Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Immunology and Infection

Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로

doi: 10.3791/58244 Published: September 13, 2018

Summary

여기, 선물이 arbovirus 복제 및 arbovirus 복제를 제한 하는 2) 진 핵 호스트 요인 1) 바이러스 인코딩된 immunomodulators 식별 프로토콜. 이러한 형광 및 발광 기반 방법을 빠르게 낮은 신호 대 잡음 비율 단순한 분석에 arbovirus 복제의 양적 정보를 연구 수 있습니다.

Abstract

RNA 간섭-및 편집-기반 플랫폼을 심사 하는 게놈 바이러스 복제를 제한 하는 호스트 셀 요소를 식별 하기 위해 널리 사용 되어 왔습니다. 그러나, 이러한 스크린 자연스럽 게 연구 바이러스 성 병원 체를 허용 하는 셀에 일반적으로 지휘 된다. 따라서, 제어 조건에 있는 바이러스의 강력한 복제 이러한 스크린의 동적 범위를 제한할 수 있습니다. 또한,이 화면 수 있습니다 수 없습니다 쉽게 식별할 세포 방어 경로 바이러스가 호스트에 잘 적응 하 고 대항 항 바이러스 방어의 경우 바이러스 복제를 제한 하는. 이 문서에서는, 우리는 vesicular 구내 염 바이러스 (VSV) arboviruses에 의해 자연스럽 게 조산 감염에 바이러스-호스트 상호 작용 센터 화면 사용을 탐험에 대 한 새로운 패러다임을 설명 합니다. Dipteran 곤충과 포유류 호스트의 넓은 범위에서 복제 VSV의 능력에도 불구 하 고 VSV는 집시 나 방 (Lymantria dispar)와 같은 lepidopteran 곤충에서 파생 된 세포 라인의 다양 한 후 항목, 조산 감염을 겪 습. 그러나, 이러한 조산 VSV 감염 수 수 "구출" 호스트 세포 항 바이러스 방어 손상 된 경우. 우리가 어떻게 VSV 긴장 인코딩 편리한 리포터 유전자와 제한적인 L. dispar 설명 셀 라인 호스트 요소 arbovirus 제한에 관련 된 식별을 설정 화면에 쌍이 될 수 있습니다. 또한, 우리는 또한 coinfection 또는 포유류 바이러스에 의해 비롯 소성 표현을 통해 VSV 복제 구조 virally 인코딩된 요소의 식별 이러한 검사 도구 유틸리티를 보여줍니다. VSV 구조, 모니터를 단순한 발광 및 형광 기반 분석의 사용 활성화를 촉진 하는 조건에 대 한 심사 때 L. dispar 셀에 VSV 복제의 자연 제한 높은 신호 대 잡음 비율을 제공 VSV 복제의 변화입니다. 이러한 방법론은 호스트 항 바이러스 응답 바이러스 면역 회피 요인 사이 상호 작용을 이해 하는 데 중요 합니다.

Introduction

생산적으로 특정 호스트에 복제 하는 바이러스의 기능 바이러스 항목 및 복제1을 지 원하는 호스트 셀 요소의 가용성 부분에 적용 됩니다. 바이러스-호스트 범위 또한 카운터 세포 항 바이러스 방어 바이러스 성 복제2,3방해 그렇지 않으면 것을 바이러스의 용량에 의해 지시 될 수 있습니다. 그것은 궁극적으로 바이러스 특정 호스트에서의 라이프 사이클을 완료할 수 여부를 결정 하는 이러한 복잡 한 바이러스-호스트 상호 작용의 결과. 바이러스 성 복제 발생 하는 경우 호스트에 대 한 잠재적으로 병원 성 결과 감안할 때, 그것은 실패와 생산 사이의 균형 팁 수 있습니다 주요 바이러스-호스트 상호 작용에 대 한 우리의 이해를 심화 하기 위해 실험적인 전략을 개발 하는 중요 한 감염입니다. 바이러스-호스트 상호 작용의 분자 기능 elucidating 신규 및 대체 항 바이러스 치료 전략의 개발에 도움이 될 것입니다.

RNA 간섭 (RNAi)4,의 도래와 함께5 및 게놈 편집 도구 (., CRISPR-Cas9, 아연 손가락 nucleases TALENs)6,7, 실험적으로 변경 가능한 되고있다는 게놈 넓은에 세포질 요인의 식을 확장 하 고 바이러스 복제에 이러한 변경의 영향. 실제로, 수많은 RNAi 및 편집-게놈 스크린 실시 되었습니다 바이러스-호스트 상호 작용8,,910, 의 새로운 측면을 발표 했다 무척 추 및 척추 호스트 셀 유형 11 , 12. 일반적으로 바이러스 기자, 반딧불 luciferase (루크) 또는 형광 성 단백질 등을 인코딩을 사용 하는이 화면 (., GFP, DsRed), 양적 평가 판독으로 바이러스 성 유전자 발현의 편리한 수단을 제공 하는 바이러스 성 복제9,12에 대 한. 이 전략 중 홍보 또는 각각 증가 또는 감소에 의해 입증으로 바이러스 성 복제를 반대, 바이러스 성 기자 신호9,12호스트 요소를 식별 하는 연구를 수 있습니다. 그러나, 대부분의 경우에서 이러한 화면 실시 되어 있는 그들은 공부 되 고 있다 호스트 셀 형식에 잘 적응 하는 바이러스를 사용 하 여. 이 전략이 될 수 있지만 바이러스 성 병원 체 및 그들의 자연적인 호스트 간의 coevolutionary 관계를 이해 하기 위한 중요 한, 그것은 잠복 호스트 항 바이러스 요인에 그들의 사용에 관한 근본적인 문제를 제기지 않습니다. 이러한 경우 바이러스 기자에 있는 증진 최저는 되 찾고, RNAi 나 세포 요소는 일반적으로 바이러스 성 복제를 방해의 비활성화 신호. 첫째, 이면 바이러스가 이미 엄격 하 게 제어 조건 하에서 시험 되 고 호스트 셀에 복제할 수 화면 (, 배경 및 향상 된 바이러스 성 기자 신호 사이 구별 하는 기능)의 동적 범위 제한 될 수 있습니다. 둘째,이 문제는 바이러스는 주인 세포에 잘 적응 하 고 화면에 타겟이 되고있다 호스트 방어 통로 대항에서 효과적인 상황에 의해 더 합성 된다.

전통적인 바이러스-호스트 상호 작용 방법 심사에 관한 위의 우려로 인해 우리는 lepidopteran 곤충 세포에서 자연적으로 유산 arbovirus 감염을 악용 하는 바이러스-호스트 상호 작용을 공부에 대 한 새로운 패러다임을 개발 했다. 이 전략은 잘 공부 인간의 arbovirus, VSV, 집시 나 방 (L. dispar)13에서 파생 된 셀에 조산 감염을 겪 습 관측에서 파생 한다. VSV는 자연스럽 게 포유류 호스트, dipteran 곤충 (, 모래 파리)에 의해 전송 무척추동물의 넓은 범위를 감염 하기 위하여 실험적으로 표시 되었습니다 및 척추 호스트 모두에 셀 문화 그리고 vivo에서14. VSV의 11 kb 부정 감지 단일 가닥 RNA 게놈 각각 엔벌로프된 virion 구성 하는 단백질으로 번역 하는 5 개의 subgenomic mRNAs를 인코딩합니다. 그러나, VSV 역 유전자 시스템 인코딩 루크 또는 5 자연 VSV 유전자 제품15,,1617이외에 형광 단백질, 복제 유능한 긴장의 창조에 대 한 수 있다. 이 기자 단백질은 VSV virion에 통합 되지, 때문에 그들은 후 항목을 발생 하는 VSV 유전자 발현에 대 한 편리한 판독을 제공 합니다. VSV 긴장 GFP 또는 루크 인코딩을 사용 하 여, 우리는 이전 표시 VSV 유전자 발현은 LD652 셀의 항목에 따라 엄격 하 게 제한 VSV titers 72 시간 후 감염 (hpi)에 의해 증가 하지 않습니다. 반면, VSV와 포유류 poxvirus, vaccinia 바이러스 (VACV), LD652 세포의 coinfection VSV 유전자 발현에 titers 로그 증가이 시간 포인트 리드. VACV는 이른 유전자 발현, DNA 복제, 및 LD652 세포 감염에서 늦은 유전자 발현을 겪 습 하지만 VACV 복제 주기 때문에 불완전 한 virion morphogenesis18궁극적으로 실패. VACV의 큰 ~ 192 kb DNA 게놈 많은 호스트 면역 응답19의 억제를 통해 바이러스 성 복제를 촉진 immunomodulatory 속성을 표시 하는 > 200 단백질을 인코딩합니다. 따라서, 우리는 VSV 복제 VACV coinfection LD652 셀에서의 "구조"는 가능성이 VACV immunomodulators L. dispar 응답 VSV 복제를 제한 하는 일반적으로 저해 하 여 중재 하는 가설. 이 지원 호스트 RNA 중 합 효소 II 억제제 악티노마이신 D와 LD652 세포의 치료 또한 VSV 복제 LD652 세포에서 전사 종속 호스트 응답 VSV 복제 후 항목13블록 나타내는 구출.

위의 관찰 VSV 인코딩 기자 신호 (, 호스트를 억제 하는 그를 강화 하는 조건에 대 한 심사 때 자연스럽 게 제한적인 성격의 VSV 감염 LD652 셀 상대적으로 낮은 배경을 제공할 수 있습니다 제안 항 바이러스 방어)입니다. 여기, 우리는 조건 완화 VSV 제한 lepidopteran 세포에서 형광 또는 루크 기반 분석 화면을 사용 하기 위한 방법을 제공 합니다. 첫째, 우리는 VSV 제한 중 coinfection 실험 중 또는 후보 바이러스 성 요인의 소성 표현을 통해 휴식 virally 인코딩된 immunomodulatory 요소를 식별 하기 위해 이러한 분석 실험을 사용 하는 방법을 보여줍니다. 예를 들어, 우리는 어떻게 우리가 다른 poxvirus 요인13의 부재에 VSV 복제 구조 immunomodulatory 요인의 새로운 가족으로 poxvirus 인코딩된 A51R 단백질을 식별 하기 위해 이러한 심사 기법을 사용을 보여 줍니다. 둘째, 우리는 RNAi 제한적인 VSV LD652 세포 감염에서 심사를 사용 하 여 직접 arbovirus 제한13에 관련 된 진 핵 호스트 요소를 식별 하는 방법을 보여 줍니다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. 일반적인 Lymantria dispar (LD652) 세포와 바이러스 문화

  1. LD652 셀 배양 및 도금
    1. 문화 나 dispar-파생된 LD652 세포는 정상적인 분위기에서 27 ° C에서 incubated 성장 매체 (자료 테이블)에 있는 세포의 단층을 유지. 조직 문화 취급 요리 10 cm 세포를 유지 하 고 80 %confluency 도달 시 세포를 통과.
    2. 하려면 접시, 접시에서 부착 LD652 셀 (이 셀이 꺼내 려 trypsinization를 필요로 하지 않는) 단층에 반복적으로 미디어를 pipetting으로 꺼내 1 x 105 셀/mL의 대략 조밀도에 성장 매체에서 샘플을 희석. 1 mL의 희석 문화/24-잘 접시의 플라스틱 각 시간 포인트 (최대 8 개의 치료/접시)에 대 한 3 개의 복제 웰 스/치료 형식의 최소 씨앗
    3. 1 h의 최소를 셀 수 있습니다.
  2. Vaccinia 바이러스 준비
    1. VACV의 준비, 헬러에 바이러스를 증폭 세포20 또는 아프리카 녹색 원숭이 신장 세포 (BSC-1 또는 BSC 40 셀)20,,2122.
      참고: VACV 스트레인 서쪽 예비 (VACV-WR) 여기에서 설명 하는 분석 실험에서 잘 작동 합니다.
    2. VACV 긴장을 통해 플 라크 분석 결과 BSC-1 또는 BSC 40 셀20,22에 적정
      참고: 모든 VACV 복합성 감염 (MOI)의 세포 감염 titers BSC 40 패 분석 실험에서 얻은 기반으로 하는 LD652에 대 한 여기에 설명 된 표시.
  3. Vesicular 구내 염 바이러스 준비
    1. VSV 주식 준비, BHK 세포23바이러스를 증폭.
    2. BSC-40 또는 BHK 세포 monolayers13,23패 분석 실험에 의해 VSV를 적정.
      참고: 모든 VSV MOIs 여기 셀 감염 titers BSC 40 패 분석 실험에서 얻은 기반으로 하는 LD652에 대 한 설명.

2. 형광 기반 VSV 구조 분석 결과 공동 감염 및 라이브 셀 이미징 사용 하 여

  1. 시드 및 LD652 세포의 감염
    1. 8 잘 챔버의 40000 LD652 셀/잘 플레이트.
    2. 형광 기반 라이브 셀 이미징, VSV 긴장 형광 단백질을 인코딩을 사용 합니다. 여기에 제시 된 실험 VSV DsRed17, 다른 VSV 단백질에 융합 하지 무료 DsRed 단백질을 표현 하는 재조합 VSV 긴장을 사용 합니다.
      참고: LD652 셀의 VSV 감염 96 hpi에 의해 cytopathic 이며, 따라서, 세포 죽음 아니다 혼동 요인이 시간 내 VSV 복제를 평가할 때.
    3. 혈 청 무료 미디어 (SFM; VSV-DsRed 및 VACV-플로리다-GFP를 준비 자료의 테이블) 1 25 년의 나에 각각.
      참고: VACV-플로리다-GFP는 루크와 GFP24사이의 융합을 표현 하는 재조합 VACV 긴장. VACV 변종에 대 한 25 또는 더 큰 나를 사용 하 여 모든 LD652 세포 감염된13는 보장 합니다. 다른 coinfecting 바이러스를 사용 하는 경우에 나 사용자에 의해 실험적으로 결정 해야 합니다. 각 감염 치료 중복 우물에서 설정 해야 하 고 포함 모의 감염 치료만 SFM 셀에 추가 됩니다.
    4. 27 ° c.에서 2 h inoculum 0.2 mL에 셀을 품 어
    5. 씻어 0.5 mL/성장 매체의 셀.
    6. 셀 셀 생존 염료 (자료 테이블)의 25 μ M에 27 ° c.에서 45 분에 대 한 성장 매체에 품 어
    7. 미디어를 발음 하 고 세척 우물 1 x 0.5 mL/과잉 염료를 제거 하는 잘.
    8. 셀 0.3 mL/성장 매체의 잘 유지 합니다.
  2. 라이브 셀 이미지 캡처
    1. Confocal 현미경 30 분 사전에 켜고 8 잘 챔버 접시를 로드.
      참고: LD652 셀 20-25 ° C에서 배열 하는 실내 온도에 몇 군데 있습니다 하지만 최적의 조건, 방의 온도 27 ° c.에 조정 되어야 한다
    2. 단계 대조 이미지 설정 뿐 아니라 이미지 수를 각 형광 마커 단백질에 대 한 적절 한 여기/방출 설정을 설정 합니다.
    3. 각 채널에 대 한 레이저 강도 조정 합니다.
      참고:이 마지막 실험에 사용 될 시간 내내 관찰 하는 형광 신호 강렬의 범위를 결정 하는 시범 실험을 실행 해야 합니다.
    4. 원하는 시간 까지는 감염의 기간에 대 한 각 잘 각 1-5 h의 위상 대비 및 형광 이미지를 캡처 10 X 목표를 사용 하 여 (., 48-72 hpi).
      참고: 각 잘 정확 하 게 문화를 통해 감염 속도 추정 하에 여러 필드의 보기를 캡처하는 데 중요 하다.
  3. 이미지 분석
    1. 이미지 분석 소프트웨어를 사용 하 여 적절 한 형광 채널의 자동된 이미지 분석 (., 405 nm, 488 nm, 568 nm).
    2. 감염 된 세포의 백분율을 계산 하려면 분할 VSV 감염을 나타내는 형광 세포의 총 수 (., VSV DsRed 감염에 대 한 DsRed-긍정적인 세포) 세포 생존 염료에 의해 표시 된 가능한 세포의 총 수로 모든 치료에서 각 필드의 보기

3. 일반 바이러스 감염 프로토콜 LD652 세포에서 발광 기반 VSV 구조 분석에 대 한

  1. Inoculum의 준비
    1. 이전에, 감염 30 분 녹여 VSV 루크16 (재조합 VSV 긴장 무료 반딧불 luciferase 단백질 하지 다른 VSV 단백질을 융합 하는 표현)의 주식. 만약 VSV 뤽 구조에 대 한 VACV coinfection 동안 시 금, 또한 VACV WR 바이러스 얼음에 녹여.
      참고: (VACV-WR) 외 다른 바이러스 coinfection, 동안 VSV 루크를 구출 수 있습니다 하지만이 각 사용자에 의해 실험적으로 결정 될 것 이다.
    2. 10 그리고 25의 나 각각 0.2 mL의 총 inoculum 볼륨을 추가할 때 유발은 SFM으로 VACV WR의 유무에 VSV 루크를 diluting 하 여는 inoculum을 준비/잘.
  2. 세포의 감염
    1. 성숙한 LD652 미디어는 단층을 방해 하지 않으려면 신중 하 게 발음 하 고 바이러스/잘 0.2 mL를 접종. 이 시간 0 hpi로 정의 됩니다. "모의 감염" 부정적인 제어 트리 트 먼 트로 추가 우물을 메 마른 SFM을 추가 합니다.
    2. 27 ° c.에서 2 h inoculum 셀을 품 어
    3. 2 hpi에서 포부에 의해 inoculum을 제거 1 mL를 바꿉니다/LD652 성장 매체를 잘.
    4. 24-72 hpi 진행에 감염을 수 있습니다.

4. luciferase 분석 결과

  1. 세포 lysates의 준비
    1. 신중 하 게는 상쾌한 발음 및 Dulbecco의 인산 염 버퍼 식 염 수 (DPBS)의 1 mL을 추가/잘.
    2. 1 mL 주사기의 플런저를 사용 하 여 DPBS로 셀을 다쳤어요.
    3. Microcentrifuge 튜브, 및 4 ° c.에 20 분에 대 한 400 x g 에서 원심 분리기는 셀 전송
    4. 한편, 1 x 희석 기자 세포의 용 해 버퍼 (RLB) 살 균 H2o. x 5의 준비
    5. 원심 분리, 다음 셀 펠 렛을 방해 하지 않고는 DPBS 발음.
    6. 각 펠 릿 1의 150 µ L에서 resuspend x RLB.
    7. 샘플 1-80 ° C 냉장고 실내 온도 물 욕조에 급속 해 동 뒤에 5 분 외피를 사용 하 여 x를 동결-해 동. -80 ° C에서 lysates 분석할 준비가 될 때까지 저장 합니다.
  2. Luciferase 분석 결과
    1. 얼음에 lysates 녹여
    2. 20 μ의 단색 검정 또는 흰색 96-잘 미 판으로 lysate의 플라스틱
    3. 각 잘 100 μ luciferase 분석 실험 시 약의 추가.
    4. 즉시 사용 하는 루미 노 빛의 강도 측정 (특정 luminometers에 대 한 적절 한 설정을 해야 합니다 사용자에 의해 실험적으로 결정).
  3. Luciferase 분석 결과 분석
    1. 루 루 수치 제어 트리 트 먼 트 (대표 결과)에서 얻은 각 치료에 대 한 신호를 정상화. 적어도 3 개의 독립적인 실험 수행한 후 적절 한 통계적 테스트에 의해 루 각 치료/제어 그룹에서 얻은 의미를 분석할 수 있습니다.

5입니다. Immunoblot

  1. SDS 페이지 및 적절 한 시 약 및 계측을 사용 하 여 후속 immunoblotting 뤽 분석 실험에 대 한 추출 lysates를 사용 합니다.

6. titer VSV LD652 세포 배양에서의

  1. 1.1 단계에 따라 플레이트 LD652 셀입니다.
  2. 바이러스 성 감염 3 단계에 따라 셀.
  3. 원하는 시간 지점에서 살 균 microcentrifuge 튜브는 supernatants를 수집 합니다.
  4. 4 ° C에서 10 분 1000 x g 를 사용 하 여 셀을 작은 고 새로운 튜브는 supernatants 전송.
  5. 저장-80 ° C에서 supernatants 또는 BSC 40 세포 분석 결과 플 라크에 의해 적정 진행.
    참고: 경우 넣는 VSV VACV를 포함 하는 LD652 세포 배양에서 그것은 BSC-40 monolayers13플 라크 형성에서 잔여 VACV 입자를 방지 하기 위해 2 hpi 내 BSC 40 문화 미디어를 100 μ g/mL 시 토 신 arabinoside (아크)를 추가 하는 것이 좋습니다. 아크는 바이러스 성 DNA 중 합 효소 억제제 VACV DNA 복제25 차단 하지만 VSV 복제에는 영향을 미치지 않습니다.

7. 발광 기반 VSV의 변형 구조 LD652 세포 분석 실험: RNAi 및 플라스 미드 Transfection 실험

  1. DsRNA 바이러스의 최저 RNAi 중재에 대 한 준비 또는 호스트 사본
    1. 디자인 유전자 특정 뇌관 꼬리 끝에 5' T7 발기인 순서 (TAATACGACTCACTATAGGG) 중 하나를 대상으로 coinfecting 바이러스 (예를들면, VACV) 또는 관심의 L. dispar mRNA 사본. 이 뇌관은 효과적인 RNAi 중재 최저에 대 한 400-600 bp의 PCR 제품을 생산 한다. 사기 그 외 참조 13 뇌관 시퀀스 사용 아래 최저 VACV 또는 L. dispar LD652 세포에서 RNAi dsRNA 중재 녹취 록.
      참고: L. dispar mRNA 사본에서 확인할 수 있습니다 L. dispar transcriptome 데이터베이스26,,2728출판.
    2. DNA 템플릿을 통해 RT-PCR 생성 (cDNA 합성: 30 분; 50 ° C의 1 개 주기 PCR: 15 94 ° C의 40 주기 s, 30 ° C 50 s, 그리고 45 ° C 68 s 각).
    3. PCR 정화 키트를 사용 하 여 PCR 제품을 정화.
    4. 템플릿으로 순화 PCR 제품을 사용 하 여 에 체 외 녹음 하 고 정화 dsRNA를 생체 외에서 전사 및 정화 키트를 사용 하 여.
  2. Transfection dsRNA 또는 LD652 세포로 DNA 플라스 미드의
    1. 씨앗 1 x 105 셀/24-잘 접시의 우물 그리고 셀 적어도 1 시간에 대 한 정착.
    2. 페 수를 각 잘 SFM의 100 μ로 4 μ transfection 시 약의 희석. 실 온에서 최대 15 분 동안 품 어. 이 수행 되어야 할 모든 transfections에 대 한 마스터 믹스를 만들기 위해 확장할 수 있습니다.
    3. 페 수를 각 잘 SFM의 100 μ로 dsRNA 또는 총 플라스 미드 DNA의 1 μ g까지 희석. 실 온에서 최대 15 분 동안 품 어.
      참고: 우리는 이전에 발견 dsRNA/105 LD652 셀의 1 μ g의 transfection에 대 한 충분 한은 >의 80% 최저 바이러스 또는 호스트 사본13, dsRNA 복용 하지만 필요한 실험 수정에 대 한 설정 업/조건 해야 합니다 실험적으로 결정 될.
    4. Transfection 시 약 및 dsRNA/플라스 미드 DNA 희석 1:1 비율을 결합 (예를 들어, 희석된 dsRNA의 100 μ와 혼합 희석된 transfection 시 약의 100 μ)와 실 온에서 20 분 동안 품 어.
    5. 한편, 1 mL/SFM의 우물을 세척 하 고 각 우물에 SFM의 500 μ를 추가.
    6. Transfection 시 약 dsRNA (또는 플라스 미드 DNA) 천천히 추가 각 우물에 dropwise 혼합물.
    7. Transfection 시 약 5 h에 대 한 셀을 품 어.
      1. RNAi에 대 한 최저 성적 (, VACV), coinfecting 바이러스에 의해를 포함 하는 실험 바꿉니다 transfection 시 약 5 h transfection 잠복기 후 바이러스 inoculum VSV 루크를 포함 된 (또는 VACV 없이 또는 또 다른 coinfecting 바이러스) (3 단계). 그 후, 완전 한 성장 미디어 2 hpi와 VSV 루크를 포함 하는 바이러스 inoculum을 교체 합니다. 루크 분석 실험 (4 단계) 바이러스 사본 coinfecting의 최저 VSV 뤽 구조의 손실에 이르게 하는 경우 확인 하려면 다양 한 시간 포인트에서 추출한 lysates 다음 수행할 수 있습니다.
      2. RNAi 실험 L. dispar 성적표의 RNAi를 포함, 완전 한 성장 매체 transfection 믹스 바꿉니다 및 감염 VSV 뤽 (4 단계) 이전 24 시간에 대 한 ensue를 최저 허용. 루크 분석 실험 (4 단계) 다음 경우 L. dispar 성적 최저 승격 VSV 뤽 구조 결정을 다양 한 시간 포인트에서 추출한 lysates에 수행할 수 있습니다.
      3. 플라스 미드 식 벡터 표현 후보 immunomodulators의 transfections를 포함 하는 실험에 대 한 transfection 시 약 교체 하 고 단백질 식 VSV 뤽 (4 단계)와 감염 전에 24 h에 대 한 허용 합니다. 루크 분석 실험 (단계 4) 후보 immunomodulatory 단백질의 표현을 촉진 VSV 뤽 구조를 다양 한 시간 포인트에서 추출한 lysates 다음 수행할 수 있습니다.
        참고: transfection 조건 40-6013의 transfection 효율에 1 μ g/우물의 플라스 미드 DNA 결과 사용 하 여 여기에 설명 된.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

라이브 셀 이미징 응용 프로그램을 모니터링 VSV 구조 VACV coinfection 시의 예를 들어, LD652 세포 했다 8 잘 연 발된 접시에 도금 고 다음 모의 감염 또는 VSV DsRed 감염 (나 = 1) VACV-플로리다-GFP의 유무에서 (나 = 25). VSV DsRed DsRed 무료 단백질으로 표현 하 고 구조 VSV 단백질 (그림 1A)에 융합 하지, 때문에 그것만 VSV 항목 및 유전자 식 시작 후 감지 됩니다. 모든 셀 다음 자유롭게 그것은 레이블이 지정 된 셀에 형광 신호의 보존을 촉진 막 impermeant 제품으로 변환, 세포의 원형질 막 통과 하는 세포 생존 염료도 표시 했다. 이미지 마다 5 h 405를 사용 하 여 65 hpi까지 인수 했다 nm, 488 nm, 568, 및 백색 빛 각각 세포 생존 염료, VACV-플로리다-GFP, VSV-DsRed, 및 위상 대비 (PC) 채널 캡처 필터. 단일 감염 조건 하에서 LD652 셀 제한 VSV DsRed 복제; 따라서, 세포 수가 적은 DsRed 신호를 전시 한다. 그러나, VSV-DsRed VACV-플로리다-GFP와의 coinfection 시간 과정 (그림 1B)의 끝에 의해 DsRed 신호 표시 대부분의 세포에서 발생 합니다. 각 시간 지점에서 캡처한 이미지 이미지 분석 소프트웨어, 대상이 됐다 어디 405 nm 568 nm 채널 이미지 자동으로 각각 총 및 DsRed-긍정적인 세포 숫자를 결정 하는 데 사용. 각 치료에 대 한 DsRed 신호를 표시 하는 셀의 백분율 곱하기 100% 뒤 각 시간 지점에 대 한 405 nm 채널에서 식별 된 개체의 수에 의해 568-nm 채널에서 긍정적인 신호 개체 (세포)를 나누어 계산 됩니다. . 그림 1C에서 같이, VSV DsRed 단일 감염에서 ~ 2 %65 hpi에 의해 DsRed 양성 했다. 반면, VSV-DsRed + VACV-플로리다-GFP coinfections ~ 77%가 시간 포인트에서 DsRed 양성 했다. 영화 s 1과 S2 보여 VSV DsRed 감염의 진행 단일 감염과 coinfection 조건에 전체 65 h 시간 동안 각각. 그것은 VACV-플로리다-GFP는 GFP 식 DsRed 신호, 충분 한 VACV 유전자 발현 VSV DsRed 구조 (표시 되지 않음) 전에 필요한 나타내는 이전 10 hpi에 의해 감지 되었다 주의 하는 것이 중요. 샨 다, 이러한 결과 명확 하 게 VACV coinfection에 의해 VSV DsRed 복제의 구조를 나타냅니다. Coinfecting 바이러스는 VSV DsRed를 구출 하지 못했습니다, 우리 사이의 단일 감염 및 coinfection 치료 DsRed-긍정적인 세포의 동일한 백분율을 기대 합니다.

LD652 셀에 VSV 복제 수 있습니다 또는 VSV 뤽 긴장 (그림 2A)를 사용 하 여 발광 기반 분석을 사용 하 여 측정할 수 있습니다. 예를 들어, 그림 2B lysates 셀 모의 감염 또는 감염 VSV 뤽 셀에서 72 h 시간 과정을 통해 준비를 사용 하 여 뤽 분석 결과의 결과 보여줍니다 (나 = 10) VACV-WR의 유무에서 (나 = 25). VSV 뤽 복제의 긍정적인 구조는 임의의 루 lysates coinfected 세포 lysates 단일 VSV 뤽 감염에서 비교에서 준비 발견 로그 증가 의해 표시 됩니다. 부정적인 결과 단일 VSV 뤽 치료에서 관찰에서 루 수치를 변경 하는 coinfection의 실패에 의해이 분석 결과에 표시 될 것 이다. 원하는 경우 준비 lysates 사용할 수 있습니다 또한 immunoblotting를 위한 coinfection 처리에 향상 된 VSV 유전자 발현을 확인 하. 예를 들어 그림 2C 보여줍니다 일반적인 immunoblot 결과 VSV 인코딩 루크와 매트릭스 (M) 단백질 lysates 모의-, VSV 뤽 고 VSV 뤽 + VACV WR 치료 72 hpi 준비. VACV I3L 단백질에 대 한 Immunoblotting VACV 감염의 표식으로 봉사 그리고 immunoblotting 셀룰러 걸에 대 한 로드 제어로 사용 되었다. VSV 인코딩 루크와 M coinfection lysates 추가에 단백질의 명확한 향상 VACV에 의해 VSV 구조를 확인 합니다. 마지막으로, 이러한 LD652 세포 배양에서 supernatants 수집 및 BSC-40 monolayers (그림 2D)에 전염 성 바이러스를 titrating 하 여 생산적인 VSV 복제를 확인할 수 있습니다. 이 결과 VACV 동안에 coinfection는 VSV 생산적으로 복제 하는 방법을 보여 줍니다.

Coinfecting 바이러스 표시 되 면 LD652 셀에 VSV 복제 구조 수, RNAi 심사 VSV 구조에 기여 하는 요소는 coinfecting 바이러스에 의해 식별을 사용할 수 있습니다. 이 실험에서 구출 바이러스 VSV LUC coinfection 동안 "구조의 손실" 표현 형에 이르게 RNAi 조건을 화면. 우리는 이전 VACV 인코딩 녹취 록13의 수십의 RNAi 심사 통해 VSV 구조 요소로 VACV A51R 단백질을 발견. 예를 들어, 우리는이 화면 (그림 3)의 작은 규모 버전을 지 있다. RNAi은 체 외에서 의 transfection에 의해 중재 dsRNAs coinfecting 바이러스에 의해 성적을 대상으로 복사할. 여기에 표시 된 데이터에서 VACV A50R, A51R, 및 A52R 단백질 인코딩 바이러스 성적 RNAi 최저에 대 한 표적으로 했다. 구조의 손실에 대 한 부정적인 컨트롤로 셀 dsRNAs GFP 인코딩 사본을 타겟팅으로 페도 했다. 구조 표현 형의 손실에 대 한 긍정적인 컨트롤로 셀 dsRNAs 뤽 인코딩 성적 증명서에 대 한와 페 했다. 이 치료 coinfection 동안 강한 루 신호 손실을 생성 하 고 연구자 transfection/RNAi 프로토콜 작동 하는지 확인 도움이 됩니다. DsRNA transfection의 5 h 후 셀 VSV 루크와 coinfected 했다 (나 = 10)와 VACV-WR (나 = 25). 만 VSV 루크와 함께 별도 감염도 루 신호의 배경 수준을 확립을 수행 했다. Lysates 다음 72 hpi 수확 되었고 뤽 분석 결과에 사용. DsRNA 치료 GFP dsRNA 제어 치료에 걸쳐 VSV 구조 수준을 비교, 결과 나타냅니다을 최저 VACV A51R의 생산 구조 표현 형의 강한 손실 (손실의 부정적인 결과 생성 하는 A50R 및 A52R의 최저 반면 GFP dsRNA에 비해 구조)입니다.

RNAi VSV 구조에 기여 하는 바이러스 성 요인 식별을 검사 하는 대신, 후보 LD652 세포에 바이러스 요소를 overexpress 하 고 VSV 뤽 구조에 대 한 분석 결과. 이 적절 한 식 벡터 p16629 등으로 관심의 후보 유전자를 복제 하 고 LD652 셀 VSV 뤽 도전 이전에이 플라스 미드를 transfecting 하 여 수행할 수 있습니다. 예를 들어, 그림 4A GFP 플래그 태그 (FGFP) 또는 A51R 플래그 태그 구조 실험을 보여준다 (FA51R) p166 벡터 VSV 뤽 감염 뒤 다양 한 농도에서 LD652 셀으로 페 했다 (모 = 10) 24 시간 후. VSV 구조에 대 한 부정적인 컨트롤로 추가 문화 모의 페 고 플라스 미드 DNA에는 영향을 받지 않았다. Lysates 문화 72 hpi에서 수집 되었고 뤽 분석 실험을 복종 되었다. FA51R 치료는 여러 복용량에서 치료 모의 페를 통해 향상 된 LU 신호에 의해 증명으로 긍정적인 VSV 구조 결과 생산. 대조적으로, FGFP 치료 테스트 어떤 복용량에 VSV 구조에 대 한 부정 했다. 그림 4A 에서 lysates의 Immunoblotting 확인 FGFP 및 FA51R 단백질 (그림 4B)의 비슷한 표현.

RNAi 심사 후보 L. dispar 요인의 사용 하 여, 우리 LD652 셀에 VSV의 제한은 항 바이러스 RNAi 통로에 속하는 다양 한 세포질 요인에 의해 중재 나타났습니다 (예를 들어, AGO2 및 Dicer-2), 핵 요인 카파 B (NF-κB)-관련된 IMD 통로 (예를 들어, 소스), 유비퀴틴-프로테아좀 시스템 (., polyubiquitin)13. 예를 들어, 우리는 반복이 RNAi 실험의 규모 축소판 dsRNAs 최저 시 뤽 VSV 복제 향상 된 L. dispar 증명서를 대상으로 (., AGO2, Dicer-2, 양념, polyubiquitin) 또는 아무 영향 (AGO1 )13. DsRNA transfection의 24 h 후 셀 VSV RNAi 치료 부정적인 제어 GFP dsRNA 치료를 통해 루 신호를 향상 된 경우 확인 하려면 72 h에 대 한 루크와 도전 되었다. LU 신호를 강화 하는 RNAi 치료 대상된 증명서에 의해 인코딩된 요소 VSV 복제 제한 나타냅니다. RNAi 최저에 대 한 긍정적인 컨트롤로 dsRNAs 뤽 인코딩 사본을 타겟팅 병렬 처리에서 페도 했다. 루 GFP dsRNA 제어 트리 트 먼 트, 그것은 그들의 최저 ~ 10을 생산 하기 때문에 RNAi 심사를 사용 하 여 호스트 인코딩 제한 요소를 식별 하는 비교적 간단 감지 신호 낮은 배경 때문-루 신호 ( 에서에서 빌드하기 증가 그림 5). 따라서, 그것은 상대적으로 낮은 배경 VSV 유전자 발현의 수준에 활용을 완화 VSV 제한 호스트 RNAi 최저의 조건 화면 LD652 셀 수 있습니다.

Figure 1
그림 1: 라이브 셀 이미징 형광-기반을 사용 하 여 LD652 세포의 바이러스 coinfection에 의해 VSV 구조의. (A)이이 패널 DsRed (dR) 유전자 위치를 나타내는 VSV DsRed 게놈의 개략도를 보여줍니다. (B) 이러한 대표 10 배 confocal 현미경 이미지 캡처된 60 hpi는. 405 nm 채널 가능한 셀에 대 한 얼룩, 488 nm 채널 VACV-플로리다-GFP 감염 나타냅니다 나타내고 568 nm 채널 VSV DsRed 감염을 나타냅니다. 단계 대조 (PC) 이미지도 표시 됩니다. 바 규모 = 100 µ m. (C)이이 패널 전체 65 h 감염 시간 동안 DsRed-긍정적인 LD652 세포의 비율을 보여줍니다. 각 시간 지점에 대 한 DsRed 신호를 보여주는 셀의 평균 (SD) 비율이 표시 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: 루크 분석 실험을 사용 하 여 LD652 셀에 VSV 구조의 평가. (A)이이 패널 VSV 뤽 게놈의 개략도를 보여줍니다. (B)이이 패널 임의 빛 단위 모의 감염 된 세포 또는 VACV WR의 존재 또는 부재에 VSV-뤽, 감염 세포 lysates의 분석 실험 (루크) 보여줍니다. 및 (C)이이 패널 보여준다 루크, VSV M, VACV I3L의 immunoblot 패널 A 에서 lysates의 셀룰러 걸 단백질 72 hpi 수집. (D)이이 패널 패널 B에서 얻은 문화 supernatants VSV 뤽 titers를 보여줍니다. 패널 BD 의 양적 데이터 3 중에 수행 하는 실험에서 수단을 (± SD)를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: LD652 셀의 coinfection 동안 RNAi 심사 통해 virally 인코딩된 VSV 구조 요인의 식별. 이 패널 루 루 VSV 뤽 단독 감염 세포에서 lysates에서 검색 기준으로 표시 된 RNAi 치료 후 lysates VSV 루크와 VACV WR 셀 72 hpi에서에서 발견에서 배 변화를 보여줍니다. 데이터는 3 중에서 수행 하는 실험에서 수단을 (± SD)를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: LD652 세포에 바이러스 성 immunomodulator의 overexpression에 의해 VSV의 구조. (A)이이 패널 표시는 루크 VSV 뤽 감염 세포 72 hpi에서 시험을 모의 페 (모의) 또는 FGFP 또는 FA51R p166 식 플라스 미드와 페 합니다. LU 신호 각 치료를 모의 페 제어 치료에서 감지 신호를 정상화 했다. 데이터는 3 중에서 수행 하는 실험에서 수단을 (± SD)를 나타냅니다. (B)이이 패널 패널 A, immunoblotted 플래그와 말라 항 체와 lysates를 보여줍니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: 호스트의 식별 요소 RNAi 심사 통해 LD652 세포에 제한 VSV 복제. 이 패널 배 루 신호는 GFP dsRNA 제어 치료 72 hpi VSV 루크와 상대적인 표시 된 RNAi 치료에서 변화를 보여 줍니다. 데이터는 3 중에서 수행 하는 실험에서 수단을 (± SD)를 나타냅니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

영화 S1: 대표 405 nm (셀 생존 염료)와 65 h 시간 걸쳐 캡처한 568 nm (DsRed) 이미지 (각 프레임 = 5 h 간격) VSV DsRed LD652 세포의 감염 후. 이 파일을 다운로드 하려면 여기를 클릭 하십시오.

영화 S2: 대표 405 nm (셀 생존 염료)와 65 h 시간 걸쳐 캡처한 568 nm (DsRed) 이미지 (각 프레임 = 5 h 간격) VSV-DsRed와 VACV-플로리다-GFP LD652 세포의 coinfection 후. 이 파일을 다운로드 하려면 여기를 클릭 하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

여기 우리는 VSV 복제 제한 lepidopteran 세포 배양에서 구출 하는 조건에 대 한 화면을 간단한 형광 및 발광 기반 분석 실험을 설명 했습니다. Lepidopteran 셀에 VSV의 조산 감염 VSV 유전자 발현에 대 한 시 금 때 우수한 신호 대 잡음 비율을 만듭니다. 예를 들어 단일 VSV 뤽 감염에서 lysates 감지 LU 신호 했다 ~ 1,000-fold 보다 높은 모의 감염 lysates 아직 이러한 신호만 72 h 시간 걸쳐 약 두 가지를 변경. VSV-루크와 VACV의 coinfection LU 신호를 강화 하는 반면, ~ 300-fold 이상 72 hpi에 의해 VSV 뤽 감염을 단일. 따라서, VSV 구조 분석 실험 여러 자릿수로 포괄 우수한 동적 범위를 표시 합니다.

이 분석 실험 설정에 중요 한 단계 중 하나 포함 VSV 구조 형광 또는 발광 기반 방법을 사용 하 여에 대 한 분석 결과를 결정을 한다. 우리는 VSV 인코딩 방법을 DsRed 신호 양적 라이브 셀 이미징 기법 및 부재 또는 구조는의 존재에 DsRed-긍정적인 세포의 자동화 된 정량화를 촉진 하는 소프트웨어 패키지를 사용 하 여 분석 될 수 있다의 예 나타났습니다. coinfection입니다. 이 분석 실험은 설정 하 고 다양 한 좁은 시간에 있는 유일한 관찰 VSV 복제 속도 론에서 차이의 검색에 도움이 있습니다 시간 포인트를 캡처 수 있도록 저렴 연구원 라이브 셀 이미징 기능에 액세스할 수 있다면, 창입니다. 대조적으로, 발광-기반 접근 정해진된 시간 지점에서 세포 lysates의 준비를 해야 하는 기본적으로 끝점 분석 되며 lysate 준비 시간이 많이 소요 될 수 있습니다. 다른 한편으로, 발광 기반 분석 정교한 현미경 장비를 필요 하지 않습니다-단지 플레이트 리더 발광 신호를 읽을 수 있는. 또한, 발광 기반 분석 실험 세포 감염의 비율을 계산 하는 현미경 기반 분석 보다 더 동적 범위가 있다. 예를 들어 현미경 분석 실험, DsRed-긍정적인 세포 (VSV DsRed 감염을 나타내는) 수만 범위 0-100에서 %의 시야에서 분석 된 세포의. 반면, 단일 VSV-루크 coinfection (또는 다른 구조 조건) 간의 LU 신호는 몇몇 크기 순서에 배열할 수 있다.

VSV-L. dispar 셀 시스템 여기 포유류 바이러스 인코딩된 immunomodulators에 대 한 화면에 제시 된를 사용 하 여의 주요 장점은 그것이 본질적으로 보존 될 것 및 고 대를 억제 하는 바이러스 성 요인의 식별에 대 한 선택은 앞선 척추 관련 인터페론 응답을 응답에 대 한 항 바이러스. 실제로, 예비 관측 제안 A51R 단백질 보존된 항 바이러스 유비퀴틴-프로테아좀-관련 세포 응답 (참조 사기 외. 억제 13 및 게시 되지 않은 데이터)입니다. VSV의 VACV A51R 구조를의 발견 했다 분리 바이러스 구조는 무척 추 동물 호스트13, 척추 동물 바이러스의 첫 번째 예제와 이러한 심사 시스템 추가 척추 바이러스 인코딩된 immunomodulators를 밝히기 것입니다 높습니다. . 무 겁 게 제한 (또는 실패) 호스트 면역을 억제 하는 조건에 대 한 판독은 VSV 복제 VSV 구조를 사용 하 여 키 여야 하는 것이 중요 하다 VSV 복제에서 검사 중인 셀 형식에서. 따라서, 대부분 포유류 세포 유형 가능성이 것입니다 이러한 유형의 분석, 적합는 VSV 복제 포유류 세포에서 잘. 이 때문에 L. dispar 셀 사용 되었다 VSV는 자연스럽 게 제한 호스트 셀 형식으로 여기.

항 바이러스 RNAi 응답의 바이러스 진압 식 플라스 미드 인코딩 후보 RNAi 진압 및 각자 복제 무리 집 바이러스 게놈 RNA의 cotransfection에 의해 확인 될 수 있었다 초파리 세포에 있는 이전 연구 보여주었다는 B2, 그것의 자연적인 RNAi 억압30대신 GFP를 인코딩합니다. 무리 집 게놈 RNA의 복제 및 GFP의 생산 cotransfected 후보 계수로 RNAi의 억제에 종속 되었고, GFP 식의 구조 RNAi 억제30을 표시 하는 따라서. VSV 뤽 유전자 발현 세포 L. dispar 에이 시스템 또한 RNAi 응답의 맥락에서의 진압을 식별 하기 위해 사용할 수 있습니다 제안을 구출 하는 바이러스로 인코딩된 RNAi 억제제의 overexpression 우리의 게시 되지 않은 작업 표시 진실 fide 는 replicon 반대로 바이러스 성 병원 체에 의해 감염. 참으로, RNAi, IMD와 유비퀴틴-프로테아좀-관련 경로 L. dispar13 VSV 복제의 제한에 기여 하는 찾는 여러 항 바이러스 통로의 길 하 항 바이러스 제는 VSV로 식별 될 수 있습니다 나왔다 여기에 제시 된 분석 실험 구조.

호스트 항 바이러스 단백질의 식별에 관한 이러한 심사 방법의 잠재적인 한계는 L. dispar 게놈 시퀀스는 아직 사용할 수 없습니다입니다. 그러나, 공개적으로 사용 가능한 L. dispar 는 transcriptomes RNAi 최저26,,2728후보 호스트 대상 식별 하는 데 사용할 수 있습니다. 또한, 우리는 앞에 나와 VSV는 지금 공개적으로 사용 가능한 게놈 (예를 들어, Manduca sexta) 다른 lepidopterans13 에서 파생 된 셀 라인에서 제한 된다31. 따라서, 시퀀스 유전자와 다른 lepidopterans에서 파생 된 셀 라인 프로토콜 여기에 설명 된 L. dispar 세포를 대체할 수 있습니다.

주어진 경제 성장 및 arboviruses32의 공중 보건 위협, 여기 제시 하는 심사 분석 실험 소설 전략 새로운 바이러스의 디자인 값을 가질 수 있는 arbovirus-호스트 상호 작용의 새로운 기능을 제공할 수 있습니다. 치료제입니다. 또한, RNA 바이러스 복제를 제한 하는 lepidopteran 메커니즘의 우리의 상대적으로 제한 된 이해, 때문에 여기에 제시 하는 도구가에 의해 호스트 방어 메커니즘을 새로운 기회 제공 경제적으로 중요 한 곤충의 순서입니다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 없다.

Acknowledgments

D.G.는 텍사스 대학의 남서부 의료 센터의 부여 학자 프로그램에서 자금을 지원 했다. 저자는 마이클 휘 트 (테네시 대학 건강 과학 센터)와 숀 Whelan (하버드의과 대학) VSV DsRed 및 VSV 뤽의 조항에 대 한 감사. 또한 저자 게리 Luker (미시간 대학의과 대학) VACV-플로리다-GFP 긴장의 종류 선물 감사합니다.

Materials

Name Company Catalog Number Comments
6-well tissue culture plates CELLTREAT 229106
24-well tissue culture plates CELLTREAT 229124
10 cm tissue culture dishes Corning C430167
Grace’s Insect Medium Sigma G8142
EX-CELL 420 Sigma 14420C
Fetal Bovine Serum - Optima Atlanta Biologicals S12450
Growth medium 1:1 mixture of Grace's Insect Medium and EX-Cell 420 Serum-Free Medium also containing 1% antibiotic-antimycotic solution and 10% Fetal bovine serum
Antibiotic-Antimycotic Solution (100×) Sigma A5955
Dulbecco’s Phosphate Buffered Saline (DPBS) Sigma D8662
Serum Free Media (SFM) Thermo Fisher 10902096
Cytosine arabinoside Sigma C1768
Transfection reagent Thermo Fisher 10362100
Corning cellgro DMSO (Dimethyl Sulfoxide) Corning 25950CQC
Reporter lysis buffer 5x Promega E3971
Luciferase Assay Reagent Promega E1483
96-Well Microplates Corning 3915
Mouse anti-FLAG antibody Wako 014-22383
Rabbit anti-firefly luciferase antibody Abcam ab21176
Mouse anti-actin antibody Sigma A2066
Mouse anti-VSV M N/A N/A Dr. John Connor (Boston University)
Mouse anti-VACV I3L N/A N/A Dr. David Evans (University of Alberta)
8-well Chambered dish Lab-Tek II 155409
Cell viability dye Thermo Fisher C12881
FLUOstar microplate reader BMG Labtech FLUOstar
Confocal microscope Olympus FV10i-LIV
Image analysis software Olympus v1.18 cellSens software
Eppendorf 5702 ventilated centrifuge Eppendorf 22628102
Odyssey Fc Infrared Imaging System Li-COR Biosciences Odyssey Fc
LD652 cells N/A N/A Dr. Basil Arif (Natural Resources Canada)
BSC-40 cells ATCC CRL-2761
BHK cells ATCC CCL-10
HeLa cells ATCC CCL-2
BSC-1 cells ATCC CCL-26
in vitro transcription and purification kit Thermo Fisher AM1626
PCR purification kit Qiagen 28104

DOWNLOAD MATERIALS LIST

References

  1. Nomaguchi, M., Fujita, M., Miyazaki, Y., Adachi, A. Viral tropism. Frontiers in Microbiology. 3, 281 (2012).
  2. Werden, S. J., McFadden, G. The role of cell signaling in poxvirus tropism: the case of the M-T5 host range protein of myxoma virus. Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1784, (1), 228-237 (2008).
  3. McFadden, G., Mohamed, M. R., Rahman, M. M., Bartee, E. Cytokine determinants of viral tropism. Nature Reviews: Immunology. 9, (9), 645-655 (2009).
  4. Silva, J. M., et al. Second-generation shRNA libraries covering the mouse and human genomes. Nature Genetics. 37, (11), 1281-1288 (2005).
  5. Moffat, J., et al. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell. 124, (6), 1283-1298 (2006).
  6. Ma, D., Liu, F. Genome Editing and Its Applications in Model Organisms. Genomics Proteomics Bioinformatics. 13, (6), 336-344 (2015).
  7. Yin, H., Kauffman, K. J., Anderson, D. G. Delivery technologies for genome editing. Nature Reviews: Drug Discovery. 16, (6), 387-399 (2017).
  8. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, (7206), 890-893 (2008).
  9. Houzet, L., Jeang, K. T. Genome-wide screening using RNA interference to study host factors in viral replication and pathogenesis. Experimental Biology and Medicine. 236, (8), Maywood, NJ. 962-967 (2011).
  10. Marceau, C. D., et al. Genetic dissection of Flaviviridae host factors through genome-scale CRISPR screens. Nature. 535, (7610), 159-163 (2016).
  11. Savidis, G., et al. Identification of Zika Virus and Dengue Virus Dependency Factors using Functional Genomics. Cell Reports. 16, (1), 232-246 (2016).
  12. Panda, D., Cherry, S. Cell-based genomic screening: elucidating virus-host interactions. Current Opinion in Virology. 2, (6), 784-792 (2012).
  13. Gammon, D. B., et al. A single vertebrate DNA virus protein disarms invertebrate immunity to RNA virus infection. Elife. 3, (2014).
  14. Letchworth, G. J., Rodriguez, L. L., Del cbarrera,, J, Vesicular stomatitis. Veterinary Journal. 157, (3), 239-260 (1999).
  15. Whelan, S. P., Ball, L. A., Barr, J. N., Wertz, G. T. Efficient recovery of infectious vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National Academy of Sciences of the United States of America. 92, (18), 8388-8392 (1995).
  16. Cureton, D. K., Massol, R. H., Saffarian, S., Kirchhausen, T. L., Whelan, S. P. Vesicular stomatitis virus enters cells through vesicles incompletely coated with clathrin that depend upon actin for internalization. PLoS Pathogens. 5, (4), e1000394 (2009).
  17. Duntsch, C. D., et al. Recombinant vesicular stomatitis virus vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic brain tissue slice-glioma coculture model. Journal of Neurosurgery. 100, (6), 1049-1059 (2004).
  18. Li, Y., Yuan, S., Moyer, R. W. The non-permissive infection of insect (gypsy moth) LD-652 cells by Vaccinia virus. Virology. 248, (1), 74-82 (1998).
  19. Seet, B. T., et al. Poxviruses and immune evasion. Annual Review of Immunology. 21, 377-423 (2003).
  20. Cotter, C. A., Earl, P. L., Wyatt, L. S., Moss, B. Preparation of Cell Cultures and Vaccinia Virus Stocks. Current Protocols in Microbiology. 39, 11-18 (2015).
  21. Andrei, G., et al. Cidofovir resistance in vaccinia virus is linked to diminished virulence in mice. Journal of Virology. 80, (19), 9391-9401 (2006).
  22. Dascher, C., VanSlyke, J. K., Thomas, L., Balch, W. E., Thomas, G. Preparation of recombinant vaccinia virus for expression of small GTPases. Methods in Enzymology. 174-188 (1995).
  23. Martin, A., Rex, E. A., Ishidate, T., Lin, R., Gammon, D. B. Infection of Caenorhabditis elegans with Vesicular Stomatitis Virus via Microinjection. Bio-Protocol. 7, (22), (2017).
  24. Luker, K. E., Hutchens, M., Schultz, T., Pekosz, A., Luker, G. D. Bioluminescence imaging of vaccinia virus: effects of interferon on viral replication and spread. Virology. 341, (2), 284-300 (2005).
  25. Rozelle, D. K., Filone, C. M., Dower, K., Connor, J. H. Vaccinia reporter viruses for quantifying viral function at all stages of gene expression. Journal of Visualizes Experiments. (87), e51522 (2014).
  26. Cao, C., et al. Characterization of the transcriptome of the Asian gypsy moth Lymantria dispar identifies numerous transcripts associated with insecticide resistance. Pesticide Biochemistry and Physiology. 119, 54-61 (2015).
  27. Sparks, M. E., Blackburn, M. B., Kuhar, D., Gundersen-Rindal, D. E. Transcriptome of the Lymantria dispar (gypsy moth) larval midgut in response to infection by Bacillus thuringiensis. PloS One. 8, (5), e61190 (2013).
  28. Sparks, M. E., Gundersen-Rindal, D. E. The Lymantria dispar IPLB-Ld652Y cell line transcriptome comprises diverse virus-associated transcripts. Viruses. 3, (11), 2339-2350 (2011).
  29. Lin, G., Li, G., Granados, R. R., Blissard, G. W. Stable cell lines expressing baculovirus P35: resistance to apoptosis and nutrient stress, and increased glycoprotein secretion. In Vitro Cellular & Developmental Biology - Animal. 37, (5), 293-302 (2001).
  30. Li, W. X., et al. Interferon antagonist proteins of influenza and vaccinia viruses are suppressors of RNA silencing. Proceedings of the National Academy of Sciences of the United States of America. 101, (5), 1350-1355 (2004).
  31. Kanost, M. R., et al. Multifaceted biological insights from a draft genome sequence of the tobacco hornworm moth, Manduca sexta. Insect Biochemistry and Molecular Biology. 76, 118-147 (2016).
  32. Paixao, E. S., Teixeira, M. G., Rodrigues, L. C. Zika, chikungunya and dengue: the causes and threats of new and re-emerging arboviral diseases. BMJ Global Health. 3, (2018).
Arbovirus 감염 바이러스 Immunomodulators 및 호스트 항 바이러스 요인의 식별을 위한 도구를 심사로
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).More

Rex, E. A., Seo, D., Gammon, D. B. Arbovirus Infections As Screening Tools for the Identification of Viral Immunomodulators and Host Antiviral Factors. J. Vis. Exp. (139), e58244, doi:10.3791/58244 (2018).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter