Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arbovirus Infections comme outils de dépistage pour l’Identification des virales facteurs antiviraux immunomodulateurs et hôte

doi: 10.3791/58244 Published: September 13, 2018

Summary

Nous présentons ici les protocoles afin d’identifier les immunomodulateurs 1) virus codé qui favorisent la réplication arbovirus et facteurs de l’hôte 2) eucaryotes que restreignent la réplication des arbovirus. Ces méthodes à base de fluorescence et de luminescence aux chercheurs d’obtenir rapidement des afficheurs quantitatives de réplication arbovirus dans les essais simplistes avec des rapports signal sur bruit faibles.

Abstract

RNA interference - et génome édition axée sur les plateformes de dépistage ont été couramment pour identifier les facteurs de cellule hôte qui restreignent la réplication du virus. Toutefois, ces écrans sont généralement effectuées dans des cellules qui sont naturellement permissives au pathogène viral à l’étude. Par conséquent, la réplication robuste de virus dans des conditions de contrôle peut limiter la plage dynamique de ces écrans. En outre, ces écrans peuvent être incapables d’identifier facilement les voies de défense cellulaire qui restreignent la réplication du virus si le virus est bien adapté à l’hôte et capable de lutter contre les défenses antivirales. Dans cet article, nous décrivons un nouveau paradigme pour explorer les interactions virus-hôte grâce à l’utilisation des écrans qui se centre sur les infections naturellement avortées par arbovirus tels que les virus de la stomatite vésiculaire (VSV). Malgré la capacité de la VSV à reproduire dans un large éventail d’insectes diptères et hôtes mammifères, VSV subit une infection postérieure à la création avortée dans une variété de lignées cellulaires dérivées de lépidoptères, tels que la spongieuse (Lymantria dispar). Cependant, ces infections VSV avortées peuvent être « sauvées » lorsque les défenses antivirales des cellules hôte sont compromises. Nous décrivons comment VSV souches gènes codant de journaliste commode et restrictives dispar L. lignées cellulaires peuvent être couplées aux écrans de configuration afin d’identifier les facteurs de l’hôte impliqués dans restriction des arbovirus. En outre, nous montrons également l’utilité de ces outils de dépistage pour l’identification des facteurs virally codés que sauver la réplication VSV pendant la co-infection ou par le biais de l’expression ectopique, y compris celles encodées par des virus chez les mammifères. La limitation naturelle de la réplication dans les cellules de dispar L. VSV fournit un rapport signal sur bruit élevé lorsque le dépistage pour les conditions qui favorisent le sauvetage VSV, permettant ainsi l’utilisation d’épreuves simplistes luminescence et fluorescence dotés de surveiller les modifications dans la réplication de VSV. Ces méthodes sont utiles pour comprendre l’interaction entre réponses antivirales de l’hôte et des facteurs viraux évasion immunitaire.

Introduction

La capacité d’un virus de façon productive répliquer dans un hôte particulier est régie en partie par la disponibilité des facteurs de cellule hôte prenant en charge l’entrée virale et réplication1. La gamme de virus-hôte peut aussi être dictée par la capacité d’un virus à compteur cellulaire antivirale défenses qui seraient autrement empêcher la réplication virale2,3. Il est le fruit de ces interactions hôte-virus complexe qui décident en dernier ressort si un virus sera en mesure de terminer son cycle de vie dans un hôte particulier. Étant donné les conséquences potentiellement pathogènes pour l’hôte si la réplication virale s’ensuit, il est essentiel d’élaborer des stratégies expérimentales pour approfondir notre compréhension des interactions virus-hôte clés qui peuvent faire pencher la balance entre avortée et productif infections. Élucider les caractéristiques moléculaires de l’interaction virus-hôte jouera un rôle déterminant dans le développement de nouvelles stratégies thérapeutiques antivirales.

Avec l’avènement de l’ARN interférence (ARNi)4,5 et les outils de retouche du génome (e.g., CRISPR-Cas9, Zinc finger nucleases, TALENs)6,7, il est devenu expérimentalement possible de modifier la expression des facteurs cellulaires sur tout le génome, échelles et d’analyser l’impact de ces modifications sur la réplication virale. En effet, les nombreux RNAi et génome édition dotés d’écrans ont été menées dans les types de cellule hôte d’invertébrés et de vertébrés qui ont dévoilé de nouvelles facettes de virus-hôte interactions8,9,10, 11 , 12. ces écrans emploient généralement virus codant des journalistes, comme la luciférase firefly (LUC) ou protéines fluorescentes (e.g., GFP, DsRed), qui fournissent un moyen pratique d’évaluer quantitativement l’expression de gènes viraux comme une lecture pour la réplication virale9,12. Cette stratégie permet aux chercheurs d’identifier les facteurs de l’hôte qui soit promouvoir ou antagonisent la réplication virale, comme en témoignent les augmentations ou diminutions, respectivement, en journaliste virale signaux9,12. Toutefois, dans la grande majorité des cas, ces écrans ont été réalisées à l’aide de virus qui sont bien adaptés pour le type de cellule hôte dans lequel ils sont à l’étude. Si cette stratégie peut être importante pour la compréhension des relations coévolutive entre les virus pathogènes et leurs hôtes naturels, il pose des préoccupations fondamentales au sujet de leur utilisation en découvrant facteurs antiviraux de l’hôte. Dans ces cas, une amélioration dans la journaliste virus signal à Arni knockdown est recherchée ou à l’inactivation d’un facteur cellulaire qui normalement empêche la réplication virale. Tout d’abord, si un virus est déjà capable de se répliquer fermement dans la cellule hôte examinée dans des conditions de contrôle, la plage dynamique de l’écran (c'est-à-dire, la capacité de distinguer entre le fond et journaliste virale accrue des signaux) peut être limitée. Deuxièmement, ce problème est aggravé par les situations dans lesquelles le virus est bien adapté à la cellule hôte et efficace à la lutte contre les voies de défense hôte qui sont ciblés sur l’écran.

En raison de préoccupations ci-dessus au sujet de l’interaction virus-hôte traditionnelles méthodes de dépistage, nous avons développé un nouveau paradigme pour étudier les interactions virus-hôte qui exploitent les infections naturellement abortif arbovirus dans des cellules d’insectes lépidoptères. Cette stratégie découle d’une observation que l’arbovirus humaine bien étudiés, VSV, subit une infection avortée dans les cellules dérivées de la spongieuse (L. dispar)13. VSV est naturellement transmise par des insectes diptères (c.-à-d., phlébotomes) aux hôtes mammifères et il a été démontré expérimentalement pour infecter un large éventail d’invertébrés et vertébrés hôtes dans les deux cellules de culture et in vivo14. Le génome d’ARN simple brin sens négatif 11-Ko de la VSV encode les ARNm subgénomique cinq qui sont chacun traduits les protéines qui composent le virion enveloppé. Cependant, systèmes de génétique inverses VSV ont permis la création de souches aptes à la réplication encodage LUC ou protéines fluorescentes, outre les cinq VSV naturelle gène produits15,16,17. Comme ces protéines journaliste ne sont pas incorporées dans le virion VSV, ils proposent une lecture commode pour l’expression de gène VSV qui survient après l’entrée. À l’aide de souches VSV codant la GFP ou LUC, nous avons déjà montré que l’expression des gènes VSV est strictement limitée à l’entrée des cellules LD652 et que les titres VSV n’augmentent pas par une infection après 72 heures (hpi). En revanche, la co-infection des cellules LD652 VSV et les mammifères poxvirus, virus de la vaccine (VACV), provoque une augmentation logarithmique de l’expression des gènes VSV tant des titres par ce point dans le temps. VACV subit l’expression des gènes précoces, réplication de l’ADN et la fin expression génique dans les infections de cellules LD652, mais le cycle de réplication VACV est finalement avorté en raison de virion incomplète morphogenèse18. Le grand génome d’ADN ~ 192-Ko de VACV encode les protéines > 200, dont beaucoup affichent des propriétés immunomodulatrices qui favorisent la réplication virale par la suppression de l’hôte des réponses immunitaires19. Par conséquent, nous avons émis l’hypothèse que le « sauvetage » de la réplication dans les cellules LD652 de la co-infection VACV VSV a été probablement véhiculé par immunomodulateurs VACV qui inhibe les réponses dispar L. normalement limiter la réplication VSV. À l’appui de cela, le traitement des cellules LD652 avec l’inhibiteur de II hôte RNA polymérase actinomycine D sauve aussi réplication de la VSV dans les cellules LD652, indiquant que la transcription dépendante h6te bloque VSV réplication après l’entrée13.

Ces observations suggèrent que le caractère restrictif naturellement des cellules LD652 à l’infection de VSV peut fournir un fond relativement faible lorsque le dépistage pour les conditions qui améliorent les signaux codés VSV journaliste (c'est-à-direceux qui inhibent l’hôte défenses antivirales). Ici, nous fournissons les méthodes pour l’utilisation de la fluorescence ou analyses LUC à l’écran pour des conditions qui soulagent la restriction de la VSV dans des cellules chez les lépidoptères. Tout d’abord, nous montrons comment ces tests peuvent être utilisés pour identifier les facteurs immunomodulateurs virally codé qui cassent la restriction VSV au cours de deux expériences de co-infection ou par le biais de l’expression ectopique de facteurs viraux de candidat. À titre d’exemple, nous illustrons comment nous avons utilisé ces techniques de dépistage pour identifier les poxvirus codé A51R protéines comme une nouvelle famille de facteurs immunomodulateurs qui sauver réplication VSV en l’absence d’autres facteurs de poxvirus13. Deuxièmement, nous illustrons comment RNAi de dépistage dans les infections de cellule de VSV-LD652 restrictives peut servir à identifier directement facteurs de l’hôte eucaryote participant à arbovirus restriction13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. GENERALITES Lymantria dispar (LD652) Culture de cellules et Virus

  1. LD652 cellule culture et placage
    1. À la culture dispar L.-dérivées des cellules LD652, maintenir une monocouche de cellules dans un milieu de culture (Table des matières) incubés à 27 ° C sous atmosphère normale. Maintenir les cellules en plats de tissu-culture-traitée de 10 cm et de passage des cellules en arrivant à confluence de 80 %.
    2. Plaque, déloger les cellules adhérentes de LD652 de la plaque en pipettant également les médias à plusieurs reprises sur la monocouche (ces cellules ne nécessitent pas de trypsinisation de déloger) et diluer l’échantillon dans les milieux de culture à une densité approximative de 1 x 105 cellules/mL. Pipette 1 mL de culture dilué/puits d’une plaque 24 puits. Graines d’un minimum de trois répliques puits/traitement type pour chaque point dans le temps (un maximum de huit traitements/plaque).
    3. Laissez les cellules à se contenter d’un minimum de 1 h.
  2. Préparation de virus de la Vaccine
    1. Pour préparer les stocks de VACV, amplifier le virus en HeLa cellules20 ou des cellules de rein de singe vert africain (cellules BSC-1 ou BSC-40)20,21,22.
      Remarque : La souche VACV Western Reserve (VACV-WR) fonctionne bien dans les essais décrits ici.
    2. Titrer l’essai VACV souche via le plaque sur BSC-1 ou BSC-40 cellules20,22.
      NOTE : Tous ont indiqué multiplicité VACV d’infection (MOI) décrites ici pour LD652 les infections cellulaires reposent sur des titres obtenus à partir des essais de plaque BSC-40.
  3. Préparation de virus de la stomatite vésiculeuse
    1. Pour préparer les stocks VSV, amplifier le virus dans les cellules BHK23.
    2. Titrer VSV par essai de plaque sur BSC-40 ou BHK cellulaires monocouches13,23.
      Remarque : Tous les MOIs de VSV décrites ici pour LD652 les infections cellulaires reposent sur des titres obtenus à partir des essais de plaque BSC-40.

2. basés sur la fluorescence VSV sauvetage dosage à l’aide de la co-infection et l’imagerie de cellules vivantes

  1. Ensemencement et l’infection des cellules LD652
    1. LD652 plaque 40 000 cellules/puits d’une chambre de 8 puits.
    2. Pour l’imagerie de cellules vivantes basés sur la fluorescence, utiliser des souches VSV codant des protéines fluorescentes. Les expériences présentées ici utilisent VSV-DsRed17, une souche recombinante de VSV qui exprime des protéines DsRed libres qui ne sont pas fusionné à toute autre protéine de la VSV.
      Remarque : L’infection des cellules LD652 VSV n’est pas cytopathogène par hpi 96 et, ainsi, la mort cellulaire n’est pas un facteur de confusion lors de l’évaluation de réplication VSV dans ce laps de temps.
    3. Préparer la VSV-DsRed et VACV-FL-GFP dans un milieu sans sérum (GDF ; Table des matières) à un MOI de 1 et 25, respectivement.
      Remarque : VACV-FL-GFP est une souche recombinante de VACV qui exprime une fusion entre LUC et GFP24. Un MOI de 25 ou plus pour les souches VACV s’assure que toutes les cellules de LD652 infecté13. Si vous utilisez un autre virus coinfecting, ministère de l’intérieur devront être déterminées empiriquement par l’utilisateur. Chaque traitement de l’infection doit être mis en place dans les puits dédoublés et inclure les traitements mock-infectés dans lequel seulement GDF est ajouté aux cellules.
    4. Incuber les cellules dans 0,2 mL d’inoculum pendant 2 h à 27 ° C.
    5. Laver les cellules avec 0,5 mL/bien des milieux de culture.
    6. Incuber les cellules à 25 μM de colorant de viabilité cellulaire (Table des matières) dans les milieux de croissance pendant 45 min à 27 ° C.
    7. Aspirer les médias et laver les puits 1 x 0,5 ml/bien pour enlever le colorant excédentaire.
    8. Maintenir les cellules en 0,3 mL/bien des milieux de croissance.
  2. Vivre la cellule image capture
    1. Tourner sur un microscope confocal 30 min à l’avance et un plat de 8 puits chambre de charge.
      Remarque : Les cellules de LD652 peuvent être photographiées à température ambiante allant de 20 à 25 ° C, mais pour des conditions optimales, la température de la pièce doit être ajustée à 27 ° C.
    2. Configurer les paramètres d’excitation/émission appropriés pour chaque protéine marqueur fluorescent à être photographiée, ainsi que les paramètres d’image de contraste de phase.
    3. Ajuster l’intensité du laser pour chaque canal.
      Remarque : Cela peut nécessiter une expérience pilote pour déterminer la plage d’intensité de signal fluorescent observée tout au long de temps à utiliser dans la dernière expérience en cours d’exécution.
    4. Avec l’objectif 10 X, enregistrez les images de contraste et de la fluorescence de phase de chaque bien chaque 1 – 5 h pour la durée de l’infection jusqu'à un certain point la durée souhaitée (par exemple., 48 – 72 hpi).
      Remarque : Il est important de saisir les multiples champs de vision dans chaque puits d’évaluer avec précision le taux d’infection dans l’ensemble de la culture.
  3. Analyse d’images
    1. Utiliser le logiciel d’analyse image pour analyse d’image automatique de canaux fluorescents appropriés (par ex.., 405 nm, 488 nm, 568 nm).
    2. Pour calculer le pourcentage de cellules qui sont infectés, divisez le nombre total de cellules fluorescentes indiquant une infection VSV (e.g., cellules DsRed positives pour les infections de VSV-DsRed) par le nombre total de cellules viables marquées par le colorant de viabilité cellulaire pour chaque champ de vision à travers tous les traitements.

3. le général Infection virale protocole pour VSV axée sur la Luminescence des dosages de sauvetage dans les cellules de LD652

  1. Préparation de l’inoculum
    1. 30 min avant l’infection, décongeler les stocks de VSV-LUC16 (un recombinant VSV souche qui se déclare libre firefly luciférase protéine ne fondue pas à toute autre protéine de la VSV). Si le dosage pour le sauvetage de VSV-LUC au cours de la co-infection VACV, également décongeler le virus VACV-WR sur la glace.
      Remarque : Autres virus (en dehors de VACV-WR) peuvent sauver VSV-LUC au cours de la co-infection, mais cela devra être déterminé empiriquement par chaque utilisateur.
    2. Préparation de l’inoculum en diluant VSV-LUC en présence ou en absence de VACV-WR dans la gestion durable des forêts tels qu’un MOI de 10 et 25, respectivement, est atteint lors de l’ajout d’un volume total d’inoculum de 0,2 mL/ainsi.
  2. Infection des cellules
    1. Aspirer mature LD652 médias avec précaution pour ne pas perturber la monocouche et ensemencer avec 0,2 mL de virus/puits. Ce temps est défini comme 0 hpi. Ajouter GDF stérile aux puits supplémentaires pour servir de « mock-infecté » des traitements de contrôle négatif.
    2. Incuber les cellules de l’inoculum pendant 2 h à 27 ° C.
    3. À 2 hpi, enlever l’inoculum par aspiration et remplacer par 1 mL/bien des milieux de culture LD652.
    4. Permettre l’infection aller de 24 à 72 hpi.

4. de luciferase

  1. Préparation des lysats cellulaires
    1. Soigneusement, aspirer le surnageant et ajouter 1 mL de solution saline tamponnée au phosphate de Dulbecco (SPD) / bien.
    2. En utilisant le piston d’une seringue de 1 mL, gratter les cellules dans le SPD.
    3. Transférer les cellules dans un tube de microcentrifuge et centrifuger à 400 x g pendant 20 min à 4 ° C.
    4. Pendant ce temps, préparer 1 dilution x 5 x tampon de lyse de journaliste (RLB) stérile H2O.
    5. Après la centrifugation, aspirer le SPD sans déranger le culot cellulaire.
    6. Resuspendre chaque culot dans 150 µL de 1 x RLB.
    7. Gel-dégel des échantillons 1 x en utilisant une période d’incubation de 5 min dans un congélateur à-80 ° C suivi d’un dégel rapid dans un bain-marie à température ambiante. Stocker les lysats à-80 ° C jusqu’au moment de l’analyser.
  2. Analyse de luciferase
    1. Décongeler les lysats sur la glace.
    2. Distribuer 20 μL de lysat dans un puits d’une microplaque de 96 puits solide noir ou blanc.
    3. Ajouter 100 μl de réactif d’analyse luciférase dans chaque puits.
    4. Mesurez immédiatement l’intensité lumineuse à l’aide d’un luminomètre (paramètres appropriés pour luminomètres spécifiques devront être déterminées empiriquement par l’utilisateur).
  3. Analyse de test de luciférase
    1. Normaliser les signaux de LU pour chaque traitement de lectures LU obtenus à partir des traitements de lutte (Représentant des résultats). Après ont effectué au moins trois expériences indépendantes, la moyenne que lu provenant de chaque groupe de traitement/contrôle peut être analysée par les tests statistiques appropriés.

5. Immunoblot

  1. Utilisez les lysats extraites pour les dosages LUC pour SDS-PAGE et immunoblotting ultérieur, à l’aide d’instruments et réactifs appropriés.

6. titre de la VSV de Cultures de cellules LD652

  1. Plaque de LD652 cellules selon étape 1.1.
  2. Viral infectent les cellules selon l’étape 3.
  3. Aux moments désirés, recueillir les surnageants dans des microtubes stériles à.
  4. Les cellules à l’aide de 1 000 x g pendant 10 min à 4 ° C de granule et transférer les surnageants dans de nouveaux tubes.
  5. Stocker les surnageants à-80 ° C ou bien procéder à titrage par essai de plaque sur les cellules BSC-40.
    Remarque : Si le titrage VSV de cultures de cellules LD652 qui contenait des VACV, il est conseillé d’ajouter 100 μg/mL cytosine arabinoside (AraC) pour les milieux de culture de BSC-40 dans 2 hpi, pour empêcher que les particules résiduelles de VACV formant des plaques sur des monocouches de BSC-4013. AraC est un inhibiteur de l’ADN polymérase virale qui bloque la réplication de l’ADN VACV25 , mais n’affecte pas la réplication de la VSV.

7. variations de la VSV axée sur la Luminescence des essais dans les cellules LD652 de sauvetage : RNAi et expériences de Transfection de plasmide

  1. Préparation d’ARNdb de précipitation véhiculée par ARNi de virale ou d’accueillir des transcriptions
    1. Amorces de gène-spécifique de conception à queue à l’extrémité 5' avec la séquence du promoteur T7 (TAATACGACTCACTATAGGG) soit cibler le virus coinfecting (par exemple, VACV) ou dispar L. mRNA transcriptions d’intérêt. Ces amorces devraient produire un produit de PCR de 400 – 600 bp pour efficace par l’ARN-knockdown. Voir Gammon et al. 13 pour les séquences d’amorces utilisée ci-dessous à coup de masse VACV ou dispar L. transcriptions de dsRNA véhiculée par ARNi dans les cellules LD652.
      NOTE : Dispar L. mRNA transcriptions peuvent être identifiées à partir publié dispar L. transcriptome bases de données26,27,28.
    2. Générer un ADN modèle par RT-PCR (synthèse de cDNA : 1 cycle de 50 ° C pendant 30 min ; PCR : 40 cycles de 94 ° C pendant 15 s, 50 ° C pendant 30 s et 68 ° C pendant 45 s chacun).
    3. Purifier le produit de la PCR à l’aide d’un kit de purification de PCR.
    4. Le produit PCR purifié en utilisant comme modèle, in vitro transcrire et purifier dsRNA utilisant un in vitro kit transcription et la purification.
  2. Transfection de dsRNA ou l’ADN de plasmide dans les cellules de LD652
    1. Semences de 1 x 105 cellules/puits d’une plaque 24 puits et laisser les cellules à se contenter d’au moins 1 h.
    2. Pour chaque puits à transfecter, diluer 4 μl de réactif de transfection dans 100 μl de l’AFD. Incuber pendant jusqu'à 15 min à température ambiante. Cela peut être dimensionnée pour faire un mélange maître pour tous les transfections à accomplir.
    3. Diluer jusqu'à 1 μg de dsRNA ou l’ADN de plasmide total avec 100 μL de GDF pour chaque puits à transfecter. Incuber pendant jusqu'à 15 min à température ambiante.
      NOTE : Nous avons trouvé précédemment qu’une transfection de 1 μg de dsRNA/105 LD652 cellules suffit pour > knockdown 80 % soit virale ou d’accueillir des transcriptions13, mais des doses de dsRNA nécessaires pour modification expérimentale set-ups/conditions devront être déterminés de façon empirique.
    4. Combiner la transfection réactif et dsRNA/plasmide ADN des dilutions avec un ratio 1:1 (par exemple, 100 μL de dsRNA dilué est mélangé avec 100 μl de réactif de transfection dilués) et incuber pendant 20 min à température ambiante.
    5. Pendant ce temps, laver les puits avec 1 mL/puits de GDF et puis ajouter 500 μl de l’AFD dans chaque puits.
    6. Ajouter lentement l’ARNdb de réactif de transfection (ou l’ADN de plasmide) mélange goutte à goutte dans chaque puits.
    7. Incuber le réactif de transfection avec les cellules pendant 5 h.
      1. Pour RNAi expériences impliquant la précipitation des transcriptions codées par un virus coinfecting (par exemple, VACV), remplacer le réactif de transfection après la période d’incubation de transfection de 5 h avec un inoculum de virus contenant VSV-LUC (avec ou sans VACV ou un autre virus coinfecting) (étape 3). Par la suite, remplacer l’inoculum de virus contenant VSV-LUC avec hpi médias 2 croissance complète. Tests de LUC (étape 4) puis peuvent être effectuées que sur des lysats extraites à divers moments pour déterminer si la précipitation de coinfecting transcriptions de virus entraîne une perte de sauvetage VSV-LUC.
      2. Pour les expériences d’Arni impliquant Arni des transcriptions dispar L. , replacer le mélange de transfection avec milieux de croissance complète et laisser knockdown de s’ensuivre pendant 24 h avant l’infection avec VSV-LUC (étape 4). Tests de LUC (étape 4) puis peuvent être effectuées que sur des lysats extraites à divers moments pour déterminer si la précipitation des transcriptions dispar L. favorise le sauvetage de VSV-LUC.
      3. Pour les expériences impliquant des transfections des vecteurs d’expression de plasmide exprimant candidat immunomodulateurs, remplacer le réactif de transfection et permettant l’expression de la protéine pendant 24 h avant l’infection avec VSV-LUC (étape 4). Tests de LUC (étape 4) puis peuvent être effectuées que sur des lysats extraites à divers moments pour déterminer si l’expression de protéines immunomodulatrices candidat favorise le sauvetage de VSV-LUC.
        Remarque : Les transfection conditions décrites ici à l’aide de 1 μg/puits des résultats d’ADN de plasmide dans l’efficacité de transfection de 40 à 60 %13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Par exemple des applications d’imagerie de cellules vivantes pour surveiller le sauvetage VSV sur la co-infection VACV, LD652 cellules ont été plaqués dans un plat de lamelle de 8 puits puis infectés par le simulacre ou infectés par VSV-DsRed (MOI = 1) en présence ou en absence de VACV-FL-GFP (MOI = 25). Parce que VSV-DsRed exprime DsRed comme une protéine libre et n’est pas fusionné à protéines structurales de VSV (Figure 1 a), il est détecté uniquement après l’amorce de VSV entrée et l’expression génique. Toutes les cellules sont ensuite marquées avec colorant de viabilité cellulaire qui passe librement à travers la membrane plasmique des cellules, où il est transformé en un produit membrane-imperméants, qui favorise le maintien du signal fluorescent en cellules marquées. Les images ont été acquises toutes les 5 h jusqu'à 65 hpi, à l’aide de la 405 nm, 488 nm, 568 nm et blanc lumineux filtres pour capturer le colorant de viabilité cellulaire, VACV-FL-GFP, VSV-DsRed et canaux de phase de contraste (PC), respectivement. Dans des conditions d’infection unique, LD652 cellules restreignent la réplication VSV-DsRed ; par conséquent, seul un petit nombre de cellules présentent un signal DsRed. Cependant, la co-infection de VSV-DsRed avec VACV-FL-GFP résulte dans la plupart des cellules afficher des signaux DsRed avant la fin de l’évolution temporelle (Figure 1 b). Images capturées à chaque point dans le temps ont été soumises aux logiciels d’analyse image 405 nm et les images de canal 568 nm ont été utilisées pour déterminer automatiquement le total et le nombre de cellules positives DsRed, respectivement. Le pourcentage de cellules en affichant un signal DsRed pour chaque traitement est calculé en divisant les objets (cellules) par un signe positif dans le chenal de 568 nm par le nombre d’objets identifiés dans le chenal de 405 nm pour chaque point de temps, suivie par la multiplication de 100 % . Comme le montre la Figure 1, environ 2 % des cellules de VSV-DsRed infections simples avaient DsRed positif par hpi 65. En revanche, ~ 77 % des cellules de VSV-DsRed + co-infections VACV-FL-GFP avaient DsRed positif à ce point dans le temps. Films S1 et S2 montrent la progression de l’infection de VSV-DsRed au cours de tout ce temps 65-h dans la seule infection et des conditions de co-infection, respectivement. Il est important de noter que l’expression de la GFP par VACV-FL-GFP devenue détectable par 10 hpi, avant le signal de DsRed, indiquant que l’expression des gènes VACV suffisante est requise avant le sauvetage de VSV-DsRed (non illustré). Collectivement, ces résultats indiquent clairement une opération de sauvetage de VSV-DsRed réplication de co-infection par VACV. Si un virus coinfecting n’a pas pu sauver VSV-DsRed, nous nous attendrions égales pourcentages de cellules DsRed positives entre l’infection unique et traitements de la co-infection.

La réplication dans les cellules LD652 VSV peut alternativement être quantifiée à l’aide d’analyses luminescence lors de l’utilisation de souches de VSV-LUC (Figure 2 a). À titre d’exemple, la Figure 2 b montre les résultats d’un test LUC à l’aide de lysats préparés sur une durée de 72 h de cellules infectées par un simulacre ou les cellules infectées par VSV-LUC (MOI = 10) en présence ou en absence de VACV-WR (MOI = 25). Un sauvetage positif de réplication VSV-LUC est illustrée par l’augmentation logarithmique dans LU arbitraire détecté avec des lysats de cellules co-infectées, comparés aux lysats de simples infections VSV-LUC de. Un résultat négatif pourrait figurer dans cet essai par l’échec d’une co-infection à modifier lectures LU de celles observées dans les traitements de l’infection de VSV-LUC unique. Si vous le souhaitez, lysats préparés également utilisable pour immunoblotting, pour confirmer l’expression de gène VSV accrue dans les traitements de la co-infection. Par exemple, Figure 2 montre un résultat typique d’immunoblot pour LUC VSV-codé et la matrice protéines (M) dans les lysats préparés à partir de mock-, VSV-LUC et LUC VSV + VACV-WR traitements 72 hpi. Immunoblotting I3L VACV protéine servi comme marqueurs de l’infection VACV et immunoblotting pour l’actine cellulaire a été utilisé comme un contrôle de chargement. L’amélioration claire des protéines codées VSV LUC et M dans les lysats de co-infection encore confirmer sauvetage VSV par VACV. Enfin, la réplication VSV productive peut être confirmée en recueillant des surnageants de ces cultures de cellules LD652 et titrant un virus infectieux sur des monocouches de BSC-40 (Figure 2D). Ce résultat montre que seulement pendant VACV la co-infection ne VSV productivement répétée.

Une fois un virus coinfecting est montré capable de sauver la réplication dans les cellules LD652 VSV, Arni dépistage peut servir à identifier les facteurs codées par le virus coinfecting qui contribuent au sauvetage de la VSV. Dans cette expérience, l’écran correspondant à une condition de RNAi qui mène à un phénotype « perte de sauvetage » au cours de la co-infection de la VSV-LUC avec un virus de sauvetage. Précédemment, nous avons identifié la protéine VACV A51R comme un facteur de sauvetage VSV grâce à un dépistage de RNAi de dizaines de transcriptions codées VACV13. À titre d’exemple, nous avons récapitulé une version plus petite de cet écran (Figure 3). Arni est médiée par transfection de in vitro transcrit les ARN doubles brins qui ciblent les transcriptions codées par le virus coinfecting. Dans les données présentées ici, transcriptions virales codant des protéines VACV A50R, A51R et A52R ont été ciblées pour RNAi knockdown. Comme témoin négatif pour la perte de sauvetage, les cellules ont été transfectées également avec ARN doubles brins ciblant les transcriptions de codage de GFP. Comme témoin positif pour une perte de phénotype de sauvetage, les cellules ont été transfectées avec ARN doubles brins contre LUC-codage des relevés de notes. Ce traitement produit une forte perte de signal LU au cours de la co-infection et aide les chercheurs à confirmer que les protocoles de transfection/Arni travaillent. Après 5 h de dsRNA transfection, les cellules sont coinfectés par VSV-LUC (MOI = 10) et VACV-WR (MOI = 25). Les infections séparées avec seulement VSV-LUC ont également été effectuées afin d’établir un niveau de fond du signal LU. Lysats étaient alors récolté 72 hpi et utilisés dans un test de LUC. Comparant le niveau de sauvetage VSV entre dsRNA traitements pour le traitement de contrôle de dsRNA GFP, les résultats indiquent que la précipitation de VACV A51R produit une forte perte de phénotype de sauvetage, tandis que la précipitation d’A50R et A52R produit un résultat négatif (aucune perte de sauvetage par rapport à GFP dsRNA).

Comme alternative à l’ARNi pour identifier les facteurs virus qui contribuent au sauvetage VSV, surexpriment les facteurs viraux de candidat dans les cellules LD652 et puis de dosage pour le sauvetage de VSV-LUC. Cela est possible par clonage des gènes candidats d’intérêt dans des vecteurs d’expression appropriée comme p16629 et transfectants ces plasmides dans les cellules de LD652 avant le défi de VSV-LUC. Par exemple, Figure 4 a montre une expérience de sauvetage dans lequel le drapeau-tag GFP (Jeremfinck) ou drapeau-le tag A51R vecteurs p166 (FA51R) ont été transfectés dans des cellules LD652 à différentes concentrations, suivies d’une infection de VSV-LUC (MO = 10) 24 h plus tard. Comme témoin négatif pour le sauvetage de la VSV, cultures supplémentaires ont été transfectées mock et n’a pas reçu l’ADN plasmidique. Lysats ont été prélevés sur les 72 hpi cultures et ont été soumis à des essais LUC. Traitements FA51R provoquèrent un résultat positif de sauvetage VSV, tel que démontré par renforcée LU signaux sur maquette transfectées traitements à doses multiples. En revanche, les traitements de Jeremfinck étaient négatifs pour sauvetage VSV à toute dose testée. L’immunotransfert des lysats de Figure 4 a confirmé une expression similaire des protéines Jeremfinck et FA51R (Figure 4 b).

À l’aide d’un criblage de RNAi de candidat dispar L. facteurs, nous avons montré que la restriction de la VSV dans les cellules de LD652 est médiée par divers facteurs cellulaires appartenant aux antiviraux Arni voies (p. ex., AGO2 et Dicer-2), le facteur nucléaire Kappa B (NF-κB)-voie de IMD connexe (p. ex., Relish)et le système ubiquitine-protéasome (e.g., polyubiquitine)13. À titre d’exemple, nous avons répété une version plus petite de ces expériences d’Arni avec ARN doubles brins ciblant les transcriptions dispar L. qui augmentent le réplication VSV-LUC sur la précipitation (e.g., AGO2, Dicer-2, Relish, polyubiquitine) ou n’a eu aucun effet (AGO1 )13. Après 24 h d’ARNdb transfection, les cellules ont été contestés avec VSV-LUC pendant 72 h pour déterminer si Arni traitements améliorés LU signaux sur les traitements de dsRNA GFP contrôle négatif. Arni traitements qui améliorent LU signaux indiquent que le facteur codé par la transcription ciblée restreint la réplication de VSV. Comme témoin positif pour RNAi knockdown, dsRNA ciblant les transcriptions LUC-codage ont été également transfectées dans les traitements parallèles. En raison de la faible bruit de fond LU signaux détectés dans des traitements de lutte de dsRNA GFP, c’est relativement simple d’identifier les facteurs de restriction d’hôte codé à l’aide de dépistage Arni parce que leur précipitation produit environ 10-à des augmentations dans les signaux de LU ( 1000 fois Figure 5). Ainsi, il est possible de tirer parti de l’arrière-plan du relativement faible niveau d’expression de gène VSV dans les cellules LD652 pour détecter les conditions de précipitation Accueil Arni qui soulagent la restriction de la VSV.

Figure 1
Figure 1 : Identification de sauvetage VSV de co-infection du virus de l’imagerie de cellules vivantes basés sur la fluorescence des cellules LD652. (A), ce panneau affiche un schéma d’un génome de VSV-DsRed indiquant la localisation des gènes DsRed (dR). Les images de microscopie confocale (B) ces représentant 10 X sont capturé 60 hpi. Le canal de 405 nm indique une tache pour des cellules viables, le canal 488 nm indique une infection VACV-FL-GFP et chenal 568 nm indique une infection de VSV-DsRed. Images de contraste (PC) de phase sont également indiqués. Barreaux de l’échelle = 100 µm. (C), ce panneau indique le pourcentage de cellules positives DsRed LD652 au cours de temps h 65 toute infection. Le pourcentage moyen de (SD) des cellules montrant un signal DsRed pour chaque point dans le temps est montré. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : évaluation de sauvetage VSV dans les cellules de LD652 utilisant la LUC. (A), ce panneau affiche un schéma d’un génome de VSV-LUC. (B) ce panneau montre les unités lumineuses arbitraires les dosages (LUC) de lysats de cellules infectées par un simulacre ou les cellules infectées par VSV-LUC, en l’absence ou la présence de VACV-WR. (C), ce panneau indique un immunoblot de LUC, VSV M, I3L VACV et protéines actine cellulaire dans les lysats de panneau A recueilli 72 hpi. (D) ce panneau montre les titres de VSV-LUC dans les surnageants de culture provenant du groupe B. Les données quantitatives dans les séries B et D représentent le moyen (±et) des expériences réalisées en trois exemplaires. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Identification d’un facteur de sauvetage VSV virally codé par ARNi dépistage au cours de la co-infection des cellules LD652. Ce panneau montre les changements de pli dans LU détecté dans les lysats de cellules 72 hpi avec VSV-LUC et VACV-WR après le traitement indiqué de RNAi, par rapport à LU détecté dans les lysats de cellules infectées individuellement avec VSV-LUC. Les données représentent les moyens (± SD) des expériences réalisées en trois exemplaires. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : sauvetage de la VSV par la surexpression d’un immunomodulateur virale dans les cellules LD652. (A) ce panneau indique un LUC doser chez les cellules infectées par VSV-LUC 72 hpi qui ont été transfectées mock (mock) ou transfectées avec les plasmides d’expression p166 soit Jeremfinck ou FA51R. LU signaux provenant de chaque traitement ont été normalisées aux signaux détectés dans les traitements de contrôle transfectées mock. Les données représentent les moyens (± SD) des expériences réalisées en trois exemplaires. (B), ce panneau montre les lysats de panneau A, immunoblotted avec des anticorps de drapeau et de l’actine. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : Identification des hôtes facteurs limitant la réplication VSV LD652 des cellules à Arni dépistage. Ce panneau indique le pli modifier dans LU des signaux dans les traitements de RNAi indiquées par rapport à l’ARNdb GFP contrôle traitements hpi 72 avec VSV-LUC. Les données représentent les moyens (± SD) des expériences réalisées en trois exemplaires. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Film S1 : représentant 405 nm (colorant de viabilité cellulaire) et 568 images de couche nm (DsRed) capturés sur un parcours de temps 65 h (chaque image = intervalle de 5 h) après l’infection de VSV-DsRed des cellules LD652. S’il vous plaît cliquez ici pour télécharger ce fichier.

Film S2 : représentant 405 nm (colorant de viabilité cellulaire) et 568 images de couche nm (DsRed) capturés sur un parcours de temps 65 h (chaque image = intervalle de 5 h) après la co-infection des cellules LD652 VSV-DsRed et GFP-FL-VACV. S’il vous plaît cliquez ici pour télécharger ce fichier.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Ici, nous avons décrit simple base de fluorescence et de luminescence des tests pour dépister les conditions de sauvetage réplication VSV dans des cultures cellulaires de lépidoptères restrictives. L’infection avortée de la VSV dans les cellules lépidoptères crée un excellent rapport signal-bruit lors du dosage pour l’expression des gènes VSV. Par exemple, les signaux de LU détectés dans les lysats de simples infections VSV-LUC étaient ~ 1000 plus élevé que dans les lysats mock-infectés, mais ces signaux changé seulement environ deux fois sur un parcours de 72 h temps. En revanche, la co-infection de VSV-LUC avec VACV amélioré signaux LU ~ 300 fois plus simple des infections de VSV-LUC par hpi 72. Ainsi, tests de sauvetage VSV affichent une excellente gamme dynamique, qui englobe plusieurs ordres de grandeur.

Une des étapes essentielles à mettre en place ces tests implique la décision d’analyser pour le sauvetage VSV en utilisant des approches à base de luminescence ou de fluorescence. Nous avons montré des exemples de comment codé VSV DsRed signaux peuvent être dosés quantitativement à l’aide de techniques d’imagerie de cellules vivantes et des paquets de logiciels qui facilitent la quantification automatique des cellules positives DsRed en absence ou en présence d’un sauvetage co-infection. Si les chercheurs ont accès aux capacités d’imagerie de cellules vivantes, ces tests sont peu coûteux à mettre en place et leur permettent de capturer un large éventail de points de temps qui peut aider à détecter des différences de cinétique de réplication VSV qui sont seulement observables dans le temps étroit Windows. En revanche, les approches axées sur la luminescence sont essentiellement des dosages de point final qui exigent la préparation des lysats de cellules à des moments prédéterminés, et préparation lysate peut prendre beaucoup de temps. En revanche, les analyses luminescence ne nécessitent pas de matériel sophistiqué de microscopie — seulement d’un lecteur capable de lire les signaux de la luminescence. Par ailleurs, les tests axés sur la luminescence ont une plage dynamique supérieure axée sur la microscopie des dosages qui permettent de calculer le pourcentage de cellules infectées. Par exemple, lors d’essais de microscopie, cellules DsRed positives (indiquant la VSV-DsRed infection) peuvent seulement varier entre 0 et 100 % des cellules analysées dans un champ de vision. En revanche, LU signaux entre VSV-LUC unique et des conditions de co-infection (ou d’autres conditions de sauvetage) peuvent s’étendre sur plusieurs ordres de grandeur.

Un avantage majeur d’utiliser le système de cellule de VSV -dispar L. présenté ici pour dépister les mammifères immunomodulateurs virus-encodé est qu’elle sélectionne intrinsèquement pour l’identification des facteurs virus qui suppriment ce qui sont susceptibles d’être conservées et antique réponses antivirales qui datent d’avant la réponse interféron vertébré spécifiques. En effet, observations préliminaires suggèrent que les protéines A51R inhibent conservés liés à ubiquitine-protéasome cellulaires réponses antivirales (voir Gammon et al. 13 et les données non publiées). La découverte du sauvetage de VACV A51R de la VSV a été le premier exemple d’une opération de sauvetage de virus hétérologue par un virus vertébré dans un hôte invertébré13, et il est probable que ces systèmes de dépistage vont découvrir autres vertébrés virus-encodé immunomodulateurs . Il est important de noter que la clé à l’aide de sauvetage VSV comme une lecture des conditions qui empêchent l’immunité de l’hôte est que la réplication VSV doit être fortement restreint (ou avortées) dans le type de cellule que réplication VSV est examinée dans. Par conséquent, des types de cellules mammaliennes plus serait probablement inadaptés pour ces types d’analyses, étant donné que VSV se reproduit bien dans les cellules de mammifères. C’est pourquoi les cellules dispar L. ont été utilisées ici comme un type de cellule hôte naturellement restrictives de VSV.

Une étude préalable en cellules de drosophile a montré que virales suppresseurs de réponses antivirales d’Arni pourraient être identifiées par la cotransfection des plasmides d’expression encodage candidat Arni suppresseurs et un ARN génomique du virus troupeau maison auto-répliquant qui encode GFP en lieu et place de B2, son naturel Arni suppresseur30. Production de GFP et la réplication de l’ARN génomique du troupeau maison dépendait de la répression de l’ARNi par le facteur cotransfectés candidat et, ainsi, le sauvetage d’expression de la GFP ont indiqué Arni suppression30. Notre travail inédit indique que la surexpression de virus-encodé Arni inhibiteurs sauve aussi VSV-LUC l’expression des gènes dans les cellules de L. dispar , suggérant que ce système peut également servir à identifier suppresseurs de RNAi réponses dans le cadre de infection par un virus pathogène de bona fide par opposition à un réplicon. En effet, la conclusion selon laquelle RNAi - IMD- et voies ubiquitine-protéasome-connexes contribuent à la restriction de la réplication de VSV dispar L. cellules13 suggère que virales antagonistes de plusieurs voies antiviraux peuvent être identifiés par la VSV tests de sauvetage présentées ici.

Une limitation potentielle de ces méthodes de dépistage en ce qui concerne l’identification des protéines antivirales de l’hôte, c’est que la séquence du génome de L. dispar n’est pas encore disponible. Cependant, il y a publiquement disponible dispar L. transcriptomes qui peut servir à identifier des cibles d’hôte candidat pour RNAi défiant26,27,28. En outre, nous avons montré précédemment que VSV est limité dans les lignées de cellules dérivées d’autres lépidoptères13 qui maintenant ont un génome accessible au public (p. ex., Manduca sexta)31. Par conséquent, lignées cellulaires dérivées d’autres lépidoptères génomes séquencés peuvent remplacer les cellules dispar L. , décrits dans le protocole ici.

Compte tenu de la croissance économique et la menace de santé publique d’arbovirus32, les tests de dépistage présentés ici peuvent fournir des stratégies novatrices afin d’identifier les nouvelles fonctionnalités d’interactions d’arbovirus-hôte qui peuvent avoir la valeur dans la conception de nouveaux antiviraux méthodes thérapeutiques. En outre, en raison de notre compréhension relativement limitée des lépidoptères mécanismes pour limiter la réplication des virus à ARN, les outils présentés ici offrent de nouvelles possibilités pour sonder les mécanismes de défense du hôte codés par cette importance économique ordre d’insectes.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n’ont rien à divulguer.

Acknowledgments

D.G. a été appuyée par un financement du programme des bourses de l’Université du Texas Southwestern Medical Center doué. Les auteurs remercient Michael Whitt (The University of Tennessee Health Science Center) et Sean Whelan (Harvard Medical School) pour la fourniture de VSV-DsRed et VSV-LUC. Les auteurs remercient également Gary Luker (Faculté de médecine de l’Université du Michigan) pour le gentil cadeau de la souche VACV-FL-GFP.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arbovirus Infections comme outils de dépistage pour l’Identification des virales facteurs antiviraux immunomodulateurs et hôte
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter