Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Genetics

Promotor Capture Hej-C: Høj opløsning, Genome-wide profilering af promotor interaktioner

doi: 10.3791/57320 Published: June 28, 2018
* These authors contributed equally

Summary

DNA regulerende elementer, såsom smagsforstærkere, kontrollerer genekspression ved fysisk at kontakte target gen initiativtagere, ofte gennem langtrækkende kromosom vekselvirkninger der spænder over stor genomisk afstande. Promotor fange Hi-C (PCHi-C) identificerer betydningsfulde vekselvirkninger mellem projektledere og distale regioner, gør det muligt for tildelingen af potentielle regulerende sekvenser til deres mål gener.

Abstract

Den tredimensionale organisation af genomet er knyttet til dens funktion. For eksempel, styre regulerende elementer såsom transcriptional smagsforstærkere den spatio-temporale udtryk for deres mål gener gennem fysisk kontakt, ofte bridging betydeligt (i nogle tilfælde hundredvis af kilobases) genomisk afstande og omgåelse nærliggende gener. Det menneskelige genom havne en anslået en million smagsforstærkere, hvoraf langt størstedelen har ukendte gen mål. Tildele distale lovgivningsmæssige områder til deres mål gener er således afgørende at forstå gen expression kontrol. Vi udviklede promotor fange Hi-C (PCHi-C) til at aktivere genome-wide påvisning af distale promotor-interagere regioner (PIRs), for alle projektledere i et enkelt eksperiment. I PCHi-C, er meget komplekse Hi-C biblioteker specifikt beriget til promotor sekvenser gennem i løsning hybrid udvalg med tusinder af biotinylated RNA lokkemad supplement til enderne af alle promotor-holdige begrænsning fragmenter. Formålet er at derefter pull-down promotor sekvenser og deres hyppig interaktion partnere såsom smagsforstærkere og andre potentielle regulerende elementer. Efter høj overførselshastighed parret ende sekventering påføres en statistisk test hver promotor-forbundet begrænsning fragment at identificere væsentlige PIRs på fragment begrænsningsniveau. Vi har brugt PCHi-C til at generere en atlas af langtrækkende promotor interaktioner i snesevis af mennesker og mus celletyper. Disse promotor interactome kort har bidraget til en større forståelse af pattedyr gen expression kontrol ved at tildele formodede lovgivningsmæssige områder til deres mål gener og afslørende præferentielle rumlige promotor-promotor interaktion netværk. Denne information også har høj relevans til forståelsen af menneskets genetiske sygdom og identifikation af potentielle sygdomsgener, ved at sammenkæde ikke-kodende sygdom-associerede sekvens varianter i eller i nærheden af styringsforløb til deres mål gener.

Introduction

Akkumulere beviser tyder på, at den tredimensionale organisation af genomet spiller en vigtig funktionelle rolle i en række nukleare processer, herunder gen aktivering1,2,3, undertrykkelse4 ,5,6,7,8, rekombination9,10, DNA reparation11, DNA replikation12,13, og cellulære gulne14. Fjern smagsforstærkere er fundet i geografisk nærhed til initiativtagerne de regulerer15,16,17, som er afgørende for korrekt spatio-temporale gen expression kontrol. Forstærker sletninger vis at distale smagsforstærkere er afgørende for target gen transskription18,19,20,21,22, og "tvungen kromatin looping" viser, manipuleret tethering mellem en forstærker og dens mål initiativtager i Ulla locus er tilstrækkelig til at drive transcriptional aktivering23. Yderligere, genome rearrangementer, der bringer gener under kontrol af ektopiske smagsforstærkere kan resultere i uhensigtsmæssige genaktivering og sygdom24,25,26. Sammen, illustrerer disse eksempler at promoter-forstærker interaktioner er afgørende for gen kontrol og kræver stram regulering at sikre relevant genekspression. Menneskelige og mus genomer skønnes hver havnen omkring en million smagsforstærkere. For langt de fleste af disse smagsforstærkere, target gener er ukendt, og 'regler for magtanvendelse' mellem projektledere og smagsforstærkere er dårligt forstået. Tildele transcriptional smagsforstærkere til deres mål gener således fortsat en stor udfordring i afkodningen pattedyr gen expression kontrol.

Blevet revolutioneret vores forståelse af tre-dimensionelle genom arkitektur af indførelsen af 3C27 (kromosom kropsbygning capture) og dens varianter28,29,30,31 . Den mest magtfulde af disse teknikker, Hi-C (høj overførselshastighed kromosom kropsbygning capture) er designet til at identificere den hele ensemble af kromosom vekselvirkninger i en celle population. Hej-C biblioteker, typisk genereres fra millioner af celler, er yderst komplekse med en anslået 1011 uafhængige ligatur produkter mellem ~ 4 kb fragmenter i det menneskelige genom32. Som en konsekvens, pålidelig og reproducerbar identifikation af interaktioner mellem individuelle begrænsning fragmenter (f.eks. dem, der indeholder en promotor eller forstærker) fra er Hi-C data ikke mulig, medmindre Hi-C biblioteker udsættes for ultra-dybe sekventering, der er ikke en økonomisk levedygtig løsning for laboratorier forbereder Hi-C biblioteker rutinemæssigt. For at omgå denne mangel, udviklet vi promotor fange Hi-C for at specifikt berige promotor-holdige ligatur produkter fra Hi-C biblioteker. Vi fokuserede på initiativtagerne af to grunde. Først, promoter-forstærker kontakter har vist sig at være afgørende for ordentlig gen expression niveauer i talrige undersøgelser (Se henvisninger ovenfor), og for det andet, som initiativtagere er i vid udstrækning invariant mellem celletyper, det samme fange agn system kan bruges til at forhøre den lovgivningsmæssige kredsløb på tværs af flere celletyper og betingelser. Vores tilgang bygger på-løsning hybridisering af Hi-C biblioteker med titusinder af biotinylated RNA 120mers supplerer promotor-holdige Hi-C ligatur produkter og efterfølgende opsamling på streptavidin-belagt magnetiske perler. Dette resulterer i PCHi-C biblioteker med meget reduceret kompleksitet i forhold til den oprindelige Hi-C library, fokuserer kun på identifikation af fragmenter, der er forbundet til projektledere på betydeligt høje frekvenser.

Vi har brugt PCHi-C i en række menneskelige og mus celletyper til at bidrage til en bedre forståelse af gen expression kontrol af afsløring langtrækkende distale promotor interagerende regioner med formodede regulativfunktionen, såvel som ikke-tilfældige promotor-initiativtageren kontakter i de tre-dimensionelle rum af kernen. Undersøgelserne har kortlagt hundredtusindvis af promoter-forstærker kontakter på tværs af adskillige celle typer33,34,35,36,37,38, 39, identificeret Polycomb Repressive komplekse-medieret rumlige genom organisation i mus embryonale stamceller7, påvist store rewiring af promotor interactomes under Celledifferentiering37, 38 , 39og sammenkædet ikke-kodende sygdom-associerede sekvens varianter til gen initiativtagere35.

PCHi-C er en velegnet metode til at knytte genome-wide ensemble af DNA-sekvenser interagere med initiativtagere. Relaterede tilgange, såsom fange Hi-C af kontinuerlig genomisk områder (Se diskussion) er metoden for valget mellem at få høj opløsning interaktion profiler for valgte genomisk regioner. PCHi- og fange Hi-C er meget lignende fra en eksperimentel synspunkt (den eneste forskel er valget af capture system), således at de råd og retningslinjer vi leverer er gældende for begge tilgange. Vi præsenterer her, en detaljeret beskrivelse af PCHi-C. Vi skitsere rationale og design af et PCHi-C eksperiment, giver en trinvis PCHi-C bibliotek generation protokol og illustrere, hvordan kvaliteten af PCHi-C biblioteker kan kontrolleres på forskellige trin i protokollen til udbytte data af høj kvalitet.

Protocol

1. formaldehyd fiksation

  1. Celle forberedelse: Start med et minimum af 2 x 107 celler pr. eksperiment.
    1. Celler dyrkes i kultur, resuspend celler i dyrkningsmediet. For ex vivo celler, resuspend i 1 x Dulbeccos modificerede Eagle Medium (DMEM), suppleret med 10% (vol/vol) føtal bovint serum (FBS).
    2. For vedhængende celler, fjerne næringssubstrat og Tilføj 30.625 mL frisk medium med 10% (vol/vol) FBS ved stuetemperatur (RT; 20 – 25 ° C).
    3. For suspension celler, indsamle og centrifugeres celler på 400 x g og 20 ° C i 3 min. Fjern supernatanten og genopslæmmes celle pellet i 30.625 mL medium med 10% (vol/vol) FBS på RT.
    4. Solid væv, bruge trypsin (0,05% til 2,5% endelige koncentration, afhængigt af celletype) eller dounce homogenisering for at få en enkelt cellesuspension. Efter dette ekstra skridt, behandle celler som suspension celler.
  2. Tilføje 4.375 mL af 16% methanol-fri PARAFORMALDEHYD (åben ampul lige før at bruge) til en slutkoncentration på 2% (vol/vol). Rettelse til 10 min på RT med blide blanding på en rocker.
    Forsigtig: PARAFORMALDEHYD er et farligt kemikalie. Følg de relevante sundheds- og forordninger.
  3. Dæmpning reaktion ved tilsætning af 5 mL af frisklavede 1 M iskold glycin. Bland i 5 min. med blid vuggende på RT, og derefter inkuberes i isbad i 15 min med lejlighedsvise invertere.
  4. Vask og indsamle fast celler.
    1. Vedhængende celler, Fjern supernatanten, der tilsættes 10 mL iskold 1 x PBS pH 7,4 på plade væggen og fjerne det. Der tilsættes 1 mL iskold 1 x PBS pH 7,4, indsamle celler ved hjælp af en celle skraber og overførsel til en 50 mL tube. Gentag to gange for at indsamle så mange celler som muligt. Tilføje iskold PBS til 50 mL endelige rumfang.
    2. For suspension celler, centrifuge celler på 760 x g og 4 ° C i 5 min, Fjern supernatanten, og genopslæmmes celle pellet i 50 mL iskold PBS pH 7,4.
  5. Centrifugeres celler på 400 x g og 4 ° C i 10 min og fjern forsigtigt supernatanten. Celle pellet kan være snap frosset i flydende nitrogen og efterfølgende opbevares ved-80 ° C i flere måneder.

2. celle Lysis

  1. Genopslæmmes celle pellet i 50 mL af frisklavede iskold lysisbuffer (10 mM Tris-HCl pH 8, 0,2% (vol/vol) Igepal CA-630, 10 mM NaCl, og én tablet protease hæmmer cocktail) og blandes. Der inkuberes i isbad i 30 min, bland lejlighedsvis af invertere. Centrifugeres kerner på 760 x g og 4 ° C i 5 min og Fjern supernatanten.

3. hindIII fordøjelsen

  1. Vask cellekerner med 1,25 x begrænsning buffer 2. Genopslæmmes celle pellet i 1 mL iskold 1,25 x begrænsning buffer 2 og overførsel til en 1,5 mL tube. Spin kerner på 760 x g og 4 ° C i 5 min og Fjern supernatanten.
  2. Genopslæmmes celle pellet i 1790 µL af 1,25 x begrænsning buffer 2. Gøre 5 delprøver, hver med 5-10 millioner celler i 358 µL af 1,25 x begrænsning buffer 2.
  3. Tilføje 11 µL af 10% (wt/vol) SDS pr. delprøve og ryste på 950 omdrejninger pr. min. (rpm) for 30 min. ved 37 ° C i en thermomixer. Hvis celle klumper vises, tage afstand af pipettering, undgå boblerne.
  4. Tilføje 75 µL af 10% Triton X-100 (vol/vol) pr. delprøve og ryste på 950 rpm og 37 ° C i 15 min i en thermomixer. Hvis celle klumper vises, tage afstand af pipettering, undgå boblerne.
  5. Tilføj 12 µL af 100 U/µL HindIII 100 (1.200 enheder i alt) pr. delprøve og inkuberes ved 37 ° C natten over (O/N) mens ryste på 950 rpm i en thermomixer.
    1. For kontrolelementet fordøjelsen overføre 25 µL af prøven (5 µL af hver delprøve) i en ny tube før du tilføjer enzym (ufordøjet kontrol) og Gentag samme procedure efter tilsætning af enzymet (fordøjet kontrol). Inkuber begge rør på samme måde som Hi-C-biblioteket.
  6. Den følgende morgen, tilsæt 5 µL af 100 U/µL HindIII (500 enheder i alt) pr. delprøve og inkuberes ved 37 ° C i 2 timer mens ryste på 950 rpm i en thermomixer.
  7. Fordøjelsen kontrol: for den fordøjede og ufordøjede kontrol (Se 3.5.1), udføre bitmapgenkendelse vending (trin 6), fenol: Chloroform udvinding og DNA nedbør (trin 7).
    1. Designe et par af primere, der strækker sig over en HindIII site. I samme region, designe et andet par af primere, der ikke strækker sig over en HindIII site. Design primere for kvantitativ PCR (Q-PCR) ved hjælp af Primer3 (http://bioinfo.ut.ee/primer3-0.4.0/) og følgende parametre:
      Primer størrelse: Optimal 20 (Min.: 18, Max.: 27); Primer Tm: Optimal 60 (Min.: 57, Max.: 63); Primer CG % indhold: Min.: 20, Max.: 80; Amplikon størrelse: RT-PCR ~ 100 bp (for konventionelle PCR ~ 300 bp); Mispriming bibliotek: menneskerettighederne (human primere) eller gnaver og enkel (mus primere).
    2. Udføre Q-PCR for at få 4 gennemsnitlig Cts (tærskel cyklus): Ct [D; H], fra fordøjet prøven [D] med par af primere, der strækker sig over en HindIII websted [H]; CT [D;-], fremstillet af fordøjet prøven [D] med par af primere, der ikke strækker sig over en HindIII websted [-]; CT [U; H], fra ufordøjet prøven [U] med par af primere, der strækker sig over en HindIII websted; CT [U;-], fremstillet af ufordøjet prøven [U] med par af primere, der ikke strækker sig over en HindIII websted [-]. Beregne procentdelen af fordøjelsen som: % fordøjelsen = 100-100/2(Ct[D,H]-Ct[D,-]) - (Ct[U,H]-Ct[U,-]).

4. Biotinylation om restriktion Fragment udhæng

  1. Forberede biotinylation master mix: 30.6 µL af 10 x begrænsning buffer 2, 10,2 µL af H2O (molekylær biologi klasse), 7,65 µL af 10 mM dCTP, 7,65 µL af 10 mM dGTP, 7,65 µL af 10 mM dTTP, 191.25 µL af 0,4 mM biotin-14-dATP og 51 µL af 5.000 U/mL DNA polymerase jeg store () Klenow) fragment.
  2. Tilsættes 60 µL biotinylation master mix pr. alikvot, mix, og der inkuberes ved 37 ° C i 1 h ryster på 700 omdrejninger i minuttet (thermomixer) for 5 s, hver 30 s. Efter 1 time, skal du placere delprøver på is.

5. i-kernen ligatur

  1. Forberede ligatur master mix: 510 µL af 10 x T4 DNA ligase buffer, 51 µL af 10 mg/mL bovint serumalbumin (100 x BSA), 1754.4 µL vand (molekylær biologi klasse), og 127.5 µL 1 U/µL T4 DNA ligase (Se Tabel af materialer).
  2. Tilføje 479 µL af ligatur master mix pr. alikvot mix og inkuberes ved 16 ° C i 4 h ryster på 700 rpm i 5 s hver 2 min i en thermomixer.
  3. Inkubér 30 min på RT.

6. bitmapgenkendelse tilbageførsel

  1. Kombinere alle delprøver i et 50 mL centrifugeglas (velegnet til high-speed centrifugering).
  2. Tilføje 62,5 µL af 10 mg/mL RNase A, mix, og Inkuber i 30 minutter ved 37 ° C.
  3. Tilsæt 300 µL af 10 mg/mL Proteinase K, mix, og Inkuber i 30 minutter ved 37 ° C.
  4. Inkuber reaktion O/N (eller mindst 4 h) på 65 ° C. Den følgende morgen, tilsæt 300 µL af 10 mg/mL Proteinase K, mix, og Inkuber i 1 time ved 65 ° C.

7. DNA oprensning

  1. Tilføj 4337.5 µL TLE buffer (10 mM Tris-HCl pH 8.0; 0,1 mM EDTA pH 8,0) og blandes.
  2. Tilføje 1 volumen (10 mL) fenol pH 8,0, vortex for 10 s, og der centrifugeres på RT og 20.000 x g til 3 min. Transfer 9 mL af den øverste (vandige) fase til en ny 50 mL tube.
    Forsigtig: Phenol er et farligt kemikalie. Følg de relevante sundheds- og forordninger.
  3. Der tilsættes 2 mL TLE buffer til de resterende vandfasen, vortex for 10 s og centrifugeres på RT og 20.000 x g i 3 min. Transfer 2,5 mL af den vandige fase ind i nye rør fra trin 7.2, hvilket gør den endelige rumfang 11,5 mL. Kassér rør indeholdende den lavere (økologiske) fase.
  4. Tilføje 1 volumen (11,5 mL) af phenol: chloroform: isoamyl alkohol (25:24:1), vortex for 10 s, og der centrifugeres på RT og 20.000 x g til 3 min. Transfer 11 mL af den øverste (vandige) fase til en ny 50 mL tube. Gentag trin 7.3. Den samlede prøve volumen vil nu være 13,5 mL.
  5. Tilføje 1,35 mL 3 M natrium acetat pH 5,2 og 33.75 mL iskold 100% ethanol, mix, og der inkuberes ved-80 ° C i 45 min eller alternativt natten ved-20 ° C.
  6. Der centrifugeres ved 4 ° C og 20.000 x g i 10 min., Fjern supernatanten, genopslæmmes pellet i 1 mL af frisklavede 70% (vol/vol) ethanol og overføre til en ny tube.
  7. Der centrifugeres ved 4 ° C og ved fuld hastighed i 3 min. i en benchtop centrifuge, så Fjern supernatanten.
  8. Genopslæmmes pellet i 1 mL af is kold 70% (vol/vol) ethanol og Gentag trin 7.7. Tør pellet ved 37 ° C i 10 min og genopslæmmes i 650 µL af TLE buffer. Fastslå DNA udbytte ved hjælp af et fluorescens-baseret analyse til kvantificering af dobbelt-strenget DNA.
    Bemærk: Protokollen kan være midlertidigt her af snap frysning og opbevaring af prøven ved-80 ° C i flere måneder eller ved-20 ° C i en kortere periode.

8. kvalitetskontrol

  1. Overvåge bibliotek integritet og ligatur af DNA elektroforese. Kør 200 ng af bibliotek på en 0,8% Agarosen/1 x TBE gel. DNA skal køre som et band over 10 kb.
  2. Registrere kendte celletype invariante korte - og lang - fritgående interaktioner ved konventionelle PCR. Brug 100 ng af DNA-template pr. PCR reaktionen. Design PCR-primere, tæt og mod begrænsningen websteder efter instruktionerne ovenfor (Se 3.7.1). Primer sekvenser for kvalitetskontrol af mus og menneskelige Hi-C biblioteker er angivet i tabel 1.
  3. Fill-in og ligatur kontrol: skåret ud gel bands der indeholder amplikoner fra styre 8.2, gel-ekstrakt DNA og bruge DNA som skabelon for 4 individuelle PCR reaktioner med identiske primer kombinationer.
    1. Rense amplikoner ved hjælp af en PCR rensning kit og kvantificere DNA-koncentrationen.
    2. Forberede hver amplikon i en endelige mængden af 15 µL fire fordøjelsen reaktioner (HindIII [en], NheI [b], HindIII + NheI [c] og ingen enzym [d]): 500 ng af amplikon, 1,5 µL af 10 x begrænsning buffer 2.1, 0,15 µL af 10 mg/mL bovint serumalbumin (100 x BSA) , og 0,1 µL (10 enheder) af enzymet (HindIII [en], NheI [b], HindIII + NheI [c] eller vand [d]).
    3. Fordøje i 1 timer ved 37 ° C, derefter køre fordøjelsen reaktioner på en 1,5% (wt/vol) Agarosen/1 x TBE gel.

9. DNA opsplitning

  1. Overføre 50,5 µg af prøven i en ny tube og tilføje TLE buffer til en endelige mængden af 655 µL. Split sample i 5 sonikering hætteglas (Se Tabel af materialer) ved at tilføje 130 µL af bibliotek (10 µg) til hvert hætteglas. Shear til en størrelse på ~ 400 bp i en ultra-sonikator (Se Tabel af materialer) ved hjælp af følgende parametre: pligt faktor: 10%; hændelse spidseffekt (w): 140; cyklusser pr. brast: 200; tid: 55 s.
  2. Indsamle sonicated prøve i en frisk 2 mL tube.

10. dobbeltsidet Sprinkler-perle størrelse udvælgelse

  1. Mix SPRI (fast fase Reversible immobilisering) perle løsning godt af invertere, overføres 1.85 mL perle løsning til en ny tube og bringe til RT i 15 min.
  2. Tilføje 350 µL vand (molekylær biologi klasse) til prøven (endelige rumfang 1 mL).
  3. Tilføje 600 µL af Sprinkler perle løsning til prøven (samlede volumen 1,6 mL; forholdet mellem SPRI løsning til DNA: 0,6 til 1), inkuberes i 5 min på RT og spin prøve i en benchtop centrifuge for 2-3 s at indsamle prøven.
  4. Åbn låget, prøven anbringes på magnetisk separation stå i 5 min, overførsel klart supernatanten ind i et nyt rør og kassér perler.
  5. Koncentrere SPRI perler for anden størrelse udvælgelse trin: overføre 930 µL af Sprinkler perler ind i en ny tube, sted i magnetisk separation stativet i 5 min og kassér klart supernatanten. Genopslæmmes perlerne i 310 µL af Sprinkler perle løsning.
  6. Tilføje 300 µL af koncentreret SPRI perler (trin 10.5) til prøven (samlet diskenhed 1,9 mL; forholdet SPRI løsning til DNA er nu 0,9 til 1), inkuberes ved RT i 5 min, og spin prøve i en benchtop centrifuge for 2-3 s. forsigtigt åbne låget , Læg røret på magnetisk separation stå i 5 min, og kassér supernatanten.
  7. Der tilsættes 1 mL af frisklavede 70% ethanol (vol/vol) til prøveglas på magnetisk separation stand, inkuberes i 30 s, og kassér supernatanten. Gentag to gange.
  8. Tør perler ved 37 ° C i en thermomixer (tube låg åbent) for ikke mere end 5 min. tilføje 300 µL TLE buffer til prøven, blandes og inkuberes i 10 min. ved stuetemperatur.
  9. Spin prøve i en benchtop centrifuge for 2-3 s, åbne låget og rør på den magnetisk separation stå i 5 min. overførsel Fjern supernatanten ind i et nyt rør og kassér perler.

11. biotin/Streptavidin Pull-down af ligatur produkter

  1. Forberede buffere: 1 x TB buffer (5mM Tris-HCl pH 8.0; 0,5 mM EDTA; 1 M NaCl; 0,05% Tween 20); 2 x NTB buffer (10 mM Tris-HCl pH 8.0; 1 mM EDTA; 2 M NaCl); 1 x NTB buffer (5 mM Tris-HCl pH 8.0; 0,5 mM EDTA, 1 M NaCl).
  2. Tilføje 200 µL af magnetisk streptavidin-kombineret perler (Se Tabel af materialer) ind i en ny tube, placere den i magnetisk separation stativet i 1 min og Fjern supernatanten.
  3. Vaske perlerne to gange med 500 µL 1 x TB buffer.
    1. For hver vask trin under biotin pull-down, ende reparation og fjernelse af biotin på ikke-forbundet DNA spidser, dATP hale og adapter ligatur trin, genopslæmmes perlerne i den tilsvarende buffer, rotere på RT og 15 rpm i 3 min, dreje røret i en benchtop centrifuge for 2-3 s, røret anbringes i magnetisk separation stativet i 3 min og Fjern supernatanten.
  4. Genopslæmmes perler i 300 µL af 2 x NTB buffer. Bland perler og prøve (600 µL samlede volumen) og inkuberes ved RT for 15 min på en roterende hjul på 3 rpm.
  5. Genvinde perler i magnetisk separation stativet i 3 min og fjern den klare supernatanten. Vaske perlerne to gange i 500 µL af 1 x NTB buffer første og derefter i 200 µL 1 x ligatur buffer. Genopslæmmes perlerne i 50 µL af 10 x ligatur buffer.

12. ende reparation og fjernelse af Biotin i ikke-forbundet DNA ender

  1. Kombinere prøve (50 µL i alt) med 50 µL af 2,5 mM dNTP mix (12,5 µL af 10 mM for hver dNTP), 18,1 µL af 3.000 U/mL T4 DNA Polymerase, 18,1 µL af 10.000 U/mL T4 PNK, 3,7 µL af 5.000 U/mL DNA polymerase jeg store (Klenow) fragment , og 360.1 µL af H2O.
  2. Blandes og inkuberes ved 20 ° C i 1 h, ryster 5 s på 700 rpm hver 2 min i en thermomixer.
  3. Genvinde perler på magnetisk separation stå, fjerne den klare supernatanten og vaske perlerne to gange i 500 µL 1 x TB buffer.
  4. Vaske perlerne i 500 µL af 1 x NTB buffer, efterfulgt af en vask i 500 µL af 1 x TLE.
  5. Genvinde perler på magnetisk separation stå, fjerne den klare supernatanten og genopslæmmes perler i 415 µL 1 x TLE buffer.

13. dATP hale

  1. Kombinere prøve (415 µL) med 50 µL af 10 x begrænsning buffer 2, 5 µL af 10 mM dATP og 30 µL af 5 U/µL Klenow exo-minus.
  2. Blandes og inkuberes ved 37 ° C i 30 min, ryster 5 s på 700 rpm hver 2 min i en thermomixer.
  3. Genvinde perler på magnetisk separation stå, fjerne den klare supernatanten og vaske perlerne to gange i 500 µL 1 x TB buffer.
  4. Vaske perlerne i 500 µL af 1 x NTB buffer.

14. adapter ligatur

  1. Vaske perlerne i 200 µL 1 x ligatur reaktion buffer (Se Tabel af materialer).
  2. Genopslæmmes perler i 200 µL 1 x ligatur reaktion buffer. Tilføj 4 µL DNA ligase (Se Tabel af materialer) og 16 µL af 15 µM pre udglødet PE adaptere (pre anneal PE adaptere ved at blande lige store mængder af PE adapter 1 og PE adapter 2 (begge på 30 µM) og inkubere for et par minutter på RT). Der inkuberes ved RT i 15 min.
  3. Genvinde perler på magnetisk separation stå, fjerne den klare supernatanten og vaske perlerne to gange i 500 µL 1 x TB buffer.
  4. Vaske perlerne i 500 µL af 1 x NTB buffer. Derefter, vask perler i 100 µL 1 x begrænsning buffer 2, genopslæmmes perler i 50 µL 1 x begrænsning buffer 2, og overføres til en ny tube.

15. Hej-C Library forstærkning

  1. Forberede PCR master mix: 100 µL af 5 x Phusion buffer; 6 µL af 25 µM PE PCR primer 1,0; 6 µL af 25 µM PE PCR primer 2.0; 14 µL af dNTP mix (10 mM hver); 6 µL af Phusion polymerase; 318 µL af H2O.
  2. Mix PCR master mix med perler (500 µL i alt), opdele i 10 delprøver af 50 µL og forstærke ved PCR ved hjælp af følgende betingelser:
    30s på 98 ° C
    7 cyklusser af: 10 s på 98 ° C; 30 s på 65 ° C; 30 s ved 72 ° C
    7 min. ved 72 ° C
  3. Indsamle PCR reaktioner i en ny tube, genvinde perler på magnetisk separation stå og overførsel supernatanten (500 µL) ind i et nyt rør.
  4. Rense bibliotek DNA ved hjælp af Sprinkler perler.
    1. Mix SPRI perler, overføre 460 µL af perler i en ny tube, og bringe til RT for 15 min. tilføje 450 µL af Sprinkler perler til PCR reaktioner (endelige rumfang 950 µL), inkuberes i 5 min på RT og spin prøve i en benchtop centrifuge for 2-3 s at indsamle prøven.
    2. Åbn låget, prøven anbringes på magnetisk separation stå i 5 min, og Fjern supernatanten.
    3. At holde perlerne på magnetisk separation stand, tilsættes 1 mL af 70% ethanol (vol/vol) at prøve rør over et område fri af perler, orlov for 30 s, og kassér supernatanten.
    4. Gentag trin 15.4.3 to gange mere.
    5. Tør perler ved 37 ° C i en thermomixer (tube låg åbent) for ikke mere end 5 min.
    6. Tilføje 51 µL af TLE buffer til prøven, mix, og der inkuberes i 10 min. ved 37 ° C, rysten på 950 rpm i en thermomixer.
    7. Spin prøve i en benchtop centrifuge for 2-3 s, åbne låget og rør på den magnetisk separation stå i 5 min. overførsel Fjern supernatanten ind i et nyt rør og kassér perler.
    8. Kvantificere koncentrationen af Hi-C-biblioteket. Efter 7 runder af PCR-amplifikation får vi rutinemæssigt 500-1.500 ng af Hi-C-biblioteket.

16. hybrid i løsning opsamling

Bemærk: Blokering og buffer (SHS1-4) løsningerne nedenfor er fra SureSelect kit (Se Tabel af materialer).

  1. Overførsel 500 ng til 1 µg af Hi-C-bibliotek til en ny tube og fordampe prøve på et vakuum koncentrator (Se Tabel af materialer, 45 ° C, vakuum pres: niveau 30,0, rampe 5) indtil tør.
  2. Genopslæmmes fordampet Hi-C-biblioteket ved at tilføje 3,6 µL af H2O (molekylær biologi klasse), 2,5 µL af blocker 1, 2,5 µL af blocker 2 og 0,6 µL af brugerdefinerede blocker.
  3. Overføre prøven til et godt af en ny PCR rør stribe, lukke med en PCR cap strip og Anbring på is. Etiket som "D" (for Hej-C DNA).
  4. Forberede hybridisering buffer: 12,5 µL af SHS1 buffer; 0,5 µL af SHS2 buffer; 5 µL af SHS3 buffer; 6.5 µL af SHS4 buffer.
  5. Der inkuberes ved 65 ° C i 5 min i en thermomixer. Overførsel i en brønd på en ny PCR rør bånd, lukke med en PCR cap strip og holde på RT. etiket som "H" (for hybridisering buffer).
  6. I en brønd på en ny PCR rør bånd, mix 5 µL af 100 ng/µL biotinylated RNA-sonder (butikken på-80 ° C og tø på isen lige før brug); 0,5 µL af SRNase B (RNase hæmmer) og 1,5 µL af H2O (molekylær biologi klasse).
  7. Luk PCR rør strip med en PCR cap stribe og sted på is. Etiket som "R" (i RNA).
  8. Opsætning af PCR maskine ved hjælp af følgende parametre:
    5 min. ved 95 ° C; 25 h ved 65 ° C; låg opvarmes; 29 µL PCR reaktion volumen.
    Bemærk: Gå videre så hurtigt som muligt under alle procedurer mens PCR-maskine kører for at undgå prøve fordampning.
  9. Placere "D" PCR rør strip i PCR-maskine, Luk PCR maskine låg, og start PCR reaktionen. Når PCR programmet når 65 ° C, åbne PCR maskine låg og placere "H" PCR rør strimlen i PCR-maskine. Luk PCR maskine låget og Inkuber i 3 min. Open PCR maskine låg, sted "R" PCR rør strip på PCR-maskine, og luk PCR-maskine.
  10. Efter 2 min, åbne PCR maskine låg og alle PCR rør strimler. Overføre 13 µL af godt "H" i godt "R", så alle volumen af godt "D" til godt "R". Med pipette overfoeres op og ned 3 gange at blande reaktionen, lukke PCR rør strip, Fjern "H" og "D" PCR rør strimler, og luk PCR maskine låg. Inkuber reaktion på 65 ° C i 24 timer.

17. isolering af promotor Fragment-holdige ligatur produkter

Bemærk: Følgende trin anbefales at være gjort med SureSelect adapter kit og bibliotek (Se Tabel for Materals).

  1. Pre varm 1,5 mL vaskebuffer 2 pr. sample på 65 ° C i forvejen.
  2. Tilføje 60 µL af streptavidin-kombineret magnetiske perler (Se Tabel af materialer) ind i en ny tube, sted i magnetisk separation stativet i 1 min og Fjern supernatanten.
  3. Vaske perlerne tre gange med 200 µL 1 x binding buffer.
    Bemærk: For hver vask trin under post capture isolering af promotor-holdige ligatur produkter, re suspendere perler i den tilsvarende buffer, rotere for 3 min på RT og 15 rpm på et roterende hjul, sagte dreje røret i en benchtop centrifuge for 2-3 s at indsamle prøven, sted i røret på den magnetisk separation står for 3 min, og Fjern supernatanten.
  4. Genopslæmmes perler i 200 µL 1 x binding buffer. Åbne PCR-maskine og PCR rør strip (mens PCR programmet stadig kører) og overføre hybridisering reaktion ind i røret med de magnetiske perler. Der inkuberes ved RT i 30 min. på et roterende hjul på 3 rpm.
  5. Genvinde perler på magnetisk separation stå og fjern den klare supernatanten. Genopslæmmes perler til 500 µL af wash buffer 1, mix, og Inkuber i 15 min. ved 20 ° C under omrystning på 950 rpm i en thermomixer.
  6. Genvinde perler i magnetisk separation stativet i 3 min og fjern den klare supernatanten. Genopslæmmes perler til 500 µL af vaskebuffer 2, blandes og inkuberes 10 min. ved 65 ° C under omrystning på 950 rpm i en thermomixer. Gentag trin 17,5 to gange mere.
  7. Genvinde perler på magnetisk separation stå, fjerne den klare supernatanten og genopslæmmes perler i 200 µL 1 x begrænsning buffer 2. Genvinde perler på magnetisk separation stand, Fjern supernatanten og genopslæmmes perler i 30 µL 1 x begrænsning buffer 2.

18. PCHi-C-biblioteket forstærkning

  1. Forberede PCR master mix: 60 µL af 5 x PCR buffer (Phusion buffer), 3,6 µL af 25 µM PE PCR primer 1.0, 3,6 µL af 25 µM PE PCR primer 2.0, 8.4 µL af dNTP mix (10 mM), 3,6 µL af Phusion polymerase og 190.8 µL af H2O.
  2. Mix PCR master mix med perler (300 µL i alt), kløft i 6 delprøver af 50 µL, og PCR-Forstærk ved hjælp af følgende betingelser:
    30 s på 98 ° C
    4 cyklusser af: 10 s på 98 ° C, 30 s på 65 ° C, 30 s ved 72 ° C
    7 min. ved 72 ° C
  3. Indsamle alle PCR reaktioner i en ny tube, genvinde perler på magneten, og overføre supernatanten (300 µL; indeholder PCHi-C-bibliotek) i til en ny tube.
  4. Rense PCHi-C-biblioteket ved hjælp af Sprinkler perler, følge trinene beskrevet ovenfor under 15,4.
  5. Kvantificere koncentrationen af PCHi-C-biblioteket.

Representative Results

Promotor fange Hi-C er blevet brugt til at berige mus7,34,36,39 og menneskelige33,35,37,38 Hi-C biblioteker for promotor interaktioner. En lignende protokol (opkaldt HiCap) er blevet beskrevet af Sandberg gruppe40. Figur 1A viser skematisk arbejdsprocessen for promotor fange Hi-C. I protokollen beskrevet her, er Hi-C biblioteker genereret ved hjælp af i-nucleus ligatur41, hvilket resulterer i en betydeligt reduceret antallet af falske ligatur produkter42. For PCHi-C, yderst komplekse mus eller menneskelige Hi-C biblioteker udsættes for-løsning hybridisering og fange ved hjælp af 39,021 biotinylated RNA'er supplerende til 22,225 mus promotor-holdige HindIII begrænsninger småstykker, eller 37,608 biotinylated RNA'er målretning 22,076 menneskelige promotor-holdige HindIII begrænsning fragmenter, henholdsvis. Promotor indeholdende begrænsning fragmenter kan være rettet mod en eller begge ender af individuelle biotinylated RNA'er (figur 1B). Vi fandt, at erobringen af begge ender bedre dækning af enkelte projektledere (figur 1 c, rå sekvens lyder) næsten to-fold, som forventet. Således, når muligt (dvs. i ikke-gentagne regioner), vi anbefaler for at bruge biotinylated RNA'er supplement til begge ender af en restriktion fragment at blive fanget.

For at vurdere PCHi-C bibliotek kvalitet på et tidligt tidspunkt under bibliotek forberedelse, udføre vi to kontrolelementer efter DNA ligatur og rensning, som tidligere beskrevet31. Først er at bruge specifikke primer par til at forstærke ligatur produkter som 3 C27. Vi bruger primer par (tabel 1) til at forstærke celletype invariante langtrækkende ligatur produkter, f.eks Myc -genet og dets kendte smagsforstærkere beliggende ca 2 Mb væk (figur 2A) eller mellem gener af Hist1 locus ( adskilt af 1,5 Mb), og mellem to regioner, der ligger i nærheden af lineære ('kortrækkende control').

Den anden kvalitetskontrol er gennemført til at bestemme effektiviteten af biotin indarbejdelse under Klenow-medieret udfyldning af begrænsning site markiser med biotin-dATP. Vellykket Klenow fill-in og efterfølgende blunt-ende ligatur resultater i forsvinden af den oprindelige begrænsning sted mellem DNA-molekyler af en ligatur produkt og for HindIII i dannelsen af et nyt NheI anerkendelse websted (figur 2B ). Forholdet mellem HindIII NheI fordøjet ligatur produkt er en direkte udlæsning af biotin indarbejdelse effektivitet. En dårlig kvalitet Hi-C bibliotek vil vise et højt niveau af HindIII fordøjelsen, mens høj kvalitet biblioteker har næsten fuldstændig NheI fordøjelse af ligatur produkter (figur 2B).

Efter Hi-C bibliotek forberedelse (dvs. efter biotin-streptavidin trække ned af størrelsen valgt Hi-C ligatur produkter, adapter ligatur og før fange PCR), er integritet og størrelse fordelingen af Hi-C-biblioteket vurderet af Bioanalyzer (figur 2 C). det samme kontrol udføres i slutningen af PCHi-C bibliotek forberedelse (dvs. efter hybridisering erobringen af promotor-holdige ligatur produkter og efter opsamling PCR). Sammenligning af Hi-C og PCHi C Bioanalyzer profiler viser, som forventet, Hi-C biblioteker er langt mere koncentreret end de tilsvarende PCHi-C biblioteker, men størrelse distribution af biblioteker er meget lignende, hvilket indikerer, at fange trin i PCHi-C indfører ikke en størrelse bias (figur 2 c, D).

Efter parret ende sekventering, PCHi-C læser er kortlagt, kvalitet kontrolleres og filtreres ved hjælp af HiCUP pipeline43. Høj kvalitet PCHi-C biblioteker indeholder mellem 70-90% 'gyldig par' (dvs., parret-afslutning sekvens læser mellem to begrænsning fragmenter, der ikke tilstødende på den lineære genomisk kort; Figur 3A, B). Bruger i nucleus ligatur protokol41,42, læse procentdelen af trans par (dvs., parret-afslutning sekvens læser mellem to begrænsning fragmenter, der er placeret på forskellige kromosomer) er normalt lav, mellem 5 og 25%, hvilket afspejler eksistensen af kromosom territorier, og med angivelse af god bibliotek kvalitet. Direkte sammenligning af procentdelen af gyldig par mellem Hi-C biblioteker og deres tilsvarende PCHi-C biblioteker35, viser, at i alle tilfælde procentdelen af gyldig par er højere i PCHi-C biblioteker (figur 3B). Dette ledsages af en reduktion i andelen af ikke-gyldig 'samme fragment indre' læser i PCHi-C (figur 3 c). Dette forventes, da fange skridt ikke kun beriger for promotor-holdige ligatur produkter, men også for begrænsning fragment udløber, på grund af placeringen af capture oligos om begrænsning fragmenter (Se figur 1B).

Efter HiCUP filtrering, bestemmer vi fange effektivitet. PCHi-C biblioteker indeholder tre typer af gyldig rækkefølge læser efter HiCUP filtrering:
1.) promotor: genom læser (dvs. læsninger mellem en erobrede promotor fragment og en ikke-promotor HindIII begrænsning fragment overalt i genomet)
2.) promotor: promotor læser (læsninger mellem to erobrede promotor fragmenter)
3.) genom: genom læser (baggrund Hi-C ligatur produkter hvor ingen af ligatur produkt partnere tilknyttes en erobrede promotor). Disse er kasseret før downstream analyser.

Høj kvalitet PCHi-C biblioteker har capture effektivitetsfordele (summen af kategori 1 og 2 ovenfor) mellem 65-90% (figur 3D). En direkte sammenligning med Hi-C biblioteker viser, at PCHi-C resulterer i en ~ 15-fold berigelse for promotor-holdige ligatur produkter (figur 3D), i nogle tilfælde 17-fold. Det er tæt på det hypotetiske maksimale (19.6-fold) berigelse for PCHi-C, som er afhængige af procentdelen af genom begrænsning fragmenter er omfattet af capture-system. Større berigelse kan opnås ved at designe capture systemer målretning færre begrænsning fragmenter44,45,46.

Analyse af selskabet interactomes viser celle type og afstamning-specificitet33,34,35, med udtalt ændringer under Celledifferentiering37,38,39 . Tal 4 og 5 viser eksempler på lineage specificitet og differentiering dynamik på specifikke initiativtagere. For eksempel ALAD udtrykkes constitutively i alle celler, men dens udtryk er upregulated i erythroblasts47. ALAD initiativtageren kontakter flere distale fragmenter i alle hæmatopoietisk celler og engagerer sig i ekstra interaktioner specifikt i erythroblasts (figur 4). IL-8 viser ingen statistisk signifikante interaktioner i B-celler, meget få interaktioner i T-celler, men snesevis af interaktioner i celler af myeloide slægt, herunder celletype specifikke interaktioner i () monocytter, neutrofiler og megakaryocytes Figur 5). Disse eksempler viser, hvordan PCHi-C kan bruges til at optrævle celletype specifikke interactomes og identificere promotor-interagere regioner med lovgivningsmæssige potentiale.

Figure 1
Figur 1 : Promotor fange Hi-C rationale og fange agn design. (A) skematisk arbejdsproces for PCHi-C. I kernen ligatur Hi-C41,42 (I) er efterfulgt af-løsning hybridisering med biotinylated RNA lokkemad (II) rettet mod restriktion fragmenterne af alle menneskelige (afbildet her) eller mus gen initiativtagere (III). (B) agn design til PCHi-C. Biotinylated RNA capture lokkemad (røde buede linjer) er designet mod enderne af promotor-holdige begrænsning fragmenter (grå, Bemærk at promotor sekvenser, selv (rød) målrettes kun af RNA capture lokkemad, hvis de er placeret på begrænsning fragment ender). Ligatur produkter bestående af promotor-holdige begrænsning fragmenter (grå) og deres interagerende begrænsning fragmenter (gul og grøn) er isoleret gennem sekvens-komplementaritet hybridisering mellem RNA agn og DNA mål, og efterfølgende Biotin-streptavidin pulldown, som vist i (A. C) sammenligning af PCHi-C opsamling effektivitet for promotor-holdige begrænsning fragmenter målrettet efter én RNA agn capture sonde vs to RNA agn capture sonder (Se skematisk i B). Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2 : PCHi-C før sekventering kvalitetskontroller. (A) venstre, skematisk af rumlige sammenstilling mellem arrangøren og PIR, hvilket resulterer i en Hi-C ligatur produkt bestående af en promotor-holdige begrænsning fragment, (grå, promoter sekvens i rød) og en PIR begrænsning fragment (gul). Højre, DNA gel elektroforese viser eksempler på Hi-C ligatur produkter forstærkes ved hjælp af specifikke primer par (som afbildet i skematisk til venstre). (B) venstre, repræsentative eksempler på HindIII, NheI og HindIII/NheI begrænsning fordøjer af Hi-C ligatur produkter (PCR produkter vist i A). Højre, skematisk af DNA sekvens efter Hi-C ligatur efter mislykket (øverst) eller succesfulde (nederst) dNTP Klenow fill-in begrænsning vejkryds og efterfølgende ligatur. (C) repræsentant Hi-C bibliotek bioanalyzer profil (1/5 fortynding). (D) repræsentant PCHi-C bibliotek bioanalyzer profil (ingen fortynding). Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3 : PCHi-C post sekventering kvalitetskontrol. (A) sammenligning af procent gyldig rækkefølge Læs par efter HiCUP43 forarbejdning i PCHi-C vs svarende Hi-C biblioteker (data fra Javierre et al., 201635). (B) repræsentant HiCUP PCHi-C resultatet viser gyldig læse par og andre rækkefølge kategorier, der er kasseret før downstream analyser (data fra Javierre et al., 201635). (C) sammenligning af procentdel 'samme fragment indre' læser efter HiCUP behandling i PCHi-C vs svarende Hi-C biblioteker (data fra Javierre et al., 201635). (D) sammenligning procentdelen sekvenstype læser med madding promotor fragmenter (capture effektivitet) i PCHi-C vs svarende Hi-C biblioteker (data fra Javierre et al., 201635). Venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: ALAD PCHi-C profil i hæmatopoietisk menneskeceller. Promotor interaktioner af myeloide celletyper er vist som blå buer, og promotor interaktioner af lymfoide celletyper er vist som lilla buer. Erythroblast-specifikke interaktioner er markeret med røde pile (data fra Javierre et al., 201635). Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5 : IL8 PCHi-C profil i hæmatopoietisk menneskeceller. Promotor interaktioner af myeloide celletyper er vist som blå buer, og promotor interaktioner af lymfoide celletyper er vist som lilla buer. Monocyt-specifikke interaktioner er markeret med grønne pile, neutrofile-specifikke interaktioner er markeret med røde pile og en megakaryocyte-specifik interaktion er angivet med en brun pil (data fra Javierre et al., 201635). Venligst klik her for at se en større version af dette tal.

Menneskelige
Navn Sekvens Kromosom Strand Start GRCh38/hg38 Slutningen GRCh38/hg38 Primer kombinationer at afprøve 3C interaktioner og biotin indarbejdelse
HS AHF64 Dekker GCATGCATTAGCCTCTGCTGTTCTCTGAAATC 11 + 116803960 116803991 brug i kombination med hs AHF66 Dekker
HS AHF66 Dekker CTGTCCAAGTACATTCCTGTTCACAAACCC 11 + 116810219 116810248 brug i kombination med hs AHF64 Dekker
HS MYC locus GGAGAACCGGTAATGGCAAA 8 - 127733814 127733833 brug i kombination med hs MYC +1820 eller hs MYC-538
HS MYC +1820 AAAATGCCCATTTCCTTCTCC 8 + 129554527 129554547 brug i kombination med hs MYC locus
HS MYC-538 TGCCTGATGGATAGTGCTTTC 8 - 127195696 127195716 brug i kombination med hs MYC locus
HS HIST1 F AAGCAGGAAAAGGCATAGCA 6 + 26207174 26207193 brug i kombination med hs HIST1 Rasmussen
HS HIST1 Rasmussen TCTTGGGTTGTGGGACTTTC 6 + 27771575 27771594 brug i kombination med hs HIST1 F
Mus
Sekvens Kromosom Strand Start GRCm38/mm10 Slutningen GRCm38/mm10 Primer kombinationer at afprøve 3C interaktioner og biotin indarbejdelse
TCATGAGTTCCCCACATCTTTG 8 + 84841090 84841111 brug i kombination med mm Calr2
CTGTGGGCACCAGATGTGTAAAT 8 + 84848519 84848541 brug i kombination med mm Calr1
TATCAAGGGTGCCCGTCACCTTCAGC 6 + 125163098 125163123 brug i kombination med Gapdh4 Dekker
GGGCTTTTATAGCACGGTTATAAAGT 6 + 125163774 125163799 brug i kombination med Gapdh3 Dekker
GGAGGAGGGAAAAGGAGTGATT 6 + 52212829 52212850 brug i kombination med mm Hoxa13
CAGGCATTATTTGCTGAGAACG 6 - 52253490 52253511 brug i kombination med mm Hoxa7
GGGTAATGGTGTCACTAACTGG 13 + 23571284 23571305 brug i kombination med Hist1h3e eller mm Hist1h4i
GGGTTTGATGAGTTGGTGAAG 13 + 23566541 23566561 brug i kombination med mm Hist1h2ae
TTGGGCCAAAGCCTATATGA 13 + 22043085 22043104 brug i kombination med mm Hist1h2ae

Tabel 1: Primer sekvenser for kvalitetskontrol af menneskelige og mus Hi-C biblioteker.

Discussion

Modulære design af promotor fange Hi-C

Promotor fange Hi-C er designet til specifikt berige Hi-C biblioteker for interaktioner, der vedrører projektledere. Disse interaktioner omfatter kun en delmængde af ligatur produkter findes i en Hi-C-biblioteket.

Capture Hi-C kan let ændres til at berige Hi-C biblioteker for genomisk region eller regioner af interesse ved at ændre capture-system. Capture regioner kan være kontinuerlig genomisk segmenter44,45,46,48, smagsforstærkere, der er blevet identificeret i PCHi-C (Reverse fange Hi-C-35), eller DNase overfølsomme sites49 . Størrelse ordningens capture kan justeres alt efter de eksperimentelle anvendelsesområde. For eksempel, Dryden mfl. målrette 519 agn fragmenter i tre gen ørkener forbundet med bryst kræft44. Capture-system af Martin mfl. mål begge kontinuerlig genomisk segmenter ("Region Capture": 211 genomisk regioner i alt, 2,131 begrænsning fragmenter) og valgt initiativtagere (3,857 gen initiativtagere)45.

SureSelect biblioteker er tilgængelige i forskellige intervaller: 1 kb til 499 kb (5.190 – 4,806), 500 kb til 2,9 Mb (5.190 – 4,816), og 3 Mb til 5,9 Mb (5.190 – 4,831). Som hver enkelte fange biotin-RNA er 120 nukleotider lange, disse erobre systemer rumme et maksimum af 4,158, 24,166 og 49,166 individuelle fange sonder, henholdsvis. Dette svarer til 2,079, 12,083 og 24,583 målrettede begrænsninger småstykker, henholdsvis (Bemærk, at tallene for begrænsning fragmenter er nedre grænser baseret på den antagelse, at to individuelle capture sonder kan være konstrueret til enhver begrænsning Fragmentet — i virkeligheden på grund af gentagne sekvenser vil dette ikke være tilfældet for hver begrænsning fragment (Se også figur 1B, C), hvilket resulterer i et højere antal markedssegment begrænsning fragmenter for et konstant antal tilgængelige capture sonder ).

Protokollen beskrevet her er baseret på anvendelse af en restriktion enzym med et 6 bp anerkendelse websted at afdække langtrækkende interaktioner. Ved hjælp af en begrænsning enzym med en 4 bp anerkendelse websted for større opløsning af mere proksimale interaktioner er også mulige40,49.

Begrænsninger af PCHi-C

En iboende begrænsning af alle kromosom kropsbygning capture assays er, at deres beslutning bestemmes af begrænsning enzym brugt til biblioteket generation. Samspil, der opstår mellem DNA elementer placeret på den samme begrænsning fragment er usynlige for 'C-type' assays. Yderligere, i PCHi-C, i nogle tilfælde mere end én transskription startstedet kan være placeret på det samme promotor-holdige begrænsning fragment, og PIRs i nogle tilfælde havnen både aktive og undertrykkende Histon mærker, hvilket gør det vanskeligt at lokalisere som regulerende elementer mægle samspillet, og at forudsige den regulerende output af promotor interaktioner. Ved hjælp af restriktionsenzymer med 4 bp genkendelsessekvenser afbøder problemet men kommer på bekostning af voldsomt forøgede Hi-C bibliotek kompleksitet (Hi-C biblioteker genereret med 4 bp anerkendelse websted restriktionsenzymer er mindst 100 gange mere komplekse end Hi-C biblioteker genereret med 6 bp anerkendelse websted restriktionsenzymer), og de dermed forbundne omkostninger for næste generation sequencing.

En anden begrænsning er, at den nuværende PCHi-C protokollen kræver millioner af celler som udgangspunkt materiale, udelukker analyse af promotor interaktioner i sjældne celletyper. En modificeret version af PCHi-C hen til muliggøre afhøring af initiativtageren kontakter i cellepopulationer med 10.000 til 100.000 celler (f.eks celler under tidlige embryonale udvikling eller hæmatopoietisk stamceller) ville derfor være en værdifuld tilføjelse til fange Hej-C værktøjskasse.

Endelig, ligesom alle metoder, der er afhængige af formaldehyd fiksering, PCHi-C kun registrerer interaktioner, der er» frosset» for tidspunkt af fiksering. Således, for at studere kinetik og dynamik af promotor interaktioner, metoder såsom super-resolution levende celle mikroskopi er kræves sammen med PCHi-C.

Metoder til at dissekere rumlige kromosom organisation med høj opløsning

Den enorme kompleksitet kromosomale interaktion biblioteker forbyder den pålidelige Materielidentifikationen interaktion mellem to specifikke begrænsning fragmenter med Statistisk signifikans. For at omgå dette problem, er sekvens capture blevet brugt til at berige enten Hi-C33,34,40,44 eller 3 C50,51 biblioteker for specifikke interaktioner. Den store fordel ved at bruge Hi-C-biblioteker over 3C for berigelse skridt er, at Hi-C, i modsætning til 3C, omfatter en berigelse skridt for ægte ligatur produkter. Som en konsekvens, er procentdelen af gyldig læser i PCHi-C biblioteker ca 10-fold højere end i Capture-C biblioteker50, som indeholdt omkring 5-8% gyldig læser efter HiCUP filtrering. Sahlen et al. har direkte sammenlignet Capture-C til HiCap, der ligesom PCHi-C bruger Hi-C biblioteker til fange berigelse, i modsætning til Capture-C, som bruger 3 C-biblioteker. I overensstemmelse med vores resultater, de fandt at opsamling-C biblioteker er hovedsageligt komponeret af un-sammenskrevne fragmenter40. Derudover havde HiCap biblioteker en højere kompleksitet end Capture-C biblioteker40.

En variant af Capture-C, kaldes næste generation Capture-C52 (NG Capture-C) bruger en oligo pr. begrænsning fragment slutningen, som tidligere etableret i PCHi-C33,34, i stedet for overlappende sonder anvendes i oprindelige Capture-C protokollen50. Dette øger procentdelen af gyldig læsninger i forhold til Capture-C beskedent, men NG Capture-C beskæftiger to sekventielle runder af capture berigelse og et relativt højt antal PCR-cykler (20-24 cyklusser i alt, sammenlignet med 11 cyklusser typisk for PCHi-C), som uundgåeligt medfører højere antal sekvens dubletter og lavere bibliotek kompleksitet. I retssag eksperimenter under optimering af PCHi-C, fandt vi, at den procentvise andel af unikke (dvs. ikke duplikeres) læse par var omkring kun 15% når vi brugte 19 PCR cyklusser (13 cyklusser pre fange + 6 cyklusser post capture; data ikke vist), men Optimering til et lavere antal PCR cyklusser, udbytter typisk 75-90% unikke Læs par. Således, at reducere antallet af PCR cyklusser betydeligt øger mængden af informative sekvens data.

En nyere metode kombinerer ChIP med Hi-C at fokusere på kromosom vekselvirkninger medieret af et specifikt protein af interesse (HiChIP53). I forhold til ChIA-PET54, som er baseret på en lignende rationale, indeholder HiChIP data et større antal informative sekvens læser, giver mulighed for højere tillid interaktion kræver53. Det vil være meget interessant at direkte sammenligne de tilsvarende HiChIP og fange Hi-C datasæt de bliver når tilgængelige (for eksempel HiChIP ved hjælp af en antistof mod cohesin enhed Smc1a53 med fange Hi-C for alle Smc1a bundet begrænsning fragmenter) side om side. En iboende forskel mellem disse to tilgange er at fange Hi-C ikke stole på kromatin immunoprecipitation, og derfor er i stand til at afhøre kromosom vekselvirkninger uanset protein belægning. Dette giver mulighed for sammenligning af 3D genom organisation i tilstedeværelse eller fravær af specifik faktor binding, som er blevet brugt til at identificere PRC1 som et centralt regulator af musen ESC rumlige genom arkitektur7.

PCHi-C og GWAS

Genome-wide association studier (GWAS) har afsløret, at mere end 95% af sygdom-associerede sekvens varianter er beliggende i ikke-kodende regioner i genomet, ofte på store afstande til protein-kodning gener55. GWAS varianter er ofte fundet i umiddelbar nærhed af DNase jeg overfølsom websteder, som er kendetegnende for sekvenser med potentielle regulerende aktivitet. PCHi- og fange Hi-C har været brugt flittigt at linke initiativtagere til GWAS risiko loci impliceret i bryst kræft44, kolorektal cancer48og autoimmun sygdom35,45,46. En PCHi-C undersøgelse af 17 forskellige menneskelige hæmatopoietisk celle typer fundet SNPs forbundet med autoimmun sygdom blev beriget med PIRs i lymfoide celler, hvorimod sekvens varianter tilknyttet trombocyttal og røde blodlegemer specifikke træk fandtes overvejende de makrofager og erythroblasts, henholdsvis35,56. Således vævstype specifikke promotor interactomes afsløret af PCHi-C kan bidrage til at forstå funktionen af ikke-kodende sygdom-associerede sekvens varianter og identificere nye potentielle sygdomsgener for terapeutisk intervention.

Karakteristik af promotor-interagere regioner

Flere linjer af beviser link promotor interactomes gen expression kontrol. Først, flere PCHi-C undersøgelser har vist, at genomisk regioner interagere med initiativtagere til (meget) udtrykte gener er beriget med marks tilknyttet enhancer aktivitet, som H3K27 acetylation og p300 bindende33,34 , 37. vi fandt en positiv korrelation mellem gen expression niveau og antallet af interagerende smagsforstærkere, tyder på, at tilsætningsstoffet effekter af smagsforstærkere resultere i øget genekspression niveauer34,35. For det andet naturligt forekommende udtryk kvantitative træk loci (eQTLs) er beriget med PIRs, der er forbundet med de samme gener, hvis udtryk påvirkes af eQTLs35. For det tredje ved at integrere tur57 og PCHi-C data, fandt Cairns et al. tur reporter gener kortlægning til PIRs i mus sektorrådene viser stærkere reporter genekspression end reporter gener på integration websteder, i ikke-promotor-interagere regioner 58, der angiver, at PIRs besidder transkriptionel regulering aktivitet. Sammen, tyder disse resultater på, at initiativtageren interactomes afsløret af PCHi-C i forskellige mus og menneskelige celletyper omfatte centrale lovgivningsmæssige moduler til gen expression kontrol.

Det er værd at bemærke, at smagsforstærkere udgør kun en lille brøkdel (~ 20%) af alle PIRs afdækket ved PCHi-C33,34. Andre PIRs kunne have strukturelle eller topologiske roller snarere end direkte transcriptional regulerende funktioner. Men der er også beviser for at PCHi-C kan afdække DNA elementer med regulerende funktion, der ikke havnen klassisk enhancer mærker. I en menneskelig lymfoide cellelinie, blev BRD7 selskabet fundet til at interagere med en region forstærker mærker, der blev vist sig at besidde enhancer aktivitet i reporter gen assays33. Regulerende elementer med lignende karakteristika kan være mere rigelig end i øjeblikket værdsat. For eksempel, markerer en CRISPR-baseret skærm for regulerende DNA elementer identificerede umarkerede regulerende elementer (foranstaltninger), kontrollerer genekspression, men er forstærker59.

I andre tilfælde har PIRs vist sig at havnen kromatin marks tilknyttet transcriptional undertrykkelse. PIRs og interagerende initiativtagere bundet af PRC1 i mus sektorrådene var involveret i et omfattende fysisk netværk af undertrykt gener forsynet med de repressive mark H3K27me37. I humane lymphoblastoid celler, en fjern element interagere med BCL6 promotor undertrykt transgen reporter gen expression33, tyder på, at det kan fungere for at undertrykke BCL6 transskription i sin oprindelige kontekst.

PIRs beriget for belægning af kromatin isolator protein CTCF i menneskelige og sociale råd og NECs37 kan udgøre endnu en klasse af PIRs. Kollektivt, tyder disse resultater på, at PIRs havnen en samling af genet reguleringsvirksomhed endnu at karakteriseres funktionelt.

Disclosures

Forfatterne har ikke noget at oplyse.

Acknowledgments

Vi takker Valeriya Malysheva for kritisk læsning af manuskript og eksperthjælp med figur 1. Dette arbejde blev støttet af den medicinske Forskningsråd, UK (hr./L007150/1) og UK bioteknologi og biologiske Sciences Research Council, UK (BB/J004480/1).

Materials

Name Company Catalog Number Comments
16% (vol/vol) paraformaldehyde solution Agar Scientific R1026
Dulbecco's Modified Eagle Medium (DMEM) 1x Life Technologies 41965-039
Fetal bovine serum (FBS) sterile filtered Sigma  F9665
Low-retention filter tips  Starlab S1180-3810, S1180-1810, S1180-8810 and S1182-1830
10x PBS pH 7.4 Life Technologies 70011-036
Molecular biology grade water Sigma-Aldrich W4502
1 M Tris-HCl pH 8.0 Life Technologies 15568-025
IGEPAL CA-630  Sigma-Aldrich I8896
5 M NaCl  Life Technologies 24740-011
Protease inhibitor cocktail (EDTA-free)  Roche Diagnostics 11873580001
Restriction buffer 2 (10x NEBuffer 2) New England Biolabs B7002
DNA LoBind tube, 1.5 mL  Eppendorf 0030 108.051
DNA LoBind tube, 2 mL Eppendorf 30108078
20% (wt/vol) SDS   Bio-Rad Laboratories 161-0418
20% (vol/vol) Triton X-100  Sigma-Aldrich T8787
HindIII, 100 U/uL New England Biolabs R0104
10 mM dCTP  Life Technologies 18253-013
10 mM dGTP Life Technologies 18254-011
10 mM dTTP  Life Technologies 18255-018
0.4 mM Biotin-14-dATP Life Technologies 19524-016
DNA polymerase I large (Klenow) fragment 5000 units/mL New England Biolabs M0210
10x T4 DNA ligase reaction buffer  New England Biolabs B0202
100x 10mg/ml Bovine Serum Albumin  New England Biolabs B9001
T4 DNA ligase, 1 U/μL  Invitrogen 15224-025
RNase A  Roche 10109142001
Proteinase K, recombinant, PCR grade  Roche 3115836001
20 000×g 50 ml centrifuge tube VWR 525-0156
0.5 M EDTA pH 8.0  Life Technologies 15575-020
Phenol pH 8.0  Sigma P4557
Phenol: Chloroform: Isoamyl Alcohol 25:24:1  Sigma P3803
Sodium acetate pH 5.2  Sigma S7899
Quant-iT PicoGreen  Invitrogen P7589
QIAquick Gel Extraction Kit Qiagen 28704
QIAquick PCR Purification Kit Qiagen 28104
Restriction buffer 2.1 (10x NEBuffer 2.1) New England Biolabs B7202
NheI, 100U/uL New England Biolabs R0131
Micro TUBE AFA Fiber Pre-slit snap cap 6x16mm vials  Covaris 520045 For sonication
SPRI beads (Agencourt AMPure XP)  Beckman Coulter A63881
Dynabeads MyOne Streptavidin C1 beads  Invitrogen 65001
Tween 20  Sigma P9416
10 mM dATP  Life Technologies 18252-015
T4 DNA polymerase 3000 units/mL New England Biolabs M0203
T4 PNK 10000 units/mL New England Biolabs M0201
Klenow exo minus 5000 units/mL  New England Biolabs M0212
Quick ligation reaction buffer  New England Biolabs B6058
NEB DNA Quick ligase  New England Biolabs M2200
PE adapter 1.0 (5'-P-GATCGGAAGAGCGGTTCAGC
AGGAATGCCGAG-3')
Illumina
PE adapter 2.0 (5'-ACACTCTTTCCCTACACGACGCT
CTTCCGATCT-3')
Illumina
NEB Phusion PCR kit  New England Biolabs M0530
PE PCR primer 1.0 (5'-AATGATACGGCGACCACCGA
GATCTACACTCTTTCCCTAC
ACGACGCTCTTCCGATCT-3')
Illumina
PE PCR primer 2.0 (5'-CAAGCAGAAGACGGCATACGA
GATCGGTCTCGGCATTCCT
GCTGAACCGCTCTTCCGATCT-3') 
Illumina
PCR strips  Agilent Technologies 410022 and 401425
SureSelect SSEL TE Reagent ILM PE full adaptor kit  Agilent Technologies 931108
SureSelect custom 3-5.9 Mb library  Agilent Technologies 5190-4831 custom design mouse or human PCHi-C system
Dynabeads MyOne Streptavidin T1 beads  Invitrogen 65601
E220  high-performance focused ultra-sonicator Corvaris E220

DOWNLOAD MATERIALS LIST

References

  1. Osborne, C. S., et al. Active genes dynamically colocalize to shared sites of ongoing transcription. Nature Genetics. 36, 1065-1071 (2004).
  2. Schoenfelder, S., et al. Preferential associations between co-regulated genes reveal a transcriptional interactome in erythroid cells. Nature Genetics. 42, 53-61 (2010).
  3. de Wit, E., et al. The pluripotent genome in three dimensions is shaped around pluripotency factors. Nature. 501, 227-231 (2013).
  4. Bantignies, F., et al. Polycomb-dependent regulatory contacts between distant Hox loci in Drosophila. Cell. 144, 214-226 (2011).
  5. Engreitz, J. M., et al. The Xist lncRNA exploits three-dimensional genome architecture to spread across the X chromosome. Science. 341, 1237973 (2013).
  6. Denholtz, M., et al. Long-range chromatin contacts in embryonic stem cells reveal a role for pluripotency factors and polycomb proteins in genome organization. Cell Stem Cell. 13, 602-616 (2013).
  7. Schoenfelder, S., et al. Polycomb repressive complex PRC1 spatially constrains the mouse embryonic stem cell genome. Nature Genetics. 47, 1179-1186 (2015).
  8. Kundu, S., et al. Polycomb Repressive Complex 1 generates discrete compacted domains that change during differentiation. Molecular Cell. 65, 432-446 (2017).
  9. Skok, J. A., Gisler, R., Novatchkova, M., Farmer, D., de Laat, W., Busslinger, M. Reversible contraction by looping of the Tcra and Tcrb loci in rearranging thymocytes. Nature Immunology. 8, 378-387 (2007).
  10. Zhang, Y., et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 148, 908-921 (2012).
  11. Aymard, F., et al. Genome-wide mapping of long-range contacts unveils clustering of DNA double-strand breaks at damaged active genes. Nature Structural & Molecular Biology. 24, 353-361 (2017).
  12. Ryba, T., et al. Evolutionarily conserved replication timing profiles predict long-range chromatin interactions and distinguish closely related cell types. Genome Research. 20, 761-770 (2010).
  13. Pope, B. D., et al. Topologically associating domains are stable units of replication-timing regulation. Nature. 515, 402-405 (2014).
  14. Chandra, T., et al. Global reorganization of the nuclear landscape in senescent cells. Cell Reports. 10, 471-483 (2015).
  15. Carter, D., Chakalova, L., Osborne, C. S., Dai, Y. F., Fraser, P. Long-range chromatin regulatory interactions in vivo. Nature Genetics. 32, 623-626 (2002).
  16. Tolhuis, B., Palstra, R. J., Splinter, E., Grosveld, F., de Laat, W. Looping and interaction between hypersensitive sites in the active beta-globin locus. Molecular Cell. 10, 1453-1465 (2002).
  17. Amano, T., Sagai, T., Tanabe, H., Mizushina, Y., Nakazawa, H., Shiroishi, T. Chromosomal dynamics at the Shh locus: limb bud-specific differential regulation of competence and active transcription. Developmental Cell. 16, 47-57 (2009).
  18. Zuniga, A., et al. Mouse limb deformity mutations disrupt a global control region within the large regulatory landscape required for Gremlin expression. Genes & Development. 18, 1553-1564 (2004).
  19. Sagai, T., Hosoya, M., Mizushina, Y., Tamura, M., Shiroishi, T. Elimination of a long-range cis-regulatory module causes complete loss of limb-specific Shh expression and truncation of the mouse limb. Development. 132, 797-803 (2005).
  20. D'Haene, B., et al. Disease-causing 7.4 kb cis-regulatory deletion disrupting conserved non-coding sequences and their interaction with the FOXL2 promotor: implications for mutation screening. PLoS Genet. 5, e1000522 (2009).
  21. Sur, I. K., et al. Mice lacking a Myc enhancer that includes human SNP rs6983267 are resistant to intestinal tumors. Science. 338, 1360-1363 (2012).
  22. Herranz, D., et al. A NOTCH1-driven MYC enhancer promotes T cell development, transformation and acute lymphoblastic leukemia. Nature Medicine. 20, 1130-1137 (2014).
  23. Deng, W., et al. Controlling long-range genomic interactions at a native locus by targeted tethering of a looping factor. Cell. 149, 1233-1244 (2012).
  24. Groschel, S., et al. A single oncogenic enhancer rearrangement causes concomitant EVI1 and GATA2 deregulation in leukemia. Cell. 157, 369-381 (2014).
  25. Lupianez, D. G., et al. Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions. Cell. 161, 1012-1025 (2015).
  26. Franke, M., et al. Formation of new chromatin domains determines pathogenicity of genomic duplications. Nature. 538, 265-269 (2016).
  27. Dekker, J., Rippe, K., Dekker, M., Kleckner, N. Capturing chromosome conformation. Science. 295, 1306-1311 (2002).
  28. Simonis, M., et al. Nuclear organization of active and inactive chromatin domains uncovered by chromosome conformation capture-on-chip (4C). Nature Genetics. 38, 1348-1354 (2006).
  29. Zhao, Z., et al. Circular chromosome conformation capture (4C) uncovers extensive networks of epigenetically regulated intra- and interchromosomal interactions. Nature Genetics. 38, 1341-1347 (2006).
  30. Dostie, J., et al. Chromosome Conformation Capture Carbon Copy (5C): A massively parallel solution for mapping interactions between genomic elements. Genome Research. 16, 1299-1309 (2006).
  31. Lieberman-Aiden, E., et al. Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science. 326, 289-293 (2009).
  32. Belton, J. M., McCord, R. P., Gibcus, J. H., Naumova, N., Zhan, Y., Dekker, J. Hi-C: a comprehensive technique to capture the conformation of genomes. Methods. 58, 268-276 (2012).
  33. Mifsud, B., et al. Mapping long-range promoter contacts in human cells with high-resolution capture Hi-C. Nature Genetics. 47, 598-606 (2015).
  34. Schoenfelder, S., et al. The pluripotent regulatory circuitry connecting promoters to their long-range interacting elements. Genome Res. 25, 582-597 (2015).
  35. Javierre, B. M., et al. Lineage-specific genome architecture links enhancers and non-coding disease variants to target gene promoters. Cell. 167, 1369-1384 (2016).
  36. Wilson, N. K., et al. Integrated genome-scale analysis of the transcriptional regulatory landscape in a blood stem/progenitor cell model. Blood. 127, e12-e23 (2016).
  37. Freire-Pritchett, P., et al. Global reorganisation of cis-regulatory units upon lineage commitment of human embryonic stem cells. Elife. 6, (2017).
  38. Rubin, A. J., et al. Lineage-specific dynamic and pre-established enhancer-promoter contacts cooperate in terminal differentiation. Nature Genetics. 49, 1522-1528 (2017).
  39. Siersbaek, R., et al. Dynamic rewiring of promoter-anchored chromatin loops during adipocyte differentiation. Molecular Cell. 66, 420-435 (2017).
  40. Sahlen, P., et al. Genome-wide mapping of promoter-anchored interactions with close to single-enhancer resolution. Genome Biology. 16, 156 (2015).
  41. Nagano, T., et al. Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature. 502, 59-64 (2013).
  42. Nagano, T., Varnai, C., Schoenfelder, S., Javierre, B. M., Wingett, S. W., Fraser, P. Comparison of Hi-C results using in-solution versus in-nucleus ligation. Genome Biology. 16, 175 (2015).
  43. Wingett, S., et al. HiCUP: pipeline for mapping and processing Hi-C data. F1000 Res. 4, 1310 (2015).
  44. Dryden, N. H., et al. Unbiased analysis of potential targets of breast cancer susceptibility loci by Capture Hi-C. Genome Research. 24, 1854-1868 (2014).
  45. Martin, P., et al. Capture Hi-C reveals novel candidate genes and complex long-range interactions with related autoimmune risk loci. Nature Communications. 6, 10069 (2015).
  46. McGovern, A., et al. Capture Hi-C identifies a novel causal gene, IL20RA, in the pan-autoimmune genetic susceptibility region 6q23. Genome Biol.ogy. 17, 212 (2016).
  47. Hodge, D., et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 107, 3359-3370 (2006).
  48. Jager, R., et al. Capture Hi-C identifies the chromatin interactome of colorectal cancer risk loci. Nature Communications. 6, 6178 (2015).
  49. Joshi, O., et al. Dynamic reorganization of extremely long-range promoter-promoter Interactions between two states of pluripotency. Cell Stem Cell. 17, 748-757 (2015).
  50. Hughes, J. R., et al. Analysis of hundreds of cis-regulatory landscapes at high resolution in a single, high-throughput experiment. Nature Genetics. 46, 205-212 (2014).
  51. Kolovos, P., et al. Targeted Chromatin Capture (T2C): A novel high-resolution high-throughput method to detect genomic interactions and regulatory elements. Epigenetics Chromatin. 7, 10 (2014).
  52. Davies, J. O., et al. Multiplexed analysis of chromosome conformation at vastly improved sensitivity. Nature Methods. 13, 74-80 (2016).
  53. Mumbach, M. R., et al. HiChIP: efficient and sensitive analysis of protein-directed genome architecture. Nature Methods. 13, 919-922 (2016).
  54. Fullwood, M. J., et al. An oestrogen-receptor-alpha-bound human chromatin interactome. Nature. 462, 58-64 (2009).
  55. Maurano, M. T., et al. Systematic localization of common disease-associated variation in regulatory DNA. Science. 337, 1190-1195 (2012).
  56. Petersen, R., et al. Platelet function is modified by common sequence variation in megakaryocyte super enhancers. Nat. Commun. 8, 16058 (2017).
  57. Akhtar, W., et al. Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell. 154, 914-927 (2013).
  58. Cairns, J., et al. CHiCAGO: Robust detection of DNA looping interactions in Capture Hi-C data. Genome Biology. 17, 127 (2016).
  59. Rajagopal, N., et al. High-throughput mapping of regulatory DNA. Nature Biotechnology. 34, 167-174 (2016).
Promotor Capture Hej-C: Høj opløsning, Genome-wide profilering af promotor interaktioner
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).More

Schoenfelder, S., Javierre, B. M., Furlan-Magaril, M., Wingett, S. W., Fraser, P. Promoter Capture Hi-C: High-resolution, Genome-wide Profiling of Promoter Interactions. J. Vis. Exp. (136), e57320, doi:10.3791/57320 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter