inhibitor cocktail (EDTA-free)  Roche Diagnostics 11873580001
Restriction buffer 2 (10x NEBuffer 2) New England Biolabs B7002
DNA LoBind tube, 1.5 mL  Eppendorf 0030 108.051
DNA LoBind tube, 2 mL Eppendorf 30108078
20% (wt/vol) SDS   Bio-Rad Laboratories 161-0418
20% (vol/vol) Triton X-100  Sigma-Aldrich T8787
HindIII, 100 U/uL New England Biolabs R0104
10 mM dCTP  Life Technologies 18253-013
10 mM dGTP Life Technologies 18254-011
10 mM dTTP  Life Technologies 18255-018
0.4 mM Biotin-14-dATP Life Technologies 19524-016
DNA polymerase I large (Klenow) fragment 5000 units/mL New England Biolabs M0210
10x T4 DNA ligase reaction buffer  New England Biolabs B0202
100x 10mg/ml Bovine Serum Albumin  New England Biolabs B9001
T4 DNA ligase, 1 U/μL  Invitrogen 15224-025
RNase A  Roche 10109142001
Proteinase K, recombinant, PCR grade  Roche 3115836001
20 000×g 50 ml centrifuge tube VWR 525-0156
0.5 M EDTA pH 8.0  Life Technologies 15575-020
Phenol pH 8.0  Sigma P4557
Phenol: Chloroform: Isoamyl Alcohol 25:24:1  Sigma P3803
Sodium acetate pH 5.2  Sigma S7899
Quant-iT PicoGreen  Invitrogen P7589
QIAquick Gel Extraction Kit Qiagen 28704
QIAquick PCR Purification Kit Qiagen 28104
Restriction buffer 2.1 (10x NEBuffer 2.1) New England Biolabs B7202
NheI, 100U/uL New England Biolabs R0131
Micro TUBE AFA Fiber Pre-slit snap cap 6x16mm vials  Covaris 520045 For sonication
SPRI beads (Agencourt AMPure XP)  Beckman Coulter A63881
Dynabeads MyOne Streptavidin C1 beads  Invitrogen 65001
Tween 20  Sigma P9416
10 mM dATP  Life Technologies 18252-015
T4 DNA polymerase 3000 units/mL New England Biolabs M0203
T4 PNK 10000 units/mL New England Biolabs M0201
Klenow exo minus 5000 units/mL  New England Biolabs M0212
Quick ligation reaction buffer  New England Biolabs B6058
NEB DNA Quick ligase  New England Biolabs M2200
PE adapter 1.0 (5'-P-GATCGGAAGAGCGGTTCAGC
AGGAATGCCGAG-3')
Illumina
PE adapter 2.0 (5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3')
Illumina
NEB Phusion PCR kit  New England Biolabs M0530
PE PCR primer 1.0 (5'-AATGATACGGCGACCACCGA
GATCTACACTCTTTCCCTAC
ACGACGCTCTTCCGATCT-3')
Illumina
PE PCR primer 2.0 (5'-CAAGCAGAAGACGGCATACGA
GATCGGTCTCGGCATTCCT
GCTGAACCGCTCTTCCGATCT-3') 
Illumina
PCR strips  Agilent Technologies 410022 and 401425
SureSelect SSEL TE Reagent ILM PE full adaptor kit  Agilent Technologies 931108
SureSelect custom 3-5.9 Mb library  Agilent Technologies 5190-4831 custom design mouse or human PCHi-C system
Dynabeads MyOne Streptavidin T1 beads  Invitrogen 65601
E220  high-performance focused ultra-sonicator Corvaris E220

DOWNLOAD MATERIALS LIST

References

  1. Osborne, C. S., et al. Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics. 36, 1065-1071 (2004).
  2. Schoenfelder, S., et al. Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells. Nature Genetics. 42, 53-61 (2010).
  3. de Wit, E., et al. The pluripotent genome in three dimensions is shaped around pluripotency factors. Nature. 501, 227-231 (2013).
  4. Bantignies, F., et al. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell. 144, 214-226 (2011).
  5. Engreitz, J. M., et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 341, 1237973 (2013).
  6. Denholtz, M., et al. Long-range chromatin contacts in embryonic stem cells reveal a role for pluripotency factors and polycomb proteins in genome organization. Cell Stem Cell. 13, 602-616 (2013).
  7. Schoenfelder, S., et al. Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome. Nature Genetics. 47, 1179-1186 (2015).
  8. Kundu, S., et al. Polycomb Repressive Complex 1 generates discrete compacted domains that change during differentiation. Molecular Cell. 65, 432-446 (2017).
  9. Skok, J. A., Gisler, R., Novatchkova, M., Farmer, D., de Laat, W., Busslinger, M. Reversible contraction by looping of the Tcra and Tcrb loci in rearranging thymocytes. Nature Immunology. 8, 378-387 (2007).
  10. Zhang, Y., et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 148, 908-921 (2012).
  11. Aymard, F., et al. Genome-wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nature Structural & Molecular Biology. 24, 353-361 (2017).
  12. Ryba, T., et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Research. 20, 761-770 (2010).
  13. Pope, B. D., et al. Topologically associating domains are stable units of replication-timing regulation. Nature. 515, 402-405 (2014).
  14. Chandra, T., et al. Global reorganization of the nuclear landscape in senescent cells. Cell Reports. 10, 471-483 (2015).
  15. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y. F., Fraser, P. Long-range chromatin regulatory interactions in vivo. Nature Genetics. 32, 623-626 (2002).
  16. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Molecular Cell. 10, 1453-1465 (2002).
  17. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., Shiroishi, T. Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription. Developmental Cell. 16, 47-57 (2009).
  18. Zuniga, A., et al. Mouse limb deformity mutations disrupt a global control region within the large regulatory landscape required for Gremlin expression. Genes & Development. 18, 1553-1564 (2004).
  19. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M., Shiroishi, T. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development. 132, 797-803 (2005).
  20. D'Haene, B., et al. Disease-causing 7.4 kb cis-regulatory deletion disrupting conserved non-coding sequences and their interaction with the FOXL2 promotor: implications for mutation screening. PLoS Genet. 5, e1000522 (2009).
  21. Sur, I. K., et al. Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors. Science. 338, 1360-1363 (2012).
  22. Herranz, D., et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nature Medicine. 20, 1130-1137 (2014).
  23. Deng, W., et al. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell. 149, 1233-1244 (2012).
  24. Groschel, S., et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell. 157, 369-381 (2014).
  25. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  26. Franke, M., et al. Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 538, 265-269 (2016).
  27. Dekker, J., Rippe, K., Dekker, M., Kleckner, N. Capturing chromosome conformation. Science. 295, 1306-1311 (2002).
  28. Simonis, M., et al. Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nature Genetics. 38, 1348-1354 (2006).
  29. Zhao, Z., et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nature Genetics. 38, 1341-1347 (2006).
  30. Dostie, J., et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements. Genome Research. 16, 1299-1309 (2006).
  31. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  32. Belton, J. M., McCord, R. P., Gibcus, J. H., Naumova, N., Zhan, Y., Dekker, J. Hi-C: a comprehensive technique to capture the conformation of genomes. Methods. 58, 268-276 (2012).
  33. Mifsud, B., et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nature Genetics. 47, 598-606 (2015).
  34. Schoenfelder, S., et al. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 25, 582-597 (2015).
  35. Javierre, B. M., et al. Lineage-specific genome architecture links enhancers and non-coding disease variants to target gene promoters. Cell. 167, 1369-1384 (2016).
  36. Wilson, N. K., et al. Integrated genome-scale analysis of the transcriptional regulatory landscape in a blood stem/progenitor cell model. Blood. 127, e12-e23 (2016).
  37. Freire-Pritchett, P., et al. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells. Elife. 6, (2017).
  38. Rubin, A. J., et al. Lineage-specific dynamic and pre-established enhancer-promoter contacts cooperate in terminal differentiation. Nature Genetics. 49, 1522-1528 (2017).
  39. Siersbaek, R., et al. Dynamic rewiring of promoter-anchored chromatin loops during adipocyte differentiation. Molecular Cell. 66, 420-435 (2017).
  40. Sahlen, P., et al. Genome-wide mapping of promoter-anchored interactions with close to single-enhancer resolution. Genome Biology. 16, 156 (2015).
  41. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  42. Nagano, T., Varnai, C., Schoenfelder, S., Javierre, B. M., Wingett, S. W., Fraser, P. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  43. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Res. 4, 1310 (2015).
  44. Dryden, N. H., et al. Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research. 24, 1854-1868 (2014).
  45. Martin, P., et al. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci. Nature Communications. 6, 10069 (2015).
  46. McGovern, A., et al. Capture Hi-C identifies a novel causal gene, IL20RA, in the pan-autoimmune genetic susceptibility region 6q23. Genome Biol.ogy. 17, 212 (2016).
  47. Hodge, D., et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 107, 3359-3370 (2006).
  48. Jager, R., et al. Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci. Nature Communications. 6, 6178 (2015).
  49. Joshi, O., et al. Dynamic reorganization of extremely long-range promoter-promoter Interactions between two states of pluripotency. Cell Stem Cell. 17, 748-757 (2015).
  50. Hughes, J. R., et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nature Genetics. 46, 205-212 (2014).
  51. Kolovos, P., et al. Targeted Chromatin Capture (T2C): A novel high-resolution high-throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin. 7, 10 (2014).
  52. Davies, J. O., et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nature Methods. 13, 74-80 (2016).
  53. Mumbach, M. R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  54. Fullwood, M. J., et al. An oestrogen-receptor-alpha-bound human chromatin interactome. Nature. 462, 58-64 (2009).
  55. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, 1190-1195 (2012).
  56. Petersen, R., et al. Platelet function is modified by common sequence variation in megakaryocyte super enhancers. Nat. Commun. 8, 16058 (2017).
  57. Akhtar, W., et al. Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell. 154, 914-927 (2013).
  58. Cairns, J., et al. CHiCAGO: Robust detection of DNA looping interactions in Capture Hi-C data. Genome Biology. 17, 127 (2016).
  59. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, 167-174 (2016).
مروج التقاط مرحبا c: عالية الاستبانة، وعلى نطاق الجينوم التنميط التفاعلات المروج
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).More

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter