Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Immunisierung von Alpakas (Lama Pacos) mit Protein-Antigene und Antigen-spezifische einzelne Domain Antikörperproduktion

doi: 10.3791/58471 Published: January 26, 2019

Summary

Eine Methode für die Produktion von Antikörpern Einzeldomäne von Alpakas, einschließlich Immunisierung, Blutentnahme, B-Zellen isoliert und Auswahl wird beschrieben.

Abstract

In diesem Manuskript ist eine Methode für die Immunisierung von Alpaka und den Einsatz von molekularbiologischen Methoden Einzeldomäne Antigen-spezifische Antikörper produzieren beschrieben und gezeigt. Kameliden, sind wie Alpakas und Lamas, eine wertvolle Ressource für die biomedizinische Forschung geworden, da sie eine neue Art von schweren Kette nur Antikörper produzieren, die verwendet werden, um einzelne Domäne Antikörper produzieren können. Weil das Immunsystem sehr flexibel ist, können mit sehr hoher Spezifität Einzeldomäne Antikörper zu vielen verschiedenen Protein-Antigene und sogar verschiedene Konformationen des Antigens, erfolgen. Diese Eigenschaften, unter anderem machen Einzeldomäne Antikörper ein unschätzbares Werkzeug für die biomedizinische Forschung. Eine Methode für die Produktion von Antikörpern Einzeldomäne von Alpakas wird berichtet. Ein Protokoll für die Immunisierung, Blutentnahme und B-Zell-Isolation wird beschrieben. Die B-Zellen werden für den Bau einer immunisierten Bibliothek verwendet, die bei der Auswahl der spezifischen Einzeldomäne Antikörper über schwenken verwendet wird. Vermeintliche spezifische Einzeldomäne Antikörper per schwenken werden bestätigt von Pulldown-ELISA oder Gel-Schicht-Assays. Die daraus resultierende Einzeldomäne Antikörper können dann entweder direkt oder als Teil einer veränderter Reagens verwendet werden. Die Verwendung von Einzeldomäne Antikörper und Einzeldomäne Antikörper-basierten Regenten gehören strukturelle, biochemische, zelluläre, in vivo und therapeutische Anwendungen. Einzeldomäne Antikörper können in großen Mengen produziert werden, als rekombinante Proteine in prokaryotischen Expressionssysteme, gereinigt, und direkt verwendet oder entwickelt werden kann, um enthalten spezifische Marker oder Tags, die als Reporter in zelluläre Studien oder verwendet werden können Diagnostik.

Introduction

Alpakas und andere Mitglieder der Familie Kameliden sind eine beliebte Quelle für die Erzeugung von Antikörpern für biomedizinische Forschung1,2,3geworden. Kameliden haben eine einzigartige Immunsystem, da sie produzieren sowohl normale Antikörper als auch schwere Kette nur Antikörper, die die Produktion von viel kleineren Einzeldomäne Antikörpern unter Beibehaltung hoher Spezifität und hohe Affinität zu ermöglichen. So bieten Kameliden Antikörper eine vielseitige Reagenz nützlich für eine Vielzahl von Zwecken. Eine Methode zur Alpaka zu immunisieren und produzieren Einzeldomäne Antikörper gegen eine Vielzahl von Protein-Antigene ist hier beschrieben. Diese Antikörper können in Camelids über ein relativ einfacher Prozess hergestellt werden, die nur die Immunisierung über kleine Injektionen an das Zielprotein (Antigen) und eine Blut zeichnen4erfordert. Anschließend Bibliotheksbau, M13 Phage Display5 und panning versus rekombinante Antigen6 dient zum isolieren und Einzeldomäne Antikörper mit den gewünschten Eigenschaften zu produzieren. Da der Prozess nutzt die Kraft des Phagen-Display-Technologie, fünf oder mehr Antigene gleichzeitig genutzt werden pro Tier, wodurch die Anzahl der Tiere verwendet und damit verbundene Kosten.

Typische Säugetier-Antikörper oder Immunglobuline sind große Moleküle, bestehend aus zwei Arten von Ketten (2 schweren Ketten und 2 leichten Ketten), die durch Disulfid-Bindungen miteinander verknüpft sind. Diese Antikörper sind relativ groß, ausstellenden Molekulargewichte von ca. 140-190 kDa für die reichlicher IgG-Spezies von Menschen, Mäusen, Ziegen und Kaninchen. Immunglobuline kann aufgrund ihrer Multi-Untereinheit Struktur, hohes Molekulargewicht und Disulfid-Bindungen sehr anspruchsvoll, in großen Mengen, so dass ihre hohen Kosten zu produzieren. In den 1990er Jahren wurde entdeckt, dass Kameliden, Kamele, Lamas und Alpakas umfasst neben Säugetieren typische Immunglobulin, eine neuartige Form von Immunglobulin, die in Struktur machen, besitzen nur schweren Ketten7einfacher ist. Diese einzigartige Kameliden-Antikörper besitzen die gleiche Fähigkeit, insbesondere fremde Substanzen mit hoher Affinität binden, sondern bestehen nur aus einem Protein Kette8. Darüber hinaus können Kameliden Antikörper experimentell eine noch kleinere Einheit V-H-H-Fragment, auch genannt eine Einzeldomäne Antikörper9abgeschnitten werden. Aufgrund ihrer geringen Größe Einzeldomäne Antikörper eignen sich für vielfältige Anwendungen in der biomedizinischen Forschung und finden Sie aus einer Vielzahl von akademischen und kommerziellen Quellen1,10. Eine Ausnahme scheint Western blotting da Einzeldomäne Antikörper häufiger gegen Konformation abhängigen Epitope gerichtet sind, die in der Regel unter denaturierenden Bedingungen in Western Blots verwendet verloren sind.

Da sie aus einer einzigen Polypeptidkette bestehen, können bestimmte Einzeldomäne Antikörper werden ausgewählt und leicht in großen Mengen als rekombinante Proteine in Bakterien hergestellt. Einzeldomäne Antikörper können auch genetisch entwickelt werden, um spezifische Marker oder Tags, die als "Reporter-Gruppen" verwendet werden können, für die Diagnose von Krankheiten11enthalten. Diese einfache Handhabung gepaart mit ihrer Flexibilität in der Anwendung bildet Einzeldomäne Antikörper eine wichtige Ressource für Forscher an Universitäten und anderswo.

Als Bestandteil einer National Institutes of Health Kern unterstützt, wurden bestehende Methoden Einzeldomäne Antikörper von Alpakas3,4angepasst. Alpakas haben deutliche Vorteile sowohl einfache Handhabung im Vergleich zu größeren Kameliden Familienmitglieder sowie Barrierefreiheit. Alpakas sind weit verbreitet für Faser- und Fleisch angehoben und somit erhalten Sie regional bei lokalen Alpaka Landwirte, die über ihre Websites oder durch Züchter Landesverbände identifiziert werden können. Stehen zwei Arten von Alpakas, Suri und Huacaya. Huacaya treten häufiger auf und wurden für dieses Protokoll verwendet, aber das Protokoll ist generell für beide Rassen und auch allgemein anwendbar auf andere Camelids.

Protocol

Alle Verfahren mit den Alpakas wurden gemäß Protokollen (2627-2017 und 2018-2925), genehmigt von der University of Kentucky institutionelle Animal Care und Nutzung Committee (IACUC) durchgeführt.

1. Generation von Alpaka Antigen-spezifische Antikörper

  1. Alpaka-Handling und allgemeine Überlegungen
    1. Entsprechende institutionelle und/oder behördlichen Genehmigung einholen.
    2. Erhalten Erwachsene Alpakas, weniger als 10 Jahren mit einem Body condition Score von mindestens 3,0 (Skala 1-5)12. Da sie Herdentiere sind, beherbergen Sie ein Minimum von zwei aber vorzugsweise drei Tiere zusammen.
      Hinweis: Männchen sind empfehlenswert, da in der Regel, sie ein noch mehr Temperament haben und sind einfacher zu handhaben.
    3. Überprüfen Sie den Gesundheitszustand der Tiere durch eine tierärztliche Untersuchung, einschließlich der Überprüfung der Ernährung, Unterkunft, Impfungen und Parasiten Kontrolle Programme13. Stellen Sie sicher, dass die Tiere mit Impfungen angebracht, der geographischen Region basierend auf professionelle tierärztliche Empfehlungen sind. Entwickeln Sie ein Ecto und Endoparasite Steuerprogramm in Absprache mit einem Tierarzt basierend auf einen Überblick über die Geschichte der Herde Herkunfts-und lokalen Besonderheiten13.
    4. Für mindestens eine Woche akklimatisieren, einschließlich der Ausbildung und der Exposition gegenüber Zurückhaltung Halfter.
    5. Eine Blutprobe 4 mL Serum für den Einsatz als Pre-Immunisierung Kontrolle zu sammeln (siehe Schritt 1.4). Der Sera Einfrieren und Lagerung bei-20 ° C in 0,5 mL Aliquote.
      Hinweis: Zu diesem Zeitpunkt kann zusätzliche Blut für eine komplette Blutkörperchen (CBC) Analyse der ursprünglichen Gesundheitszustand der Tiere zu überwachen übernommen werden.
  2. Antigen-Vorbereitung
    1. Bereiten Sie gereinigtes Protein-Antigene in Phosphat-gepufferte Kochsalzlösung (PBS) oder HEPES gepufferten Kochsalzlösung (HBS) und konzentrieren sich auf ≥1 mg/mL. Für das komplette Protokoll, einschließlich Immunisierung, schwenken und Bestätigung von Klonen wird etwa 3 mg Protein benötigt.
      Hinweis: Kameliden Antikörper zeigen hohe Spezifität und Selektivität gegen Protein-Antigene aber sind in der Regel nicht gut geeignet für unstrukturierte Proteine oder Peptid-Antigene, die in der Regel unstrukturiert sind.
    2. Antigen-Reinheit, Reinheit zu etablieren > 90 % gewünscht. Nutzen Sie eine analytische Methode wie SDS-PAGE.
      Vorsicht: Erhebliche Kontamination mit anderen Proteinen kann führen zu Problemen bei der Auswahl, wo einzelne Domäne Antikörper auf Verunreinigungen, anstatt das Zielprotein isoliert werden.
    3. Bereiten Sie gefrorene Aliquote des Antigens, die insgesamt 100 µg Antigen enthält. 50 µL einer 2 mg/mL-Zubereitung ist ideal. 100 µL von 1 mg/mL ist die am meisten verdünnten Proteinlösung geeignet für Immunisierung. Alternativ, wenn das Antigen kann nicht einfrieren/Auftauen zu unterziehen und in Lösung langfristig stabil zu sein bekannt ist, kann sie bei 4 ° c aufbewahrt werden
      Hinweis: Um sicherzustellen, dass das Antigen einen Frost/Tau-Zyklus durchlaufen kann, ummauerte Test, den eine aliquote 20 µL des Antigens in einer dünnen verzichtet werden sollte PCR Rohr- und Snap in flüssigem Stickstoff eingefroren. Tauen Sie das Rohr, durchführen Sie high-Speed Zentrifugation und überprüfen Sie den quantitativen Aufschwung durch den Vergleich der UV/VIS-Aufnahme vor und nach dem Einfrieren oder durch Ausführen einer SDS-PAGE-Gels. Wenn möglich, sollte das Antigen auch für den Erhalt der biologischen Aktivität getestet werden. Wenn Tauwetter Gefrierzyklus erfolgreich ist, ist der verbleibende Antigen Snap in 100 µL-Aliquots eingefroren und bei-80 ° c gelagert Wenn es Probleme mit dem Frost/Tau-Zyklus, kann das Protokoll wiederholt werden, mit dem Zusatz von bis zu 20 % Glycerin.
  3. Immunisierung
    1. Mischen Sie bis zu fünf Antigene, jeweils 200 µg mit Adjuvans in einem Endvolumen von zwischen 300 bis 1.000 µL. Die adjuvante sollte ≥50 % des endgültigen Volumens mit Wasser als das Verdünnungsmittel darstellen.
      Hinweis: Wenn Puffer erforderlich ist, verwenden Sie HEPES, MOPS oder Glycin. Ein pH-Wert zwischen 5 und 6 hat oft erwies sich als günstiger als strikt neutral. Vermeiden Sie polyvalente Ionen wie Phosphat oder Citrat, da sie Koagulation hervorrufen können.
    2. Schneiden Sie das Alpaka Haare mit elektrischen Haarschneider in einem Halbmond Muster entlang der Basis des den Hals von Schulter zu Schulter, angrenzend an den Bogen Lymphknoten Regionen verfügbar zu machen.
    3. Halten Sie das Alpaka, am Hals, langsam injizieren Sie das Antigen subkutan entlang der Basis des Halses in der Nähe der Bogen Lymphknoten mit Hilfe einer 22 G Nadel. Führen Sie fünf Einspritzungen von ~ 200 µL (oder weniger) ~ 5 cm auseinander.
      Hinweis: Die Tiere sollten während der Injektionen von einem zweiten Mitarbeiter zurückgehalten werden. Injektion und Blutungen Alpakas Aufforderungen zur Vorsicht, da sie zu treten, nicht nur von hinten, sondern seitlich neigen. Nachdem die Tiere nahe beieinander, in einer Gruppe im Verlauf der Verfahren ist optimal. Angesichts der Tatsache, dass sie Herdentiere sind, sie sind in einer Gruppe ruhiger und weniger kraftvoll Zurückhaltung ist im Verlauf der Verfahren erforderlich.
    4. Die Tiere für ~ 20 min Post Injektion auf Anzeichen einer Anaphylaxie zu überwachen (siehe Schritt 1.6). Monitor für lokalisierte Entzündung an den Injektionsstellen wöchentlich, der nicht erwartet wird, wenn die empfohlenen Adjuvans mit. Sicherstellen Sie, dass das Blut Leck aus der Injektionsstelle nicht übermäßig ist.
    5. Führen Sie fünf weitere Steigerung Injektionen wöchentlich mit 100 µg jedes Antigen in der Mischung. Abschneiden der Haare an den Injektionsstellen sein pro Woche je nach Saison erforderlich. Im Herbst und Winter kann die Tiere Haare schnell wachsen.
  4. Blutentnahme
    1. Stecken und der Sammelstelle mit Alkoholtupfer desinfizieren.
    2. Zurückhalten Sie das Tier sanft mit dem Hals aufrecht gehalten und gerade.
      Hinweis: Tiere können manuell, wie im Video gezeigt zurückgehalten werden. Falls verfügbar, ein Alpaka-Rutsche nutzen, um die Alpakas bei Blutungen zurückhalten und Injektionen können Handhabung zu erleichtern. Unterbrochen Alpakas sind um ein Alpaka-Rutsche zu verwenden, führte in die Rutsche und zurückhaltend mit Hals Bars und Gurte mit Schnellspanner. Die Alpaka-Rutsche-Versionen sind von kommerziellen Anbietern erhältlich.
    3. Mit der ventralen Projektion der Querfortsatz der Wirbel als Wahrzeichen, verdecken Sie die Vene durch Druck auf den ventralen Prozess nur medial.
      Hinweis: Es gibt keine eindeutige Vena Furche in Erwachsenen Alpaka. Die Halsvenen sind durch ventrale Projektionen der transversalen Wirbelkörper Prozesse geschützt. Diese Dicke Haut (z. B. 1 cm dick "fighting Platte" in der Mitte 1/3 der Hals bei Männern) und Halsmuskulatur macht es schwierig zu visualisieren oder die Halsschlagader selbst ertasten. Anschließend ist die Verwendung der Wirbelkörper Wahrzeichen der hilfreichsten Indikatoren für Vena Standort.
    4. Stechen Sie die Nadel in einem 45° Winkel leicht medial (~ finger Breite) der Projektion in die Mitte des Halses. Manipulieren Sie die Nadel, bis Blut fließt.
      Hinweis: Die Halsschlagader und Halsschlagader liegen nah beieinander. Venöses Blut kann durchaus in der Farbe rot aber ist noch dunkler als arterielles Blut. Im Anschluss an die Sammlung Druck angewandt werden, auf der Website für 0,5-1 min (oder länger, wenn die Halsschlagader zugegriffen wird) bis Hämostase gewährleistet ist.
    5. Ziehen Sie 4-10 mL Blut für analytische Zwecke. Nutzen Sie ein 1,5 Zoll, 20 G-Nadel in der Regel in Verbindung mit einer geeigneten Größe Spritze oder Blutsammelröhrchen. Nutzen Sie Lavendel oben K2EDTA-Röhrchen für die Erhebung der Vollblut, wenn Lymphozyten zu reinigen. Gold Top Serum Trennung Röhren (BD) zu nutzen, wenn das Blut Serum Produktion zu sammeln.
    6. 50-100 mL Blut für Produktionszwecke zu zeichnen. Verwenden Sie ein zusätzliche 12-Zoll-Infusion Erweiterungssatz mit einem geflügelten 19-20 G "Schmetterling" Infusions-Set.
      Hinweis: Eine Erweiterung eingestellte Konfiguration ermöglicht Assistent mehrere Blutentnahmeröhrchen, so dass die Venipuncturist sich auf die Stabilisierung der Sammlung Nadel zu füllen. Die Zugabe von Infusions-Set bietet Platz für mögliche Bewegung des Tieres (ca. 3-5 min-Verfahren) und bietet einen komfortable Arbeitsabstand für die Betreiber.
  5. Immune Überwachung
    1. Führen Sie drei bis vier Tage nach der 3rd und 5th Injektionen einen kleinen Test-Bleed aus jedem Tier, Sera zum Testen zu erhalten. Frieren Sie ein und lagern Sie der Sera in 0,5 mL Aliquote. Erhalten Sie zusätzliche Blutproben zur gleichen Zeit, die Gesundheit des Tieres, zu überwachen, wie oben beschrieben.
    2. Bestätigen Sie die Anwesenheit von Antigen-spezifische Antikörper mittels ELISA mit dem Sera Test blutet zu bereits immun, drei Wochen und fünf Wochen Zeitpunkten entnommen. Es empfiehlt sich, eine endgültige Beschnittzugabe zu nehmen, während die Antikörpertiter noch zunimmt.
    3. Generieren Sie Antigen Affinität Platten mit Oberfläche behandelten 96-Well-Platten. Verdünnen Sie 0,1 µg des Antigens in 100 mM Natriumcarbonat-Puffer, pH 9,0. Jedes gut 100 µL der Lösung hinzufügen und über Nacht bei 4 ° c inkubieren Zehn Verdünnungen von jedes Antigen sind in zweifacher Ausfertigung getestet. Ein leeres Steuerelement ist gut vorbereitet, die mit Carbonat Puffer nur beschichtet ist.
    4. Nach der Übernachtung Inkubation, invertieren die Platte entfernen den Inhalt der Brunnen zu waschen dreimal mit 0,1 mL PBS, 0,1 % Tween 20 (PBS-T).
    5. Blockieren Sie die Brunnen, durch Hinzufügen von 0,1 mL der BSA (5 mg/mL) im PBS-T und Inkubation der Platte für 1 h bei Raumtemperatur.
    6. Waschen Sie die Platte dreimal mit PBS-T durch Pipettieren der Waschlösung in den Brunnen und entfernen dann die Waschlösung durch die Umkehrung der Platte.
    7. Bereiten Sie zweifache Verdünnungsreihen von 0,3 mL jeweils vorab immun- und immun Sera in PBS-T-Puffer mit einem Start Verdünnung von 1/100 und bis zu 1/102, 400.
    8. 100 µL jeder Verdünnung in die Vertiefungen und lassen für 2 h bei Raumtemperatur inkubieren.
    9. Entfernen Sie das Serum aus jedem Brunnen und mit 0,2 mL PBS-T waschen Sie dreimal.
    10. Inkubieren Sie jeweils gut mit 0,1 mL HRP-konjugierten Ziege Anti-Lama-IgG-Antikörper bei einer Verdünnung von 1: 20.000 für 1 h.
      Hinweis: Die Immunantwort gemessen umfasst sowohl konventionelle als auch schwere Kette nur Antikörper, die in etwa gleichen Verhältnissen in Umlauf3,14.
    11. Die Antikörperlösung entfernen und waschen jeweils gut mit 0,2 mL PBS-T dreimal.
    12. Die gut 100 µL des chromogenen Peroxidase Substrat hinzu und bei Raumtemperatur inkubieren Sie, bis die Intensität der zwei höchsten Konzentration Punkte haben gesättigt ist, die dauert in der Regel 5-10 min.
    13. Geben Sie 100 µL 0.1 M Schwefelsäure in jeder um die Reaktion zu stoppen.
    14. Messen Sie die Absorption von jedem Bohrloch bei 450 nm mit einem Teller-Reader.
    15. Zeichnen Sie die Absorption als Funktion Konzentration.
  6. Alpaka Überwachungs- und mögliche Komplikationen
    1. Geeignete Alpaka Überwachung während des Verfahrens zu gewährleisten.
      Hinweis: Die Verfahren dürften nicht dazu führen, dass erhebliche nachteilige Auswirkungen. Wohlbefinden der Tiere und Gesundheit sollten täglich durch Tierhaltung und/oder Forschung Personal überwacht werden, beim Füttern und tränken. Jedes Tier mit grob experimentell induzierte oder spontane natürliche Morbidität sollten für die Bewertung Veterinärbehörden mit Behandlung(en) zur Verfügung gestellt, je nach Bedarf, bis zu humane Euthanasie, ggf. verwiesen werden.
      Möglichen nachteilige Folgen verbunden mit Phlebotomie sind Blutungen, Blutergüsse und Hämatom. Die Tiere sollten für 20 min Post Blutentnahme zu suchen, die Anzeichen von Blutungen beobachtet werden. Zusätzlicher Druck auf den Seiten sollte verwendet werden. Wenn die Blutung nicht stoppen, sollte ein Tierarzt kontaktiert werden.
      Anderen potenziellen nachteiligen Folgen verbunden mit Injektionen und Blutungen gehören Granulomaanordnung und Entzündung. Granulomaanordnung ist nicht zu erwarten und nicht an der University of Kentucky beobachtet worden. Injektion Website Entzündung (Rötung oder Schwellung) auftreten, könnte und sollte von einem Tierarzt gebracht werden. Die Produktion bluten stellt ein potenziell erhebliche Volumen des Blutes, und die Tiere sollten überwacht werden, um sicherzustellen, dass sie stabil und aktiv nach der Blutentnahme sind.
      Anaphylaxie und pyrogene Antworten sind die zwei am ehesten ernsteren nachteilige Folgen, aber nur sehr selten beobachtet. Gäbe es auftreten, Anaphylaxie auftreten würde, kurz nach der Antigen-Injektionen und durch eine Zunahme der Rektaltemperatur, Schwäche, Erbrechen, Atembeschwerden und/oder Durchfall manifestiert werden. Rektale Temperatur kann nach jeder Injektion zu erkennen, eine Erhöhung der Körpertemperatur überwacht werden. Wenn diese erkannt werden, benachrichtigen Sie einen Tierarzt sofort für eine Beratung. Darüber hinaus sollte ein Notfall "Crash-Kit" (z. B. Adrenalin, Kortikosteroide und Antihistaminika) in Absprache mit einem Tierarzt vorbereitet zur Behandlung von Tieren, die im Verdacht, eine negative Reaktion.

2. reinigen Lymphozyten für Einzeldomäne Antikörper Bibliotheksbau

  1. Sammeln Sie 50 mL Blut drei bis fünf Tage nach der letzten Injektion (siehe Schritt 1.4).
    Hinweis: Schnelle Verarbeitung von Blut und Isolierung von RNA ist wichtig, einen entsprechenden Bibliothek Größe15,3, das ist sehr wichtig für den Erfolg der Verschiebung zu erhalten.
  2. Verdünnen Sie das gesammelte Blut 15 mL mit 5 mL PBS.
  3. Nutzen Sie ein Lymphozyten Trennung Rohr um die peripheren Blut-Lymphozyten (PBLs) durch Dichte Gradienten Zentrifugation laut Hersteller Anregungen zu isolieren.
    Vorsicht: Herstellerangaben zufolge bis zu 25 mL Blut kann verwendet werden, aber dies kann das System sättigen und verhindern, dass eine saubere Lymphozyten-Vorbereitung zu erhalten.
  4. Hinzugeben Sie 5 mL PBS auf 4 ° C zu PBL prechilled.
  5. Spinnen Sie für 20 min bei 800 X g bei 4 ° C.
  6. Zwei Mal durch Zugabe von 5 mL PBS prechilled auf 4 ° C zu PBL, gefolgt von der Zentrifugation für 20 min bei 800 X g bei 4 ° c zu waschen
  7. Gesamt-RNS mit einem Spin-Spalte basierend System entsprechend den Anweisungen des Herstellers zu isolieren. Homogenisieren der Zellen durch Vertexing in entsprechende Puffer und ein Biopolymer-Schreddern System zuweisen. Verwenden Sie eine entsprechende Anzahl von Mini oder Maxi-Spalten basierend auf der Zelle eingeben.
  8. CDNA mit Reverse Transkriptase durch die Kombination von 10 µg RNA mit einer Mischung aus 0,1 µg von Oligo (dT) 12-18-Primer zu synthetisieren.
  9. Generieren einer Bakteriophage Bibliothek mit etablierten Methoden4. Dies beinhaltet Klonen mit Restriktionsenzymen in der Phage Display Vektor pMES4 gefolgt von der Expression des Inserts verschmolzen zu Gen III von filamentösen Phagen für die Produktion der Phagen-Lösung.

3. einzelne Domain Antikörper schwenken

  1. Antigen-Affinität-Platten mit Oberfläche behandelten 96-Well-Platten zu produzieren. Verdünnen Sie 0,25 µg des Antigens in 100 mM Natriumcarbonat-Puffer, pH 9,0. Jedes gut 100 µL dieser Lösung hinzufügen und über Nacht bei 4 ° c inkubieren Zwei Brunnen pro Antigen zu beschichten. Bereiten Sie ein leeres Steuerelement gut, das mit Carbonat Puffer nur beschichtet ist.
    Hinweis: Platten können produziert und gelagert bis zu einer Woche bei 4 ° C wenn mehrfache Umläufe der Auswahl durchgeführt werden. Diese Methode nutzt auch, direkte Absorption, die keine Kennzeichnung, während andere Methoden verwenden, Biotinylierungen oder andere Arten der Kennzeichnung Strategien.
  2. Inkubieren Sie die Platte über Nacht. Invertieren Sie, löschen den Inhalt der Brunnen zu waschen dreimal mit 0,1 mL PBS-T.
  3. Blockieren Sie die Brunnen, durch Hinzufügen von 0,1 mL der BSA (20 mg/mL) mit PBS-Puffer und Inkubation der Platte für 2 h bei Raumtemperatur.
  4. Waschen Sie die Platte dreimal mit PBS-T gefolgt von dreimal mit PBS. Antigene können auch kovalent gekennzeichnet und in Capture-Systeme wie z. B. Streptavidin/Biotin Systeme verwendet.
  5. Vorbehandeln der Phagen-Lösung (100 µL) mit 100 µL von 40 mg/mL BSA mit PBS-Puffer auf einer vibrierenden Plattform bei Raumtemperatur für 30 Minuten.
  6. Fügen Sie die Phagen-Lösung für das Antigen beschichtet, Brunnen und mit sanften Agitation für 2 h bei Raumtemperatur inkubieren. Verwenden Sie mehrere Brunnen, um insgesamt 1011 Phagen für jedes Antigen zu gewährleisten.
  7. Verwerfen Sie der ungebundenen Phagen durch Umkehrung und dann waschen Sie die Brunnen fünfmal mit 200 µL PBS-T gefolgt von fünf Mal mit PBS.
  8. Eluieren Sie die gebundenen Phagen durch Zugabe von 0,1 mL von 0,25 mg/mL Trypsin in PBS und Inkubation für 30 min bei Raumtemperatur auf der vibrierenden Plattform bei 700 u/min.
  9. Übertragen Sie die Lösung in ein Fläschchen mit 5 µL 4 mg/mL 4-Benzenesulfonyl Fluorid hydrochloride(AEBSF) Lösung Trypsin Aktivität zu stillen.
  10. TG1 Phage Display zuständigen Zellen bei 37 ° C mit schütteln bis OD600 = 0,5.
  11. 3 mL der TG1 Zellen 50 µL eluierten Phagen hinzufügen.
  12. Inkubation bei 37 ° C ohne Schütteln für 30 Minuten.
  13. Hinzugeben Sie 7 mL LB Medien ergänzt mit 100 µg/mL Ampicillin, 2 % Glukose.
  14. Schütteln Sie, über Nacht bei 37 ° C.
    Hinweis: Um die unterschiedlichsten Einzeldomäne Antikörper zu erhalten, können Klone sequenziert, für die gewünschten Eigenschaften getestet und nach einer Runde der Verschiebung verwendet. Um die höchste Affinität Einzeldomäne Antikörper zu erhalten, sollten zwei Runden der Verschiebung genutzt werden.
  15. Platte der Bakterien nach Übernachtung Wachstum auf LB-Agar-Platten mit 100 µg/mL Ampicillin, 2 % Glukose ergänzt. Mehrere serielle Verdünnungen muss geprüft werden, beginnend mit zwei Verdünnungen, Beschichtung 100 µL von 1/10.000 bis 1/100.000 Verdünnungen.
  16. Die Platte über Nacht bei 37 ° c inkubieren
  17. Wählen Sie die Kolonien und impfen Sie die Vertiefungen einer sterilen 96-Well-Platte mit 100 µL der 2XYT mit 100 µg/mL Ampicillin, 2 % Glucose, 10 % V/V Glycerin pro Bohrloch zu.
  18. Inkubation über Nacht bei 37 ° C ohne schütteln.
  19. Schütteln Sie am nächsten Tag bei 170 u/min bei 37 ° C für 60 min.
  20. Entfernen Sie 2 µL der Medien in PCR-Röhrchen. Die restliche Lösung kann links in der Platte und 1-2 Tage bei 4 ° C gelagert oder eingefroren und bei-80 ° C für eine spätere Verwendung gespeichert werden.
  21. Führen Sie PCR-Reaktion unter Verwendung der Primer für den Vektor genutzt. CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC und GGTGGTGTGAGGAGACGGTGACCTG sind für pMES4 PCR-Screening positive Klone verwendet Zündkapseln, die Site mit mehreren Klonen zu flankieren. Nutzen Sie Radfahren geeignete Bedingungen für die Polymerase verwendete, eine Anlasstemperatur von 57 ° C und 30 Zyklen.
  22. Analysieren der PCR-Reaktion durch Ausführen einer Agarose-Gels 1 % (w/V). Kolonien, die positive haben Einzeldomäne Antikörper gen Einsätze von ~ 500 BP. Stellen Sie sicher, dass positive Klone 20-50 % der Stichprobe sind.
    Hinweis: Diese Methode bietet eine Möglichkeit zum Klonen, Auswahl und Analyse, die in den meisten Forschungslabors durchgeführt werden kann. Alternativ, Next Generation Sequencing aufgebracht werden und bietet große Datasets, die statistische und vergleichende Analyse16ermöglichen.
  23. Die positive Klone von der Platte in frischen Röhrchen enthält 7 mL LB mit 100 µg/mL Ampicillin zu impfen.
  24. Wachsen Sie mit Schütteln für über Nacht bei 37 ° C.
  25. Führen Sie eine Miniprep auf die Kultur, Plasmid DNA zu erhalten.
  26. Laufende positive Klone mit der Standard-Sequenzierung Grundierung pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Führen Sie computergestützte Analyse resultierenden Einzeldomäne Antikörper Sequenzen. Damit gibt es keine Stop-Codons oder Frame verschiebt.
  28. Die daraus resultierenden Sequenzen für Ähnlichkeit und Vielfalt zu klassifizieren. Die Sequenzen, die immer wieder identifiziert werden sind am ehesten zu hohe Affinität verbindlichen Sequenzen, vor allem nach zwei Runden der Auswahl.
  29. Ausdruck den Einzeldomäne Antikörper mit einen Stamm BL21 abgeleitete Ausdruck des E. Spule. Induzieren Sie die Expression durch die Zugabe von IPTG, wächst über Nacht bei 22 ° C.
  30. Reinigen des Einzeldomäne Antikörpers mit immobilisierten Metall Affinitätschromatographie (IMAC).
  31. Einzeldomäne Antikörper/Antigen-Bindung mit einer direkten Interaktion Assay wie Pulldown-Menü, gebürtige Gelelektrophorese oder ELISA zu validieren.
  32. Einzeldomäne Anwendungs-spezifische Antikörper Leistung wie gewünscht für die spezifischen Experiment zu überprüfen.

Representative Results

Das Protokoll hier vorgestellten wurde eingesetzt, um einzelne Domäne Antikörper gegen eine Reihe von Protein-Antigene zu generieren. Fünf Antigene wurden pro Alpaka eingesetzt. Immune Überwachung angegeben, dass die Mehrheit der Antigene starke Reaktion ab drei Wochen (Abbildung 1 zeigte). Produktion blutet und Bibliotheksbau nach etwa sechs Wochen gibt der besten Balance für die Tiere, die haben mehrere Antigene injiziert. Zwei Runden der Verschiebung für jedes Antigen durchgeführt wurden, und isoliert Kolonien gezeigt (Abbildung 2). Sequenzierung der positiven Kolonien identifiziert verschiedene Einzeldomäne Antikörper Sequenzen für verschiedene Antigene. Zum Beispiel wurden drei einzigartige Klone auf der Referenz-Antigen Maltose Binding Protein (MBP) (Abbildung 3A) isoliert. Wie häufig zu beobachten ist, enthalten die Einzeldomäne Antikörper erhebliche Sequenz Vielfalt und sehr variabel CDR3 Länge (Abbildung 3). Diese Eigenschaften sind besonders wichtig in Einzeldomäne Antikörper/Antigen Interaktionen wie in der Referenz Einzeldomäne Antikörper/CX3CL1 komplexe17 (Abb. 3 b) zu sehen.

Die Mehrheit der in voller Länge Einzeldomäne Antikörper Sequenzen kann zum Ausdruck gebracht und bei 1-10 mg/L der Kultur (Abb. 4A) gereinigt werden. Aufgrund der Vielfalt in CDR3 Länge zeigen verschiedene Einzeldomäne Antikörper Abwandlung im Molekulargewicht. Bestätigung der direkten Bindung und spezifische Anwendungsleistung ist von entscheidender Bedeutung. Z. B. nach zwei Runden der Selektion gegen Antigen B identifiziert ein Gremium von Einzeldomäne waren Antikörper (Abbildung 2). Mehrere identische Sequenzen wurden identifiziert, und der Einzeldomäne Antikörper hergestellt und gereinigt wurde. Es war dann über direkten Zug nach unten mit Antigen Affinität Harz getestet und zeigte solide Dosis-abhängige Bindung (Abbildung 4 b). Wichtig ist, zeigte der Einzeldomäne Antikörper keine Bindung an das Harz zu kontrollieren. Diese Daten zeigen eine direkte Bindung Interaktion und derjenige, der gut für Affinität Capture im Pulldown-Menü und ELISA-basierten Formate geeignet ist.

Figure 1
Abbildung 1 : Repräsentative immun Überwachung von zwei unterschiedlichen Antigene zeigen deutliche spezifische Immunantwort gegen verschiedene Antigene im gleichen Tier. Viele Antigene zeigen starke Reaktion bereits drei Wochen nach Beginn der Immunisierung, die meisten zeigen maximale Reaktion nach sechs Wochen. Sechs Wochen auch Affinität Reifung ermöglicht und ist die empfohlene Zeit für die Produktion bluten und B-Zell-Isolation. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : PCR-basierter Bestätigung von positiven Klonen. Primer überspannen die MCS des pMES4 Vektors, und ein positiven gemeinnützige Klon produziert eine Amplifikate von ~ 500 bp (markiert mit *). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : Antigen-spezifische Sequenzen hervorheben Alpaka Einzeldomäne Antikörper Vielfalt. (A) Ausrichtung wählen Sie einzelne Domäne Antikörper Sequenzen isoliert an MBP mit einer Referenz Einzeldomäne Antikörper 4XT1, Rahmen und Komplementarität bestimmen Regionen (Kabat) unten hervorgehoben. (B) Struktur des Alpaka Einzeldomäne Antikörper 4XT1 an CX3CL1 gebunden (PDB 4XT1), betont die wichtige Rolle der Variable CDR Schleifen in spezifischen Antigen-Bindung. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4 : Reinigung und Validierung von Einzeldomäne Antikörper. (A) SDS-PAGE IMAC gereinigt Einzeldomäne Antikörper, diverse Einzeldomäne Antikörper zu vergleichen. Unterschiedlichen Molekulargewichte sind in erster Linie aufgrund unterschiedlicher Länge der CDR3-Schleife. Unterschiedlichen Ebenen des Ausdrucks sind auch mit einer Minderheit von Einzeldomäne Antikörpern zeigt schlechte Erträge der gereinigten Protein beobachtet. (B) Prüfung der direkten Bindung mit Affinität Antigen Pulldown-Menü. Robuste dosisabhängig Einzeldomäne Antikörperbindung wird mit Antigen-gekoppelten Harz aber nicht mit Kontrolle Harz beobachtet. Bitte klicken Sie hier für eine größere Version dieser Figur.

Discussion

Wie bereits erwähnt, die hohe Affinität und Spezifität Einzeldomäne Antikörper, kombiniert mit ihrer oberflächlichen Ausdruck und Stabilität, machen sie ideale Reagenzien für die Anwendungen in der biomedizinischen Forschung als wichtige biochemische Reagenzien, Diagnose-Tools, oder Therapeutika18. Für kommerzielle Anwendungen gibt es einige Probleme im Zusammenhang mit geistigem Eigentum, der berücksichtigt werden müssen. Darüber hinaus können Einzeldomäne Antikörper entwickelt werden, um spezifische Marker oder Tags, die als Reporter in zelluläre Assays oder in der Diagnostik verwendet werden können enthalten. Der Schlüssel für diese Anwendungen ist die Fähigkeit, spezifische Einzeldomäne Antikörper gegen Antigene von Interesse. Eine Methode wird hier beschrieben um Einzeldomäne Antikörper mit Alpakas, zu produzieren, die eine robuste Immunantwort gegen eine Vielzahl von Protein-Antigene produziert. Überlegungen zum Umgang mit Tier und Einhaltung gesetzlicher Vorschriften sind beschrieben. Diese sind der Schlüssel für den Erfolg in diesem Teil des Prozesses.

Es gibt weitere Strategien für die Herstellung von Einzeldomäne Antikörper, die die Impfung nicht erforderlich, sondern verwenden Sie stattdessen vollsynthetisches Bibliotheken mit unterschiedlichen Systemen für die Auswahl und iterative Optimierung der Affinitäten19,20 . Der Vorteil der Verwendung von Bibliotheken von immunisierten Tieren stammen, ist jedoch die Fähigkeit, zuverlässig hoch angereicherten, vielfältig und qualitativ-Affinität Einzeldomäne Antikörper zu isolieren. Darüber hinaus nicht nur erhebliche Sequenzvariationen beobachtet werden, aber eine deutliche Mehrheit der spezifischen Einzeldomäne Antikörper isoliert hatte einzigartige Einfügungen und Löschungen, insbesondere CDR3.

Weitere, einzelne Domain, die Antikörper über ein einfaches Verfahren produziert werden können, die nur kleine Injektionen des Antigens und nach diesem Prozess erfordert, können die Tiere zur Herde zurückgegeben werden. Beachten Sie das Tier für die Faserproduktion frei nutzbar, sondern muss aufgrund der Verwendung der Testantigene und nicht-FDA zugelassenen Adjuvans für Einzeldomäne Antikörperproduktion durch Verwendung als Fleisch (menschliche Nahrungskette) ausgeschlossen werden. Wenn der Vorgang abgeschlossen ist, können die Tiere sollten für eine Woche, angesichts eine tierärztliche Abschlussprüfung überwacht werden und dann entweder kehrte in ihre heimatlichen Hof oder ruhte für sechs Monate vor einer weiteren Runde von Einzeldomäne Antikörperproduktion.

Disclosures

DRS. Whiteheart und Hersh sind an der University of Kentucky und betreiben einen Kern im Zentrum für Molekularmedizin, die einzelne Domäne Antikörper in Alpaka als eine Fee-for-Service produziert.

Acknowledgments

Diese Arbeit wurde von der National Institutes of Health (P30GM103486) unterstützt.

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Immunisierung von Alpakas (<em>Lama Pacos</em>) mit Protein-Antigene und Antigen-spezifische einzelne Domain Antikörperproduktion
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter