Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

זיהומים arbovirus כמו כלים ההקרנה לצורך זיהוי גורמים אנטי ויראלי Immunomodulators ומנחה

doi: 10.3791/58244 Published: September 13, 2018

Summary

כאן, אנו מציגים את הפרוטוקולים כדי לזהות immunomodulators 1) וירוס מקודד המקדמים arbovirus השכפול וגורמים מארח 2) האיקריוטים שמגבילות את שכפול arbovirus. שיטות אלה פלורסצנטיות הפריה חוץ גופית מבוססות מאפשרים להשיג במהירות את המפרט כמותית של שכפול arbovirus ב מבחני פשטני עם יחס אות לרעש נמוך.

Abstract

התערבות RNA - ו גנום עריכה המבוססת על הקרנת פלטפורמות היה בשימוש נרחב כדי לזהות גורמים התא המארח להגביל את וירוס שכפול. עם זאת, את המסכים הבאים נערכות בדרך כלל בתאים באופן טבעי מתירניות לגורם המחלה ויראלי שנבחנה. לכן, השכפול חזקים של וירוסים בתנאי בקרה עלולה להגביל את הטווח הדינמי של המסכים הבאים. יתר על כן, המסכים הבאים עשויים להיות מסוגל לזהות בקלות מסלולים ההגנה התאית שמגבילות את שכפול הוירוס אם הווירוס הוא סטוש למחשב המארח ובעל יכולת של המאבק הגנות אנטי-ויראלי. במאמר זה, אנו מתארים פרדיגמה חדשה עבור חקר וירוס-פונדקאי אינטראקציות באמצעות מסכי מרכז על זיהומים שנכשל באופן טבעי על ידי arboviruses כגון vesicular stomatitis וירוס (VSV). למרות יכולת VSV לשכפל במגוון רחב של חרקים dipteran ומארח יונקים, VSV עובר זיהום, הכניסה לאחר שנכשל במגוון של שורות תאים שמקורם חרקים lepidopteran, כגון העש צועני (Lymantria dispar). עם זאת, זיהומים VSV שנכשל אלה יכולים להיות "לחלץ" כאשר המארח תא הגנות אנטי ויראליים הם בסכנה. נתאר כמה זנים VSV קידוד גנים כתב נוח ולא מגבילים ל' dispar שורות תאים ניתן לזווג מסכי הגדרת לזהות מארח גורמים מעורבים arbovirus ההגבלה. יתר על כן, אנו גם מראים את התועלת של כלים אלה ההקרנה הזיהוי של גורמים לשווק מקודד להציל VSV שכפול במהלך coinfection, או דרך ביטוי חוץ רחמי, כולל אלה מקודד על ידי וירוסים יונקים. ההגבלה הטבעי של שכפול VSV בתאים dispar ל' מספק יחס אות לרעש גבוה בעת הקרנת עבור התנאים המקדמים הצלה VSV, ובכך מאפשר שימוש פשטני הפריה חוץ גופית - קרינה פלואורסצנטית מבוססי מבחני לפקח השינויים VSV שכפול. מתודולוגיות אלו הם בעלי ערך להבנת יחסי הגומלין בין המארח תגובות אנטי ויראלי התחמקות המערכת החיסונית גורמים.

Introduction

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

היכולת של וירוס לשכפל באופן פרודוקטיבי שורה מסוימת כפוף באופן חלקי הזמינות של התא המארח גורמים התומכים נגיפי כניסה של שכפול1. הטווח וירוס-המארח יכול גם יכתיב את הקיבולת של וירוס מונה הגנות אנטי ויראליים הסלולר הפוגעים אחרת שכפול ויראלי2,3. זה התוצאה של אינטראקציות אלה מורכבים וירוס-מארח זה בסופו של דבר להחליט אם וירוס יהיה מסוגל להשלים את מחזור חייו מארח מסוים. לאור ההשלכות החולני שעשויות להיות עבור המארח אם שכפול ויראלי מתפתח, זה קריטי לפתח אסטרטגיות ניסיוני כדי לקדם את ההבנה שלנו של אינטראקציות וירוס מפתח-מארח זה יכול להטות את הכף בין שנכשל ופורה זיהומים. שחקרתי את התכונות מולקולרית של וירוס-פונדקאי הגומלין יהיה אינסטרומנטלי הפיתוח של אסטרטגיות טיפוליות אנטי ויראליים חדשה ואלטרנטיבית.

עם כניסתו של RNA הפרעה (RNAi)4,5 , כלים לעריכת הגנום (למשל., CRISPR-Cas9, אבץ אצבע nucleases, TALENs)6,7, זה הפך ריאלי השפעול לשנות הביטוי של גורמים הסלולר על הגנום כולו מאזני ולחקור את ההשפעה של שינויים אלה על שכפול הוירוס. ואכן, רבים RNAi, מסכי הגנום-עריכת מבוססי נערכו סוגי תאים הגעה והמארח חוליות זה יש חשפה היבטים חדשים של וירוס-פונדקאי אינטראקציות8,9,10, 11 , 12. המסכים הבאים בדרך כלל מעסיקים וירוסים קידוד כתבים, כמו גחלילית לוציפראז (לוק) או חלבונים פלורסנט (למשל., ה-GFP, DsRed), אשר מספקים אמצעי נוח באופן כמותי להערכת ביטוי גנים ויראליים כמו הבדיקה שכפול ויראלי9,12. אסטרטגיה זו מאפשרת לחוקרים לזהות גורמים מארח או לקדם או להרגיז שכפול ויראלי, כפי שמעידים עליות או ירידות, בהתאמה, ב כתב ויראלי אותות9,12. עם זאת, ברוב המכריע של המקרים, את המסכים הבאים נערכו באמצעות וירוסים מותאמים היטב סוג התא המארח שבו הם נמצאים נחקר. אסטרטגיה זו יכול להיות חשוב להבנת היחסים coevolutionary בין פתוגנים ויראליים מארחיהם טבעי, זה להוות יסוד חששות לגבי השימוש בהם במסגרת חשיפת מארח גורמים אנטי-ויראלי. במקרים אלה, שיפור בוירוס כתב אות RNAi נוקאאוט הוא להיות חיפש, או איון של הסלולר גורם בדרך כלל פוגעת שכפול ויראלי. ראשית, אם וירוס כבר אפשרות לשכפל robustly בתא המארח נבדק בתנאים שליטה, הטווח הדינמי של המסך (כלומר, את היכולת להבחין בין הרקע לבין אותות משופרת כתב ויראלי) עלולה להיות מוגבלת. שנית, בעיה זו מורכב עוד יותר על ידי המצבים בהם הנגיף הוא סטוש לתא המארח ויעיל -המאבק מארח ההגנה מסלולים המיועדים במסך.

בשל החשש לעיל לגבי האינטראקציה וירוס המסורתי-מארח הקרנות שיטות, פיתחנו פרדיגמה חדשה ללמוד אינטראקציות וירוס-פונדקאי לנצל arbovirus שנכשל באופן טבעי זיהומים בתאי חרקים lepidopteran. אסטרטגיה זו נובעת התבוננות arbovirus למד היטב האדם, VSV, עובר זיהום שנכשל בתאים שמקורם עש הצועני (ל' dispar)13. VSV מועברת באופן טבעי על ידי חרקים dipteran (קרי, זבובי חול) בתרבית של המארחים, הוכח בניסוי כדי להדביק את מגוון רחב של חסרי חוליות, מארחים חוליות ב תא תרבות, אין ויוו14. הגנום RNA חד-גדילי של שלילי-סנס 11-kb של VSV מקודד mRNAs subgenomic חמש אחד המתורגמים לתוך החלבונים המרכיבים את מעטפת virion. עם זאת, מערכות גנטיות הפוכה VSV אפשרו ליצירת זנים שכפול-המוסמכת קידוד לוק או חלבונים פלורסנט, בנוסף חמש טבעי VSV ג'ין מוצרים15,16,17. כי לא משולבים חלבונים אלה כתב virion VSV, הם מספקים readout נוח של ביטוי גנים VSV המתרחשת הפוסט פוסט. באמצעות זנים VSV קידוד GFP או לוק, אנחנו בעבר הראו כי ביטוי גנים VSV היא הוגבלה בצורה קשה על כניסתם של תאים LD652, כי VSV titers לא להגדיל על ידי 72 שעות לאחר הפגיעה (מדד מחירי הבתים. של). לעומת זאת, coinfection של תאים LD652 עם VSV, את בתרבית של poxvirus, וירוס vaccinia (VACV), מוביל לוגריתמי מגביר התבטאות גנים VSV והן titers ובשלב זה הזמן. VACV עובר מוקדם ביטוי גנים, שכפול ה-DNA, ביטוי גנים מאוחר LD652 תא זיהומים, אבל בסופו של דבר שנכשל בשל virion לא שלם מורפוגנזה18מחזור שכפול VACV. הגנום גדולות של DNA ~ 192 kb של VACV מקודד > 200 חלבונים, שרבים מהם להציג מאפייני immunomodulatory לקדם שכפול ויראלי דרך הדיכוי של תגובות חיסוניות מארח19. לכן, שיערנו כי "חילוץ" שכפול VSV בתאים LD652 על ידי VACV coinfection היה ככל הנראה מתווכת על-ידי immunomodulators VACV זה עכבות תגובות ל' dispar בדרך כלל הגבלת VSV שכפול. כדי לתמוך בזה, הטיפול של תאים LD652 עם מארח ה-RNA פולימראז II המדכא ואקטינומיצין D גם מציל שכפול VSV בתאים LD652, המציין כי התגובות תלויי-תמלול מארח לחסום VSV שכפול פוסט-הפוסט13.

התצפיות הנ ל מציע כי הטבע מגבילות באופן טבעי של תאי LD652 לזיהום VSV עשוי לספק רקע נמוך יחסית בעת הקרנת עבור התנאים המשפרים את הכתב מקודד VSV אותות (כלומר, כאלה לעכב את המארח הגנות אנטי-ויראלי). כאן, אנו מספקים שיטות באמצעות קרינה פלואורסצנטית או מבוסס-לוק מבחני המסך עבור תנאי זה להקל על הגבלת VSV בתאים lepidopteran. ראשית, אנו מראים כמה מבחני אלה ניתן להשתמש כדי לזהות גורמים לשווק מקודד immunomodulatory לשבור את ההגבלה VSV במהלך ניסויים או coinfection, או דרך ביטוי חוץ רחמי של גורמים נגיפיים המועמד. כדוגמה, אנחנו מדגימים איך היינו אלה טכניקות ההקרנה כדי לזהות חלבונים A51R מקודד poxvirus כמשפחה חדשה של גורמים immunomodulatory להציל את שכפול VSV בהיעדרו של גורמים אחרים poxvirus13. שנית, אנחנו מדגימים כיצד ניתן להשתמש RNAi הקרנת מגבילות VSV-LD652 תא זיהומים ישירות לזהות מארח האיקריוטים הגורמים המעורבים הגבלת arbovirus13.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

1. כללי Lymantria dispar (LD652) תא והתרבות וירוס

  1. תא LD652 culturing יופיצ
    1. לתרבות dispar ל'-נגזר LD652 תאים, לשמור על טפט של תאים במדיום הגידול (טבלה של חומרים) מודגרות ב 27 ° C תחת אווירה רגילה. לשמור על התאים במנות רקמות-תרבות-טיפול 10 ס מ, המעבר את התאים בהגיעם 80% confluency.
    2. צלחת, מכך תאים חסיד LD652 מהצלחת מאת pipetting התקשורת שוב ושוב על גבי חד שכבתי (תאים אלה אינן דורשות trypsinization מכך) של לדלל את הדגימה בתקשורת צמיחה לדחיסות משוער של עונה 1 פרק 105 תאים/מ ל.... פיפטה 1 מ"ל של תרבות/טוב מדוללת של צלחת 24-. טוב. זרע מינימום של שלושה שכפל בארות/טיפול סוג עבור כל נקודת זמן (לכל היותר שמונה טיפולים/צלחת).
    3. מאפשרים לתאים להתפשר על מינימום של 1 h.
  2. הכנת וירוס vaccinia
    1. כדי להכין את המניות של VACV, להגביר את הנגיף הלה תאים20 או הקוף הירוק אפריקאי כליות תאים (BSC-1 או BSC-40 תאים)20,21,22.
      הערה: VACV זן Western Reserve (VACV-WR) עובד גם את מבחני המתוארים כאן.
    2. Titrate VACV זן באמצעות שלט וזמינותו BSC-1 או BSC-40 תאים20,22.
      הערה: כל הצביעו על ריבוי VACV של זיהום (MOI) המתוארים כאן עבור LD652 תא זיהומים מבוססים על titers המתקבל מבחני פלאק BSC-40.
  3. Vesicular stomatitis וירוס הכנה
    1. כדי להכין VSV מניות, להגביר את הוירוס BHK תאים23.
    2. Titrate VSV מאת פלאק assay BSC-40 או BHK תא monolayers13,23.
      הערה: כל VSV MOIs המתוארים כאן עבור LD652 תא זיהומים מבוססים על titers המתקבל מבחני פלאק BSC-40.

2. קרינה פלואורסצנטית מבוססי VSV הצלה Assay באמצעות ושיתוף הידבקות הדמיה לחיות תאים

  1. Seeding, זיהום של תאים LD652
    1. צלחת 40,000 LD652 תאים/טוב של חדר 8-. טוב.
    2. לשימוש מבוסס על-ידי קרינה פלואורסצנטית הדמיה לחיות תאים, זנים VSV קידוד חלבונים פלורסנט. הניסויים שהוצגו כאן להשתמש VSV-DsRed17, זן VSV רקומביננטי המבטאת חלבון DsRed חינם זה לא דבוקה כל חלבון VSV אחרים.
      הערה: VSV זיהום של תאים LD652 הוא לא cytopathic על ידי מדד מחירי הבתים של 96 ואינו, לפיכך, המוות של תאים גורם מבלבלים בעת הערכת VSV שכפול בתוך פרק הזמן.
    3. הכינו VSV-DsRed ואת VACV-FL-GFP בתקשורת ללא סרום (SFM; טבלה של חומרים) ב MOI 1, 25, בהתאמה.
      הערה: VACV-FL-GFP הוא זן VACV רקומביננטי שיבטא שילוב בין לוק ו- GFP24. שימוש MOI של 25 ומעלה עבור זנים VACV מבטיח כי כל התאים LD652 הם נגועים13. אם משתמש וירוס coinfecting שונים, למשרד הפנים יהיה חייב להיקבע מדעית על ידי המשתמש. כל טיפול דלקת יש להגדיר בבארות כפולים וכוללים הנגועים ואימץ טיפולים אשר מתווסף רק SFM התאים.
    4. דגירה התאים 0.2 מ של inoculum עבור 2 h ב-27 º c
    5. לשטוף את התאים עם 0.5 mL/טוב של צמיחה מדיה.
    6. דגירה התאים 25 μM של התא הכדאיות צבע (טבלה של חומרים) בתקשורת צמיחה למשך 45 דקות ב-27 º c
    7. וארוקן את המדיה ותרחץ הבארות 1 x 0.5 mL/היטב כדי להסיר צבע עודף.
    8. לשמור על התאים ב 0.3 mL/טוב של התקשורת צמיחה.
  2. חיה לכידת התמונה תא
    1. הפעלת מיקרוסקופ קונפוקלי 30 דקות מראש וטען צלחת הקאמרית 8-. טוב.
      הערה: LD652 תאים יכולים לדימות בטמפרטורת החדר הנע בין 20-25 ° C, אך תנאים אופטימליים, הטמפרטורה של החדר צריך להיות מותאם ל 27 מעלות צלזיוס.
    2. כוונן את הגדרות המתאימים עירור/פליטה עבור כל חלבון פלואורסצנטי סמן לדימות, וכן את הגדרות התמונה של ניגודיות שלב.
    3. התאם את עוצמת הלייזר לכל ערוץ.
      הערה: זה עשוי לדרוש הפעלת ניסוי הפיילוט כדי לקבוע את טווח עוצמות האות פלורסנט נצפתה לאורך זמן כדי לשמש הניסוי הסופי.
    4. באמצעות המטרה X 10, ללכוד תמונות חדות, זריחה של שלב של כל h 1 – 5 טוב בכל משך הזיהום עד נקודת הזמן הרצויים (למשל., מדד מחירי הבתים של 48-72).
      הערה: חשוב ללכוד את המבט של שדות מרובים כל היטב כדי לאמוד במדויק את שיעור הזיהום לאורך כל התרבות.
  3. ניתוח תמונות
    1. בתוכנת ניתוח תמונה לניתוח תמונה אוטומטי של הערוצים פלורסנט (למשל., 405 ננומטר, 488 ננומטר, 568 ננומטר).
    2. כדי לחשב את אחוז התאים שהודבקו, מחלקים את המספר הכולל של תאים פלורסצנט המציין זיהום VSV (למשל., תאים DsRed-חיובית עבור זיהומים VSV-DsRed) על ידי המספר הכולל של התאים קיימא המתויגים באמצעות תא הכדאיות צבע עבור כל שדה ראייה על-פני כל הטיפולים.

3. גנרל זיהום ויראלי פרוטוקול מבוסס-הפריה חוץ גופית VSV מבחני הצלה בתאים LD652

  1. הכנת inoculum
    1. 30 דקות לפני הדלקת, להפשיר את המניות VSV-לוק16 (חלבון VSV המתח הזה מבטא חינם גחלילית לוציפראז חלבון לא דבוקה כל חלבון VSV אחרים). אם assaying לחילוץ VSV-לוק במהלך VACV coinfection, גם להפשיר את הוירוס VACV-WR על קרח.
      הערה: וירוסים אחרים (מלבד VACV-WR) עשוי להציל VSV-לוק במהלך coinfection, אבל זה יהיה חייב להיקבע מדעית על ידי כל משתמש.
    2. להכין את inoculum על ידי דילול VSV-לוק ב נוכחות או היעדרות של VACV-WR לתוך SFM כזה MOI של 10 ו- 25, בהתאמה, מושגת בעת הוספת נפח inoculum הכולל של 0.2 מ"ל/טוב.
  2. זיהום של תאים
    1. תשאף מדיה LD652 בוגרת בזהירות כדי שלא להפריע למטופלים את טפט, לחסן 0.2 מ של וירוס/טוב. הפעם מוגדר מדד מחירי הבתים של 0. להוסיף SFM סטרילי בארות נוספות כדי לשמש "נגועה מעושה" טיפולים שליטה שלילי.
    2. דגירה התאים inoculum עבור 2 h ב-27 º c
    3. ב. מדד מחירי הבתים, של 2 להסיר את inoculum על ידי שאיפה להחליף 1 מ"ל/טוב LD652 הצמיחה מדיה.
    4. לאפשר את הזיהום להמשיך מדד מחירי הבתים של 24-72.

4. לוציפראז Assay

  1. הכנת תא lysates
    1. בזהירות וארוקן את תגובת שיקוע, להוסיף 1 מ"ל של תמיסת פוספט באגירה של Dulbecco (DPBS) / טוב.
    2. באמצעות הבוכנה של מזרק 1 מ"ל, לגרד את התאים לתוך DPBS.
    3. להעביר את התאים, צינור microcentrifuge ו צנטריפוגה ב 400 x g למשך 20 דקות ב 4 º C.
    4. . בינתיים, מכינים לדילול 1 x 5 x כתב פירוק מאגר (RLB) ב- H סטרילי2O.
    5. בעקבות צנטריפוגה, וארוקן את DPBS מבלי להפריע בגדר התא.
    6. Resuspend כל גלולה ב 150 µL 1 x RLB.
    7. ההקפאה-להפשיר הדגימות 1 x באמצעות דגירה של 5-מין במקפיא-80 ° C ואחריו הפשרה מהירה בתוך אמבט מים בטמפרטורת החדר. לאחסן את lysates ב-80 מעלות צלזיוס עד מוכן לנתח.
  2. לוציפראז assay
    1. להפשיר את lysates על הקרח.
    2. פיפטה 20 μL של lysate לבאר של microplate 96-ובכן מוצק שחור או לבן.
    3. להוסיף 100 μL של ריאגנט assay לוציפראז מכל קידוח.
    4. מיד למדוד את עוצמת האור באמצעות של luminometer (ההגדרות המתאימות luminometers ספציפי יהיה חייב להיקבע מדעית על ידי המשתמש).
  3. ניתוח assay לוציפראז
    1. לנרמל LU אותות הטיפול כדי קריאות LU המתקבל שליטה טיפולים (נציג תוצאות). אחרי לפחות שלושה ניסיונות עצמאית בוצעו, ניתן לנתח הממוצע ש-LU המתקבל בכל קבוצה טיפול/בקרה על ידי בדיקות סטטיסטיות המתאים.

5. Immunoblot

  1. השתמש lysates שחולצו עבור מבחני לוק עבור מרחביות-דף ו- immunoblotting הבאים, באמצעות ריאגנטים המתאימים ומכשור.

6. כייל של VSV מתרבויות תא LD652

  1. צלחת LD652 תאים על פי שלב 1.1.
  2. ויראלי להדביק את התאים לפי שלב 3.
  3. בנקודות הזמן הרצויים, לאסוף את supernatants לתוך צינורות microcentrifuge סטרילי.
  4. גלולה התאים באמצעות x 1000 g 10 דקות ב 4 ° C ולהעביר את supernatants צינורות חדשים.
  5. לאחסן את supernatants ב-80 מעלות צלזיוס או להמשיך טיטור מאת פלאק assay בתאי BSC-40.
    הערה: אם titrating VSV מתרבויות תא LD652 שהכילו VACV, רצוי להוסיף μg/mL 100 ציטוזין arabinoside (AraC) התקשורת תרבות BSC-40 בתוך מדד מחירי הבתים של 2, כדי למנוע שיורית חלקיקים VACV ויוצרים הפלאק BSC-40 monolayers13. AraC הוא מעכב נגיפי DNA פולימראז חוסם שכפול ה-DNA VACV25 , אך אינה משפיעה על VSV שכפול.

7. וריאציות של VSV מבוסס-הפריה חוץ גופית להציל את מבחני בתאים LD652: RNAi וניסויים תרביות תאים פלסמיד

  1. הכנה של dsRNA מציאה RNAi בתיווך נוקאאוט של נגיפי או מארחים תעתיקים
    1. עיצוב גנים ספציפיים תחל זנב בקצה 5' עם הרצף יזם T7 (TAATACGACTCACTATAGGG) כדי להתמקד גם הווירוס coinfecting (למשל, VACV) או ל' dispar תמלילים mRNA של ריבית. אלה תחל צריך לייצר מוצר ה-PCR של 400 – 600 bp נוקאאוט מציאה RNAi בתיווך יעיל. לראות את מארס. et al. 13 פריימר רצפים המשמש להלן תמונות ציפורים VACV או ל' dispar תעתיקים ידי RNAi בתיווך dsRNA בתאים LD652.
      הערה: ניתן לזהות תעתיקים של mRNA ל' dispar לאור dispar ל' transcriptome מסדי נתונים26,27,28.
    2. ליצור של ה-DNA תבנית ויה RT-PCR (cDNA סינתזה: מחזור 1 של 50 מעלות למשך 30 דקות; PCR: 40 מחזורי 94 ° C 15 s, 50 ° C ל 30 s, ו- 68 מעלות צלזיוס במשך 45 s כל).
    3. לטהר את מוצר ה-PCR באמצעות ערכת טיהור PCR.
    4. שימוש במוצר ה-PCR מטוהרים כתבנית, חוץ גופית בתוך לתמלל ולטהר dsRNA באמצעות במבחנה שעתוק טיהור וניקוי ערכת.
  2. תרביות תאים של dsRNA או פלסמיד DNA לתאים LD652
    1. זרע עונה 1 פרק 105 תאים/טוב של צלחת 24-ובכן ולתת את התאים להתפשר על פחות שעה.
    2. עבור כל טוב להיות transfected, לדלל μL 4 של תרביות תאים ריאגנט לתוך μL 100 של SFM. תקופת דגירה של עד 15 דקות בטמפרטורת החדר. זה וניתן לשנותם כדי להפוך את תערובת הבסיס עבור כל transfections שיש לבצע.
    3. לדלל עד μg 1 של dsRNA או הכולל פלסמיד DNA עם 100 μL של SFM במשך כל כדי להיות transfected. תקופת דגירה של עד 15 דקות בטמפרטורת החדר.
      הערה: בעבר מצאנו כי תרביות תאים של μg 1 של dsRNA/105 LD652 תאים מספיקה עבור > 80% נוקאאוט של או ויראלי או מארחים תעתיקים13, אבל dsRNA במינונים הדרושים עבור ששינה ניסיוני set-ups/תנאים יצטרך . להיות נחוש מדעית.
    4. משלבים תקנים ריאגנט של dsRNA/פלסמיד DNA דילולים עם יחס של 1:1 (למשל100 μL של dsRNA מדולל מעורבב עם 100 μL של ריאגנט תקנים מדולל) דגירה במשך 20 דקות בטמפרטורת החדר.
    5. בינתיים, לשטוף את הבארות 1 מ"ל/טוב של SFM, ולאחר מכן להוסיף 500 μL של SFM מכל קידוח.
    6. לאט לאט להוסיף תקנים ריאגנט dsRNA (או פלסמיד ה-DNA) תערובת dropwise כל טוב.
    7. דגירה הכימית תרביות תאים עם התאים עבור 5 שעות.
      1. עבור RNAi בניסויים המערבים את נוקאאוט של הפרוטוקולים מקודד על ידי וירוס coinfecting (למשל, VACV), להחליף הכימית תרביות תאים לאחר תקופת הדגירה 5-h תקנים עם וירוס inoculum המכיל VSV-לוק (עם או בלי VACV או וירוס coinfecting אחר) (שלב 3). לאחר מכן, להחליף את inoculum וירוס המכיל VSV-לוק עם צמיחה מלאה מדיה 2 מדד מחירי הבתים. ואז ניתן לבצע מבחני לוק (שלב 4) ב- lysates שחולצו בנקודות זמן שונות כדי לקבוע אם נוקאאוט של coinfecting וירוס תעתיקים מוביל לאובדן של חילוץ VSV-לוק.
      2. לניסויים RNAi מעורבים RNAi של הפרוטוקולים ל' dispar , החלף את התמהיל תרביות תאים צמיחה מלאה מדיה ולאפשר נוקאאוט ל ensue עבור 24 שעןת לפני זיהום עם VSV-לוק (שלב 4). מבחני לוק (שלב 4) ואז ניתן לבצע ב- lysates שחולצו בנקודות זמן שונות כדי לקבוע אם נוקאאוט של הפרוטוקולים ל' dispar מקדם VSV-לוק הצלה.
      3. לניסויים מעורבים transfections של וקטורים ביטוי פלסמיד מביע המועמד immunomodulators, להחליף הכימית תרביות תאים, לאפשר ביטוי חלבון 24 שעןת לפני הזיהום עם VSV-לוק (שלב 4). מבחני לוק (שלב 4) ואז ניתן לבצע ב- lysates שחולצו בנקודות זמן שונות כדי לקבוע אם הביטוי של חלבונים immunomodulatory מועמד מקדמת VSV-לוק הצלה.
        הערה: התנאים תרביות תאים המתוארים כאן שימוש μg/טוב 1 של תוצאות הדנ א פלסמיד תרביות תאים היעילות של 40%-60%13.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כדוגמה של יישומי הדמיה לחיות תאים כדי לפקח VSV הצלה על VACV coinfection, LD652 התאים היו מצופה בצלחת chambered 8-ובכן ואז הנגועים מעושה או נגוע VSV-DsRed (MOI = 1), נוכחות או היעדרות של VACV-FL-GFP (MOI = 25). מאחר VSV-DsRed מבטא DsRed כמו חלבון חינם לא מותך VSV מבניים חלבונים (איור 1 א'), שהוא מתגלה רק לאחר כניסה VSV והביטוי ג'ין יוזם. כל התאים היו אז המסומנת לצבוע הכדאיות תא העובר בחופשיות דרך קרום הפלזמה של תאים, בו הוא מומר לתוך מוצר ממברנה-impermeant, אשר מקדם את שימור של אותות פלואורסצנט תאים עם תוויות. תמונות נרכשו כל 5 שעות עד 65 מדד מחירי הבתים של, באמצעות כביש 405 ננומטר, 488 ננומטר, 568 ננומטר, ולבן אור מסננים ללכוד תא הכדאיות לצבוע, VACV-FL-GFP, VSV-DsRed, וערוצי שלב ניגודיות (PC), בהתאמה. בתנאים זיהום יחיד, תאים LD652 להגביל את שכפול VSV-DsRed; לכן, רק מספר קטן של תאים התערוכה אות DsRed. עם זאת, coinfection של VSV-DsRed עם VACV-FL-GFP תוצאות רוב התאים הצגת אותות DsRed עד סוף מסלול הזמן (איור 1B). תמונות שנלכדו בכל נקודה בזמן היו נתונים תוכנת ניתוח תמונה, שם 405 ננומטר ותמונות ערוץ 568 nm שימשו כדי לקבוע אוטומטית סה כ ומספרים תא DsRed-חיובית, בהתאמה. האחוז של תאים הצגת אות DsRed עבור כל טיפול הוא מחושב על ידי חלוקת אובייקטים (תאים) עם קליטה חיובית בערוץ 568-nm לפי מספר חפצים המזוהים ב- 405 ננומטר הערוץ עבור כל נקודת זמן, ואחריו כפל ב- 100% . כפי שמוצג באיור 1C, ~ 2% של תאים מדלקות יחיד VSV-DsRed היו DsRed-חיוביות על ידי מדד מחירי הבתים של 65. לעומת זאת, ~ 77% מהתאים VSV-DsRed + coinfections VACV-FL-GFP היו חיוביות DsRed בנקודת זמן זו. סרטים S1 ו- S2 להראות את ההתקדמות של זיהום VSV-DsRed במרוצת כל הזמן 65-h ב זיהום יחיד ומצבים coinfection, בהתאמה. חשוב לציין כי הביטוי GFP על-ידי VACV-FL-GFP הפך לזיהוי על ידי מדד מחירי הבתים של 10, לפני האות DsRed, המציינת כי מספיק ביטוי גנים VACV נדרשות לפני חילוץ VSV-DsRed (לא מוצג). באופן קולקטיבי, תוצאות אלה מצביעות בבירור על הצלה של שכפול VSV-DsRed על ידי VACV coinfection. אם וירוס coinfecting הצליח להציל VSV-DsRed, היינו מצפים באחוזים שווים של תאים DsRed-חיובית בין זיהום יחיד וטיפולים coinfection.

ניתן לכמת VSV שכפול בתאים LD652 לחילופין באמצעות מבחני מבוסס-הפריה חוץ גופית בעת שימוש זנים VSV-לוק (איור 2 א). לדוגמה, באיור 2B מציגה את התוצאות של וזמינותו לוק באמצעות lysates שהוכנו במהלך הזמן מספר 72 h תאים הנגועים מעושה או תאים נגועים VSV-לוק (MOI = 10) ב נוכחות או היעדרות של VACV-WR (MOI = 25). חילוץ חיובית של שכפול VSV-לוק מסומן על ידי גידול לוגריתמי ב- LU שרירותי מזוהה עם lysates מקריסטלים של תאים coinfected, לעומת lysates מדלקות VSV-לוק יחיד. תוצאה שלילית המצוין הזה assay כתוצאה מכישלון coinfection לשנות LU קריאות מאלו הנהוגות טיפולי יחיד של זיהום VSV-לוק. אם רצונך בכך, lysates מוכן יכול לשמש גם עבור immunoblotting, כדי לאשר גנים VSV משופרות בטיפולים coinfection. לדוגמה, באיור 2C מציג תוצאה אופיינית immunoblot לוק מקודד VSV, מטריקס חלבונים (ז) lysates הכנתי מוק-, VSV-לוק, ו VSV-לוק + VACV-WR טיפולים 72 מדד מחירי הבתים. Immunoblotting VACV I3L החלבונים שימש כסמן לזיהום VACV, immunoblotting עבור הסלולר אקטין שימש פקד הטעינה. שיפור ברור של חלבונים מקודד VSV לוק ו- M ב- coinfection lysates נוסף אשר VSV הצלה על ידי VACV. לבסוף, שכפול VSV פרודוקטיבי יכול להיות מאושרות על ידי איסוף supernatants של תרביות תאים אלה LD652 של titrating של וירוסים זיהומיות-BSC-40 monolayers (איור דו-ממדי). תוצאה זו ממחישה כי רק במהלך VACV coinfection עושה VSV שכפל באופן פרודוקטיבי.

ברגע coinfecting וירוס מוצג מסוגל להציל VSV שכפול בתאים LD652, הקרנת RNAi יכול לשמש כדי לזהות גורמים מקודד על ידי וירוס coinfecting שתורמים VSV הצלה. בניסוי זה, המסך עבור תנאי RNAi שמוביל הפנוטיפ "אובדן הצלה" במהלך VSV-לוק coinfection בווירוס להציל. אנחנו קודם לכן לזהות את החלבון VACV A51R כגורם VSV חילוץ באמצעות הקרנה RNAi של עשרות תעתיקים מקודד VACV13. לדוגמה, אנו יש recapitulated גרסה בקנה מידה קטנה יותר של המסך הזה (איור 3). RNAi בתיווך תקנים של במבחנה עיבד dsRNAs המכוונות תעתיקים מקודד על ידי וירוס coinfecting. בנתונים המוצגים כאן, תעתיקים ויראלי קידוד חלבונים VACV A50R, A51R ו A52R היו שמיועד RNAi נוקאאוט. כפקד שלילי עבור אובדן של הצלה, היו תאים גם transfected עם dsRNAs מיקוד תעתיקים קידוד ה-GFP. כפקד חיובי לאובדן של פנוטיפ הצלה, התאים היו transfected עם dsRNAs נגד תעתיקים קידוד לוק. טיפול זה מייצר איבוד אות לו חזקה במהלך coinfection ומסייע חוקרים לאשר כי הפרוטוקולים תרביות תאים/RNAi עובדים. לאחר 5 שעות של dsRNA תרביות תאים, התאים היו coinfected עם VSV-לוק (MOI = 10) ו- VACV-WR (MOI = 25). זיהומים נפרד עם רק VSV-לוק בוצעו גם כדי ליצור רקע רמת האות LU. Lysates היו אז שנקטפו מדד מחירי הבתים של 72, בשימוש וזמינותו לוק. השוואת רמת VSV הצלה מעבר dsRNA טיפולים לטיפול שליטה dsRNA GFP, התוצאות מצביעות על כי נוקאאוט של VACV A51R מייצרת לאובדן חזקה של פנוטיפ הצלה, ואילו נוקאאוט של A50R ושל A52R מייצרת תוצאה שלילית (אין אובדן חילוץ בהשוואה ל GFP dsRNA).

כחלופה RNAi ההקרנה כדי לזהות גורמים נגיפיים שתורמים VSV הצלה, overexpress גורמים נגיפיים המועמד בתאים LD652, ואז assay לחילוץ VSV-לוק. זה יכול להתבצע על ידי שיבוט גנים המועמד עניין לתוך ביטוי וקטורים כגון p16629 transfecting פלסמידים אלה לתוך תאים LD652 לפני האתגר VSV-לוק. לדוגמה, איור 4A מראה ניסוי הצלה אילו GFP מתויג דגל (FGFP) או A51R מתויג דגל וקטורים p166 (FA51R) היו transfected לתאים LD652 בריכוזים שונים, ואחריו זיהום VSV-לוק (מו = 10) 24 שעות מאוחר יותר. כפקד שלילי לחילוץ VSV, תרבויות נוספות היו transfected מעושה, לא קיבל פלסמיד DNA. Lysates היו שנאספו ממדד מחירי הבתים של 72 תרבויות, עברו מבחני לוק. טיפולים FA51R הפיק תוצאה חיובית של חילוץ VSV כפי שמתואר על ידי אותות LU משופרים transfected ואימץ טיפול במינון מרובים. לעומת זאת, טיפולים FGFP יצאו שליליות VSV הצלה בכל מינון נבדק. Immunoblotting של lysates של דמות 4A אישר ביטוי דומה של חלבונים FGFP ו- FA51R (איור 4B).

באמצעות הקרנה של RNAi של המועמד ל' dispar גורמים, אנחנו הראו כי ההגבלה על VSV בתאים LD652 מתווך על ידי גורמים הסלולר שונים השייכים מסלולים RNAi נגיפים (למשל, AGO2 ומקצץ-2), גרעיני גורם כפא B (NF-κB)-מסלול IMD קשורים (למשל, תבלינים), ומערכת אוביקוויטין-פרוטאוזום (למשל., polyubiquitin)13. כדוגמה, אנחנו שוב ושוב גרסה בקנה מידה קטנה יותר של הניסויים RNAi עם dsRNAs מיקוד תעתיקים ל' dispar משופרת VSV-לוק שכפול לאחר נוקאאוט (למשל., AGO2, לטעמים-2, תבלינים, polyubiquitin) או לא השפיע (AGO1 )13. לאחר 24 שעות של dsRNA תרביות תאים, התאים היו אתגר VSV-לוק במשך 72 h כדי לקבוע אם טיפולים RNAi משופרת LU אותות שליטה שלילי GFP dsRNA טיפול. טיפולים RNAi המשפרים את אותות LU מציינים כי הגורם מקודד על ידי בתמליל יישוב מגבילה VSV שכפול. כפקד חיובי עבור RNAi נוקאאוט, dsRNAs מיקוד תעתיקים קידוד לוק transfected היו גם בטיפולים מקבילים. בשל הרקע נמוך LU אותות זוהה בטיפולי שליטה dsRNA GFP, זו הייתה פשוטה יחסית לזהות גורמים מקודד מארח הגבלה באמצעות הקרנה RNAi מאחר נוקאאוט שלהם מייצר ~ 10-לעלייה 1,000-fold LU אותות ( איור 5). לכן, זה אפשרי לנצל הרקע נמוכה יחסית ברמת VSV גנים בתאים LD652 על המסך עבור המארח RNAi תנאים תמונות ציפורים להקל על הגבלת VSV.

Figure 1
איור 1: זיהוי של VSV הצלה על ידי וירוס coinfection של תאים LD652 באמצעות הדמיה לחיות תאים מבוסס על-ידי קרינה פלואורסצנטית. (א) בלוח זה הופעות תיאור סכמטי של הגנום VSV-DsRed המציין את מיקום הגן DsRed (ד ר). (B) אלה נציג 10 X מיקרוסקופיה קונפוקלית התמונות הן מדד מחירי הבתים של 60 שנתפסו. בערוץ 405 ננומטר מציין כתם על התאים קיימא, הערוץ 488 ננומטר מצביעה על זיהום VACV-FL-GFP, הערוץ nm 568 מצביעה על זיהום VSV-DsRed. תמונות חדות (PC) שלב גם מוצגים. גודל ברים = 100 מיקרומטר. (ג) לוח זה מציג את האחוז של תאים LD652 DsRed-חיובי במרוצת הזמן h 65 כל זיהום. האחוז (SD) כלומר התאים מציג אות DsRed עבור כל נקודת זמן מוצג. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: הערכה של חילוץ VSV בתאים LD652 באמצעות מבחני לוק- (א) בלוח זה הופעות תיאור סכמטי של הגנום VSV-לוק. (B) לוח זה מציג יחידות אור שרירותי (לוק) מבחני של lysates תאים הנגועים מעושה או תאים נגועים VSV-לוק, היעדרות או נוכחות של VACV-WR. (ג) לוח זה מראה על immunoblot של לוק, מ' VSV, VACV I3L, ונאסף החלבונים אקטין הסלולר ב lysates של פאנל A מדד מחירי הבתים של 72. (ד) לוח זה מציג VSV-לוק titers התרבות supernatants המתקבל פאנל B. הנתונים הכמותיים פאנלים B ו- D מייצגים את האמצעים (± SD) של ניסויים שבוצעו דולר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: זיהוי של מהווה גורם הצלה VSV מקודד לשווק דרך ההקרנה RNAi במהלך coinfection של תאים LD652. לוח זה מציג שינויים קיפול LU זוהה lysates של תאים 72 מדד מחירי הבתים של ועם VSV-לוק VACV-WR לאחר הטיפול RNAi המצוין, ביחס LU זוהה lysates של תאים נגועים ביחידים VSV-לוק. הנתונים לייצג את האמצעים (± SD) בין ניסויים שבוצעו דולר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: חילוץ VSV מאת ביטוי של immunomodulator ויראליים בתאים LD652. מראה (A) בלוח זה לוק וזמינותו של מדד מחירי הבתים של VSV לוק-תאים הנגועים 72 transfected מעושה (מעושה) או transfected עם פלסמידים ביטוי p166 או FGFP או FA51R. LU אותות מן הטיפולים היו מנורמל לאותות זוהה בטיפולים שליטה transfected מעושה. הנתונים לייצג את האמצעים (± SD) בין ניסויים שבוצעו דולר. (B) לוח זה מציג lysates פאנל A, immunoblotted עם דגל של אקטין נוגדנים. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: זיהוי של המארח גורמים הגבלת השכפול VSV בתאים LD652 דרך ההקרנה RNAi. לוח זה מציג שהקיפול לשנות ב- LU אותות בטיפולים RNAi המצוין יחסית ה-GFP dsRNA שליטה טיפולים 72 מדד מחירי הבתים של VSV-לוק. הנתונים לייצג את האמצעים (± SD) בין ניסויים שבוצעו דולר. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

S1 הסרט: נציג 405 ננומטר (תא הכדאיות צבען) ותמונות 568 nm (DsRed) ערוץ שנתפסו במהלך הזמן מספר 65 h (כל מסגרת = מרווח 5 שעות) לאחר ההדבקה VSV-DsRed של תאים LD652. אנא לחץ כאן כדי להוריד את הקובץ.

סרט S2: נציג 405 ננומטר (תא הכדאיות צבען) ותמונות 568 nm (DsRed) ערוץ שנתפסו במהלך הזמן מספר 65 h (כל מסגרת = מרווח 5 שעות) לאחר coinfection של תאים LD652 עם VSV-DsRed, VACV-FL-GFP. אנא לחץ כאן כדי להוריד את הקובץ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

or Start trial to access full content. Learn more about your institution’s access to JoVE content here

כאן תארנו מבחני פשוטה פלורסצנטיות הפריה חוץ גופית מבוססות על המסך עבור תנאי זה להציל את שכפול VSV בתרבויות תא lepidopteran מגבילים. זיהום שנכשל של VSV בתאים lepidopteran יוצר יחס אות לרעש מעולה כאשר assaying על ביטוי גנים VSV. למשל, האותות LU זוהה lysates מדלקות VSV-לוק יחיד היו ~ 1,000-fold גבוה בהרבה lysates נגועה מעושה, אך אותות אלה שונה רק כ כפולה על קורס זמן 72-h. לעומת זאת, coinfection של VSV-לוק עם VACV משופרת LU אותות ~ נגמר 300-fold יחיד VSV-לוק זיהומים על ידי מדד מחירי הבתים של 72. לפיכך, מבחני הצלה VSV להציג טווח דינמי מעולה, המקיף במספר סדרי גודל.

אחד הצעדים קריטי בהגדרת מבחני אלה כרוכה ההחלטה assay לחילוץ VSV באמצעות קרינה פלואורסצנטית או הפריה חוץ גופית-גישות. אנחנו הראו דוגמאות איך VSV מקודד DsRed אותות יכול להיות לבדיקה באופן כמותי באמצעות טכניקות הדמיה לחיות תאים וחבילות תוכנה המאפשרים כימות אוטומטיות של תאים DsRed-חיובית בתוך העדר או נוכחות מבצע הצלה coinfection. אם לחוקרים יש גישה ליכולות הדמיה לחיות תאים, מבחני האלה זולים להגדיר ולאפשר להם ללכוד מגוון רחב של נקודות זמן עשויים לסייע זיהוי הבדלים VSV שכפול קינטיקה שהן נצפות רק בזמן צרה חלונות. לעומת זאת, גישות הפריה חוץ גופית בעיקרו של דבר מובילים מבחני הדורשות הכנת תא lysates בנקודות זמן מוגדרים מראש, הכנה lysate יכול להימשך זמן רב. מצד שני, מבחני מבוסס-הפריה חוץ גופית אינם דורשים ציוד מתוחכם מיקרוסקופ – רק צלחת קורא היכול לקרוא אותות הפריה חוץ גופית. יתר על כן, מבחני מבוסס-הפריה חוץ גופית יש טווח דינמי גדול יותר מאשר מבחני מבוסס מיקרוסקופיה שמחשבות את אחוז תאים נגועים. לדוגמה, במבחני מיקרוסקופ, תאים DsRed-חיוביות (המציין זיהום VSV-DsRed) יכולים רק לנוע בין 0 – 100% של תאים שנותחה במבט של השדה. לעומת זאת, לו אותות בין VSV יחיד-לוק coinfection (או תנאים אחרים חילוץ) יכולים לנוע על פני במספר סדרי גודל.

יתרון מפתח של שימוש במערכת תא VSV -ל' dispar המובאים כאן עבור יונקים immunomodulators מקודד וירוס מסך הוא כי זה מטבעו בוחר לצורך זיהוי גורמים נגיפיים לדכא את מה הם נוטים להיות שמור ועתיקה תגובות אנטי ויראליים מהשרידים התגובה אינטרפרון חוליות ספציפיים. אכן, תצפיות ראשוניות מציע כי חלבונים A51R לעכב שנשמרת נגיפים אוביקוויטין פרוטאוזום-הקשורים הסלולר תגובות (ראה מארס. et al. 13 ו נתונים שלא פורסמו). גילוי VACV A51R הצלה של VSV היה הדוגמה הראשונה של וירוס heterologous הצלה על ידי וירוס חוליות המארח הגעה13, סביר להניח כי אלו מערכות הקרנה תחשוף immunomodulators מקודד וירוס של חוליות נוספות . חשוב לציין כי המפתח לשימוש VSV הצלה הבדיקה עבור תנאי זה לעכב את המארח חסינות היא כי השכפול VSV חייב להיות מוגבל בכבדות (או שנכשל) בסוג התא זה שכפול VSV נבדקת ב. לכן, סוגי תאים בתרבית ביותר של כנראה תהיה מתאימים עבור סוגים אלה של מבחני, בהתחשב בכך VSV משכפל טוב בתאי יונקים. זו הסיבה מדוע תאים ל' dispar שימשו כאן בתור סוג התא המארח מגבילות באופן טבעי עבור VSV.

מחקר מוקדמת בתאים דרוזופילה הראה כי מדכאי ויראלי של נגיפים RNAi תגובות יכול להיות מזוהה על-ידי cotransfection של הביטוי פלסמידים קידוד המועמד RNAi מדכאי המשכפלת את הצאן הבית וירוס גנומית RNA זה מקודד ה-GFP במקום B2, שלה משתיק קול טבעית RNAi30. השכפול של RNA הגנומי הצאן הבית וייצור של GFP היה תלוי הדיכוי של RNAi על ידי הגורם המועמד cotransfected ומצוינות, לפיכך, להציל את הביטוי GFP RNAi דיכוי30. עבודתנו שלא פורסמו מציין כי ביטוי של מעכבי RNAi מקודד וירוס גם מחלץ VSV-לוק ביטוי גנים בתאים ל' dispar , טוען כי מערכת זו יכול לשמש גם כדי לזהות מדכאי RNAi תגובות בהקשר של זיהום על ידי. חיידק ויראלי של פיד ה בונה בניגוד replicon. אכן, הממצא RNAi - IMD-, מסלולים אוביקוויטין פרוטאוזום-הקשורות לתרום ההגבלה של שכפול VSV ל' dispar תאים13 מצביע על כי נגיפי היריבים של כמה מסלולים אנטי-ויראלי עשוי להיות מזוהה על ידי VSV להציל את מבחני המוצג כאן.

מגבלה פוטנציאלי השיטות ההקרנה לגבי הזיהוי של חלבונים ויראליים המארח הוא רצף הגנום ל' dispar עדיין לא זמין. עם זאת, ישנם זמין לציבור ל' dispar transcriptomes שיכול לשמש כדי לזהות מטרות מארח המועמד RNAi תמונות ציפורים26,27,28. בנוסף, אנחנו הראו בעבר כי VSV מוגבלת בשורות תאים שמקורם אחרים lepidopterans13 שיש עכשיו גנום זמין לציבור (למשל, סקסטה Manduca)31. לכן, שורות תאים שמקורם אחרים lepidopterans עם קובצי רצף הגנום להחליף רקמות התאים ל' dispar המתוארים כאן את הפרוטוקול.

בהתחשב בצמיחה כלכלית, בריאות הציבור האיום של arboviruses32, מבחני המיון המובאת כאן עשוי לספק אסטרטגיות מקוריות כדי לזהות תכונות חדשות של אינטראקציות arbovirus-מארח שיש ערך בעיצוב של נגיפים חדשים הרפוי. יתר על כן, בגלל ההבנה שלנו מוגבלת יחסית של מנגנונים lepidopteran הגבלת השכפול וירוס רנ א, הכלים המוצגים כאן מספקים הזדמנויות חדשות כדי לחקור את מנגנוני ההגנה של המחשב המארח מקודד על ידי זה חשוב מבחינה כלכלית סדר של חרקים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

המחברים אין לחשוף.

Acknowledgments

ה2 נתמכה על ידי מימון מתוכנית חוקרים מאוניברסיטת טקסס הדרומית-מערבית למרכז הרפואי של מחונן. המחברים תודה מייקל Whitt (המרכז למדעי הבריאות אוניברסיטת טנסי) שון ווילן (הספר לרפואה של הרווארד) למתן VSV-DsRed ו- VSV-לוק. המחברים מודים גם גארי Luker (בית הספר לרפואה באוניברסיטת מישיגן) על מתנה נחמדה של המתח VACV-FL-GFP.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
זיהומים arbovirus כמו כלים ההקרנה לצורך זיהוי גורמים אנטי ויראלי Immunomodulators ומנחה
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter