Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Alpacas (라마 pacos) 단백질 항 원 및 항 원 특정 단일 도메인 항 체의 생산의 면역

doi: 10.3791/58471 Published: January 26, 2019

Summary

Alpacas에서 단일 도메인 항 체의 생산을 위한 방법, 예방 접종, 혈액, B-세포 절연 및 선택을 포함 한 설명 이다.

Abstract

이 원고에 알파 카의 예방접종 및 항 원 특정 단일 도메인 항 체를 생산 하는 분자 생물학 방법의 사용에 대 한 메서드는 설명 하 고 시연. Camelids, 라마, alpacas 등 되고있다 생물 의학 연구를 위한 귀중 한 자원 때문에 그들은 새로운 유형의 단일 도메인 항 체를 생산 하는 데 사용할 수 있는 무거운 체인 전용 항 체 생산. 면역 체계는 매우 유연 하기 때문에 단일 도메인 항 체 특이성의 매우 높은 학위를 가진 많은 다른 단백질 항 원, 항 원, 심지어 다른 conformations를 만들 수 있습니다. 이러한 기능을, 생물 의학 연구를 위한 귀중 한 도구 단일 도메인 항 체를 확인합니다. Alpacas에서 단일 도메인 항 체의 생산에 대 한 방법을 보고 됩니다. 예방 접종, 혈액 수집, 및 B-세포 격리 프로토콜 설명 되어 있습니다. B 세포 면역된 라이브러리, 패닝 통해 특정 단일 도메인 항 체의 선택에 사용 되는의 건설에 사용 됩니다. 풀-다운, 패닝 통해 얻은 putative 특정 단일 도메인 항 체 확인 ELISA, 또는 젤 교대 분석 실험. 결과 단일 도메인 항 체 직접 또는 설계 시 약의 일부로 사용할 수 있습니다. 단일 도메인 항 체와 단일 도메인 항 체 기반 regents의 사용 구조, 생화학, 세포, vivo에서, 및 치료 응용 프로그램을 포함합니다. 간결한 식 시스템에 있는 재조합 형 단백질 순화, 직접 사용 또는 특정 마커 또는 세포 연구 또는 기자로 사용할 수 있는 태그를 포함 하도록 설계 될 수 있다 단일 도메인 항 체 대량에서 생산 될 수 있습니다. 진단 프로그램입니다.

Introduction

Alpacas, 그리고 camelid 가족의 다른 일원 생물 의학 연구1,2,3에 대 한 항 체를 생성 하기 위한 인기 있는 소스 되 고 있습니다. 그들은 모두 정상적인 항 체로 높은 특이성 및 높은 선호도 유지 하면서 훨씬 더 작은 단일 도메인 항 체의 생산을 허용 하는 무거운 체인 유일한 항 체 생산에 Camelids 독특한 면역 체계가 있다. 따라서, camelid 항 체 다양 한 용도로 유용 하 게 다재 다능 한 시 약을 제공합니다. 알파 카 면역 단백질 항 원의 다양 한 단일 도메인 항 체를 생성 하는 방법 여기 설명 되어 있습니다. 이 항 체만 대상 단백질 (항 원)과 혈액 그리기4의 작은 주사를 통해 예방접종을 필요로 하는 비교적 간단한 과정을 통해 camelids에 생산 수 있습니다. 그 후, 도서관 건설, M13 살 균 소 전시5 , 재조합 형 항 원6 대 팬 분리 하 고 원하는 특성을 가진 단일 도메인 항 체를 생산 사용 됩니다. 프로세스 페이지 디스플레이 기술의 힘을 이용 하기 때문에, 5 개 이상의 항 원 동물 당 동시에 이용 될 수 있다, 사용 하 고 비용을 관련 된 동물의 수를 줄입니다.

전형적인 포유류 항 체 또는 면역 글로불린 체인 (2 무거운 사슬과 2 경 쇄), 이황화 결합을 통해 서로 연결 되어 있는 두 가지 유형의 구성 된 큰 분자 이다. 이러한 항 체는 비교적 큰 전시 ~ 140-190의 분자 무게 인간, 쥐, 염소, 토끼에서 더 풍부한 IgG 종 kDa. 그리고 때문에 그들의 여러 소 단위 구조, 높은 분자량, 이황화 결합, 면역 글로불린 대량, 높은 그들의 비용을 만들기에 오히려 도전 수 있습니다. 1990 년대에 camelids, 낙 타, 라마, alpacas를 포함 하 게, 전형적인 포유류 유형 면역 글로불린, 구조, 보유만 무거운 체인7에서 간단 하 게 면역 글로불린의 소설 형태 뿐만 아니라 발견 했다. 이러한 독특한 camelid 항 체 특히 높은 선호도와 외국 물질 바인딩할 같은 능력을 보유 하지만 이루어진 하나의 단백질 체인8. 또한, camelid 항 체도 작은 단위 VHH 조각, 단일 도메인 항 체9라고도 하 실험적으로 잘릴 수 있습니다. 그들의 작은 크기 때문에 단일 도메인 항 체 생물 의학 연구 응용 프로그램의 넓은 범위에 대 한 유용 하며 다양 한 학술 및 상업 소스1,10에서 사용할 수 있습니다. 예외 때문에 단일 도메인 항 체는 서쪽 오 점에 사용 되는 변성 조건에서 일반적으로 잃 었 나 란 종속 epitopes에 대 한 감독 더 자주 부 럽 것 처럼 보인다.

그들은 하나의 polypeptide 사슬 구성 되어, 이후 특정 단일 도메인 항 체 선정 고 쉽게 세균에 재조합 단백질 대량에서 생산 수 있습니다. 단일 도메인 항 체 특정 마커 또는 질병11진단에 대 한 "기자 그룹"으로 사용할 수 있는 태그를 포함 하도록 유전자 설계 수 있다 또한. 사용의 그들의 유연성과 함께 조작의이 용이성이 연구자와 다른 대학에 대 한 중요 한 자원을 단일 도메인 항 체 게.

건강의 국가 학회의 부분 코어 지원, 기존의 방법 alpacas3,4에서 단일 도메인 항 체 생산에 적응 되었습니다. Alpacas는 큰 camelid 가족 구성원 뿐만 아니라, 내게 필요한 옵션을 기준으로 처리의 두 용이성에 상당한 이점이 있다. Alpacas는 널리 섬유 및 고기 고 따라서에서 얻어질 수 있다 지역 로컬 알파 카 농부, 누가 자신의 웹사이트를 통해 또는 상태 종 축 협회를 통해 확인 될 수 있다. Alpacas의 두 유형이 사용할 수 있습니다, Huacaya 및 수리. Huacaya는 더 일반적이 고이 프로토콜에 대 한 사용 했다 하지만 프로토콜은 일반적으로 어느 품종에 적용 하 고 또한 더 널리 다른 camelids에 적용.

Protocol

모든 절차는 alpacas는 켄터키의 대학 기관 동물 관리 및 사용 위원회 (IACUC)에 의해 승인 (2017-2627 및 2018-2925) 프로토콜에 따라 수행 했다.

1. 항 원 특정 알파 카 항 체의 생성

  1. 알파 카 처리 및 일반 고려 사항
    1. 적절 한 기관 및 규제 승인을 얻을.
    2. 성인 alpacas을 얻기는 시체와 함께 10 세 미만 조건 적어도 3.0 (규모 1-5)12의 점수. 그들은 무리 동물 이기 때문에, 최소한 함께 두 하지만 가급적 3에 해당 하는 동물의 집.
      참고: 남성 때문에, 일반적으로, 그들은 보다 더 기질이 되며 함께 작동 하도록 쉽게 권장 됩니다.
    3. 다이어트, 주택, 예방 접종 및 기생충 제어 프로그램13의 검토를 포함 하 여 동물 시험을 통해 동물의 건강 상태를 확인 하십시오. 동물 예방 접종 전문 수의 권장 사항에 따라 로컬 지역에 적합 한 최신 인지 확인 합니다. 기원과 특정 지역 조건13의 무리의 역사의 검토에 따라 수 의사와 상담에서 외의-및 endoparasite 제어 프로그램을 개발 합니다.
    4. 적어도 1 주일에 대 한 순응, 훈련 및 구속에 노출 고삐 등.
    5. 사전 예방 접종 제어로 사용 하기 위해 혈 청을 얻기 위해 4 mL 혈액 샘플을 수집 (단계 1.4 참조). 세라를 동결 하 고 0.5 mL aliquots에-20 ° C에서 저장 합니다.
      참고: 이 시점에서 동물의 초기 상태를 모니터링 하는 완벽 한 혈액 세포 (CBC) 분석에 대 한 추가 혈액을 취할 수 있습니다.
  2. 항 원 준비
    1. 순화 된 단백질 항 원에 인산 염 버퍼 식 염 수 (PBS) 또는 HEPES 버퍼링 염 분 (HBS)을 준비 하 고 ≥1 mg/mL에 집중. 단백질의 약 3 밀리 그램 예방접종, 패닝, 그리고 클론의 확인을 포함 하 여 완전 한 프로토콜에 대 한 필요 합니다.
      참고: Camelid 항 체는 높은 특이성 및 단백질 항 원에 대 한 선택도 표시 하지만 일반적으로 잘 적합 구조화 단백질 또는 펩 티 드 항 일반적으로 구조화 되지 않은.
    2. 항 원 순도, 순도 설정 > 원하는 90%. SDS 페이지 등 분석 메서드를 사용 합니다.
      주의: 다른 단백질 중요 한 오염 발생할 수 있습니다 문제는 선택 하는 동안 단일 도메인 항 체 보다는 대상 단백질 오염 물질을 고립 하 게 될 수 있다.
    3. 항 원의 100 µ g의 총을 포함 하는 항 원의 언된 aliquots를 준비 합니다. 2 mg/mL 준비의 50 µ L에 이상적입니다. 1 mg/mL의 100 µ L은 예방 접종에 대 한 적합 한 가장 희석 단백질 솔루션 이다. 또는, 항 동결/동결 해제를 받을 수 없는 경우 솔루션 긴 기간에 안정 되어 있는 것으로 알려져 있다, 그것은 저장할 수 있습니다 4 ° c.에
      참고: 항 동결/해 동 주기를 받을 수 있도록 항 원의 20 µ L 약 수에는 얇은 적절 해야 테스트 PCR 튜브 및 액체 질소에서 냉동 벽으로. 튜브를 녹여, 고속 원심 분리를 수행 하 고 UV/VIS 흡수 냉동 전후를 비교 하 여 또는 SDS 페이지 젤을 실행 하 여 양적 복구를 확인 합니다. 경우, 항 생물 학적 활동의 보존에 대 한 테스트도 해야 합니다. 냉동 해 동 주기 성공 하면 나머지 항은 스냅 100 µ L aliquots에서 냉동 고-80 ° c.에 저장 냉동/해 동 주기 문제가 있다면 프로토콜 최대 20%의 추가 함께 반복 될 수 있다 글리세롤.
  3. 예방 접종
    1. 최대 5 개의 항 원, 200 µ g을 각각 혼합 1000 300 µ L 사이 마지막 양의 보조 제와 함께. 보조 희석제로 물을 사용 하 여 최종 볼륨의 50 %를 구성 한다.
      참고: 버퍼가 필요한 경우 사용 HEPES, MOPS, 또는 글리신. 5와 6 사이 pH 자주 엄격 하 게 중립 보다 더 유리한 것을 입증 했다. 그들은 응고를 자극 수 있기 때문에 시트르산, 인산 염 등 다 원자가 이온을 하지 마십시오.
    2. 어깨에서 어깨 노출 활 림프절에 인접 한 지역에 그것의 목의 기초에 따라 초승달 패턴에서 전기 면도기와 알파 카의 머리를 잘라.
    3. 알파 카 목을 잡고 천천히 22 G 바늘을 사용 하 여 활 림프절 근처 목 기지 따라 피하 항 원 주사. 5 주사 (또는 그) ~ 200 µ L의 수행 ~ 5 cm 떨어져.
      참고: 동물 주사 하는 동안 두 번째 직원에 의해 제 지 되어야 한다. 이후 그들은, 하는 경향이 그냥 뒤에서 하지만 옆으로 주입 및 alpacas 출혈 주의 대 한 호출 합니다. 절차 동안 그룹에서 서로 가까운 동물 데 최적입니다. 주어는 무리 동물, 그들은 그룹에서 조용한 고 덜 강력한 구속 절차 동안 필요 하다.
    4. 알레르기의 징후에 대 한 ~ 20 분 포스트 주입을 위해 동물을 모니터링 (단계 1.6 참조). 권장 되는 보조 제를 사용 하 여 때 예상 하지는 매주 주사 사이트에서 지역화 된 염증에 대 한 모니터. 주사의 사이트에서 혈액 누출 과도 한 인지 확인 합니다.
    5. 5 후속 증폭 주사 주간 혼합물에서 각 항의 100 µ g를 사용 하 여 수행 합니다. 사출 사이트에 머리를 자르기는 시즌에 따라 매주 필요할 수 있습니다. 가 겨울에 동물의 머리는 빠르게 성장할 수 있다.
  4. 혈액을 그리기
    1. 클립 컬렉션 사이트 알코올 면봉으로 소독 하 고.
    2. 목 직 립 개최와 직선 동물 부드럽게 제 지.
      참고: 동물은 비디오 에서처럼 수동으로 제 지 될 수 있습니다. 가능한 경우, 출혈 하는 동안은 alpacas을 억제 하는 알파 카 슈트의 사용 하 고 주사 처리를 쉽게 할 수 있습니다. 알파 카 슈트를 사용 하려면 haltered alpacas는 낙하산에 이르렀고 목 바, 빠른 출시와 함께 스트랩와 절제 된. 알파 카 슈트의 버전 상업용 공급 업체에서 사용할 수 있습니다.
    3. 복 부 과정을 그냥 중간 압력을 적용 하 여 정 맥을 가리고 랜드마크로는 척추의 가로 프로세스의 복 부 투영을 사용 하 여.
      참고: 성인 알파에 없는 독특한 jugular 밭 고 랑이 있다. 경 정 맥은 척추는 가로 프로세스의 복 부 계획에 의해 보호 됩니다. (예를 들어, 1 ㎝ 두께 "파이팅 플레이트" 남성에 목의 중간 1/3 이상)이 두꺼운 피부와 목 근육 어려운 시각화 또는 자체는 경 정 맥을 만져. 그 후, 척추 랜드마크의 사용은 jugular 위치에 대 한 가장 유용한 지표 이다.
    4. 약간 중간 45 ° 각도로 바늘을 삽입 (~ 손가락 폭) 목의 중심 방향으로 투영. 혈액 흐름까지 바늘을 조작 합니다.
      참고: 경 정 맥 및 경 동맥 서로 가까이 있습니다. 정 맥 혈액 꽤 색상에 붉은 수 있지만 여전히 동맥 혈 보다 더. 컬렉션에 따라 압력은 0.5-1에 대 한 사이트에 적용 되어야 합니다 분 (또는 더 긴 경우는 경 동맥에 액세스) hemostasis 안심 될 때까지.
    5. 분석 목적을 위한 4-10 mL의 혈액을 그립니다. 적절 한 크기의 주사기 또는 혈액 컬렉션 튜브 1.5 인치, 일반적으로에 20 G 바늘을 사용 합니다. 세포를 정화 하는 때 전체 혈액을 수집 하기 위해 라벤더 K2EDTA 튜브를 사용 합니다. 혈 청 생산을 위한 혈액 수집 하는 때 금 최고 혈 청 분리 관 (BD)을 활용 합니다.
    6. 50-100 mL의 생산 목적에 대 한 혈액을 그립니다. 19-20 G 날개 "나비" 주입 세트로 설정 추가 12 인치 주입 확장을 사용 합니다.
      참고: 확장 설정된 구성 컬렉션 바늘 안정화에 초점을 venipuncturist 수 있도록 여러 혈액 컬렉션 튜브를 채우기 위해 보조 수 있습니다. 주입 세트의 추가 (3-5 분 절차) 동물의 잠재적인 움직임을 수용 하 고 연산자에 대 한 편안한 작업 거리를 제공 합니다.
  5. 면역 감시
    1. 3 와 5 주사 후 3 ~ 4 일 테스트 세라를 각 동물에서 작은 테스트 화상 물림 재단을 수행 합니다. 동결 하 고 0.5 mL aliquots에는 세라를 저장 합니다. 위에서 설명한 대로 동물의 상태를 모니터링 하는 동시에 추가 혈액 샘플을 얻을.
    2. ELISA 미리 면역, 3 주 및 5 주 시간 지점에서 테스트 물림에서 얻은 혈 청을 사용 하 여 항 원 특정 항 체의 존재를 확인 합니다. 그것은 항 체 titer 여전히 증가 하는 동안 마지막 화상 물림 재단을 최고의입니다.
    3. 항 원 선호도 접시 표면 처리 96 잘 접시를 사용 하 여 생성 합니다. 100 m m 탄산 나트륨 버퍼, pH 9.0에서에서 항 원의 0.1 µ g을 희석. 각 잘을 솔루션의 100 µ L을 추가 하 고 하룻밤 4 ° c.에 품 어 각 항의 10 희석 복제본에서 테스트 합니다. 빈 컨트롤 잘만 탄산 버퍼 코팅 준비가 되어 있습니다.
    4. 야간 보육, 후 반전 우물의 내용을 제거 하 여 PBS, 0.1%의 0.1 mL로 세 번 세척 접시 트윈 20 (PBS-T).
    5. PBS-T에서 BSA (5 mg/mL)의 0.1 mL를 추가 하 고 실 온에서 1 h에 대 한 접시를 배양 하 여 우물을 차단.
    6. 세척 솔루션 우물에 pipetting 다음 접시의 반전에 의해 세척 솔루션을 제거 하 여 세 번 PBS-T와 접시를 씻어.
    7. 1/100, 및 최대 시작 희석을 사용 하 여 PBS T 버퍼에 미리 면역과 면역 세라의 각 두 배 직렬 희석 0.3 mL의 준비 1/102, 400.
    8. 우물에 각 희석의 100 µ L을 추가 하 고 실 온에서 2 h에 대 한 알을 품을 수 있도록.
    9. 각 우물에서 혈 청을 제거 하 고 0.2 mL PBS-T의 세 번 씻어.
    10. 품 어 각 1 시간에 대 한 1:20,000의 희석에 HRP 활용 된 염소 항 라마 IgG 항 체의 0.1 mL와 잘.
      참고: 측정 하는 면역 반응 모두 기존의 무거운 체인 유일한 항 체, 순환3,14에서 대략 동등한 비율에 있는 뿐만 아니라 포함 됩니다.
    11. 항 체 솔루션을 제거 하 고 씻어 각각 0.2 mL PBS-T의 세 번 잘.
    12. 잘 발 과산화 효소 기판의 100 µ L을 추가 하 고 두 높은 농도 포인트의 강도 될 포화, 일반적으로 5-10 분을 소요 때까지 실 온에서 품 어.
    13. 각 잘 반응을 중지를 0.1 m M 황산의 100 µ L를 추가 합니다.
    14. 각 450에서의 흡 광도 측정 nm 플레이트 리더를 사용 하 여.
    15. 함수 농도 흡수도 플롯 합니다.
  6. 알파 카 모니터링 하 고 잠재적인 합병증
    1. 확인 절차를 통해 모니터링 하는 적절 한 알파 카.
      참고: 절차 없는 상당한 부작용을 일으키는 것으로 예상 된다. 동물 복지 및 건강 모니터링 해야 합니다 수 매일 축산 및 연구 인력에 의해 먹이 물을 동안. Unalleviated 실험적으로 유도, 또는 자발적인 자연 사망률에 대 한 어떤 동물 든 지 해야 참조 될 평가 대 한 수의 서비스에서 적절 하 고, 자비 롭 안락사까지 제공 하는 여야와 필요한 경우.
      잠재적인 불리 한 결과 정와 관련 된 출혈, 멍이, 및 혈 종 있습니다. 동물 20 분 게시물 혈액 무승부 출혈의 징후에 대 한 보고 모니터링 해야 합니다. 사이트에 추가 압력을 사용 한다. 출혈이 멈추지 않으면, 수 의사 연락을 한다.
      다른 잠재적인 불리 한 결과 출혈 하 고 주사와 관련 된 육아 종 형성 및 염증 포함 됩니다. 육아 종 형성 되지 및 켄터키의 대학에서 관찰 되지 않는. 사출 사이트 염증 (빨갛게 또는 붓기) 발생할 수 있는 고 수 의사의 관심을 끌게 한다. 생산 출혈, 혈액의 중요 한 볼륨을 나타냅니다 그리고 동물 들은 안정적이 고 적극적인 혈액 컬렉션 후 보장을 모니터링 해야 합니다.
      알레르기 및 화성 응답 두 개의 가장 가능성이 심각한 불리 한 결과, 하지만 매우 드물게 관찰 된다. 그것은 발생 했다, 알레르기 항 원 주사 직후 발생 하 고 직장 온도, 약점, 구 토, 호흡 곤란, 또는 설사의 증가 의해 각 성. 직장 온도 체온에 있는 증가 감지 하 각 주입 후 모니터링할 수 있습니다. 이 인식, 상담에 대 한 즉시 수 의사를 게 알립니다. 또한,는 비상 "충돌 키트" (예를 들어, 피 네 프 린, 코르 티 코 스테로이드, 그리고 항히스타민제) 수 의사와 상담에 불리 한 반응을의 의심 하는 동물 치료를 사용할 수 있어야.

2. 단일 도메인 항 체 도서관 건축을 위한 세포 정화

  1. 혈액의 50 mL (단계 1.4 참조) 마지막 주사 후 3 ~ 5 일을 수집 합니다.
    참고: 혈액의 신속한 처리 및 RNA의 격리 얻을 적당 한 라이브러리 크기15,3, 패닝의 성공을 위해 매우 중요 하다 중요 하다.
  2. PBS의 5 mL와 함께 수집 된 혈액의 15 mL를 희석.
  3. 림프 구 분리 튜브 제조 제안에 따라 밀도 그라데이션 원심 분리에 의해 주변 혈액 림프 톨 (PBLs)을 활용 합니다.
    주의: 제조업체의 지침에 따라 혈액의 25 mL까지 사용할 수 있습니다, 하지만이 시스템을 포화 수 있으며 깨끗 한 림프 구 준비 취득 방지를 나타냅니다.
  4. PBL 4 ° C에 prechilled PBS의 5 mL를 추가 합니다.
  5. 4 ° c.에 800 x g 20 분에 대 한 회전
  6. PBL 4 ° c.에 800 x g 에서 20 분 동안 원심 분리 뒤에 4 ° C에 prechilled PBS의 5 mL을 추가 하 여 두 번 씻어
  7. 제조업체의 지침에 따라 스핀-열 기반 시스템을 사용 하 여 총 RNA 격리. Vertexing 적절 한 버퍼에 biopolymer 분쇄 시스템에 적용 하 여 셀을 균질. 미니 또는 맥시-열 입력 셀에 따라 적절 한 수를 사용 합니다.
  8. CDNA 결합 하 여 RNA의 10 µ g 올리고 (dT)의 0.1 µ g의 혼합 12 18 뇌관 역전사를 사용 하 여 음성 합성.
  9. 살 균 소 도서관 설립된 방법4를 사용 하 여 생성 합니다. 살 균 소 디스플레이 벡터 pMES4 융합 유전자 III 페이지 솔루션의 생산을 위한 filamentous 페이지의 삽입 식으로 뒤에 금지 효소로 복제 해야 합니다.

3. 단일 도메인 항 체 이동

  1. 항 원 선호도 접시 표면 처리 96 잘 접시를 사용 하 여 생성 합니다. 100 m m 탄산 나트륨 버퍼, pH 9.0에서에서 항 원의 0.25 µ g을 희석. 각 잘에이 솔루션의 100 µ L을 추가 하 고 하룻밤 4 ° c.에 품 어 항 원 당 두 웰 스 코트. 빈 컨트롤 잘 탄산 버퍼만 코팅을 준비 합니다.
    참고: 플레이트 생산 고 선택의 여러 라운드를 수행 됩니다 경우 4 ° C에서 최대 1 주일까지 저장 될 수 있습니다. 또한,이 메서드는 다른 방법 사용 biotinylation 또는 전략 라벨의 라벨을 필요 하지 않는 직접 흡수를 활용 합니다.
  2. 접시를 밤새 품 어. 우물의 내용을 제거 하 고 씻어 세 번 0.1 mL PBS-t를 반전합니다
  3. PBS에서 BSA (20 mg/mL)의 0.1 mL를 추가 하 고 실 온에서 2 h에 대 한 접시를 배양 하 여 우물을 차단.
  4. PBS-T 뒤에 세 번 PBS를 가진 접시 세 번 씻어. 항 수 또한 covalently 표시 되며 캡처 시스템, 예를 들어 streptavidin/biotin 시스템에에서 사용.
  5. 전 40 mg/mL의 BSA PBS에서 30 분 동안 실내 온도에 진동 플랫폼에서 100 µ L로 살 균 소 솔루션 (100 µ L)를 취급 합니다.
  6. 항 원에 살 균 소 솔루션 웰 스 코팅 및 실 온에서 2 h에 대 한 부드러운 교 반으로 품 어 추가 합니다. 여러 개의 우물을 사용 하 여 각 항 원에 대 한 1011 페이지의 총 수 있도록.
  7. 반전 하 여 언바운드 페이지를 삭제 하 고 5 번 PBS-T 다음 5 번 PBS의 200 µ L로 우물을 씻어.
  8. PBS와 700 rpm에서 진동 플랫폼에 실 온에서 30 분 동안 잠복기에 트립 신 0.25 mg/mL의 0.1 mL를 추가 하 여 바운드 페이지 elute.
  9. 트립 신 활동을 풀기 위해 4 mg/mL 4-benzenesulfonyl 불 소 hydrochloride(AEBSF) 솔루션의 5 µ L을 포함 하는 유리병에 솔루션을 전송 합니다.
  10. OD600 까지 떨고와 37 ° C에서 TG1 파지 디스플레이 유능한 세포 성장 = 0.5.
  11. TG1 셀 3 mL에 eluted 살 균 소의 50 µ L를 추가 합니다.
  12. 37 ° C에서 30 분 동안 흔들어 없이 품 어.
  13. 100 µ g/mL 암 피 실린, 2% 포도 당으로 보충 하는 파운드 미디어의 7 mL를 추가 합니다.
  14. 37 ° c.에서 밤새 흔들어
    참고: 가장 다양 한 단일 도메인 항 체를, 클론 시퀀싱, 원하는 속성에 대 한 테스트 고 패닝의 한 라운드 후 활용. 높은 선호도 단일 도메인 항 체를 얻기 위해 이동 하는 2 라운드를 활용 합니다.
  15. 파운드 한 천 배지에서 하룻밤 성장 100 µ g/mL 암 피 실린, 2% 포도 당으로 보충 후 박테리아를 접시. 여러 직렬 희석 해야 합니다 테스트 2 희석 시작, 1/10000, 1의 100 µ L를 도금/100000 희석.
  16. 37 ° c.에 하룻밤 접시를 품 어
  17. 식민지를 선택 하 고 2XYT 100 µ g/mL 암 피 실린, 2% 포도 당, 잘 당 10 %v / v 글리세롤의 100 µ L를 포함 살 균 96 잘 접시의 우물을 예방.
  18. 동요 하지 않고 37 ° C에서 하룻밤를 품 어.
  19. 다음 날, 60 분 동안 37 ° C에서 170 rpm에 흔들.
  20. PCR 튜브 미디어의 2 µ L을 제거 합니다. 나머지 솔루션 수 수는 접시에 남아 1-2 일 동안 4 ° C에서 저장 또는 냉동 저장 및 나중에 사용-80 ° C에.
  21. 벡터 활용에 대 한 적절 한 뇌관을 사용 하 여 PCR 반응을 수행 합니다. 여러 복제 사이트 측면 긍정적인 클론 사용 뇌관의 PCR 검사는 pMES4, CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC 및 GGTGGTGTGAGGAGACGGTGACCTG. 중 합 효소 사용, 57 ° C 그리고 30 사이클의 어 닐 링 온도 사이클링 조건을 적절 한 활용.
  22. 1% (w/v) agarose 젤을 실행 하 여 PCR 반응 분석. 긍정적인 식민지 ~ 500의 단일 도메인 항 체 유전자 삽입 해야 bp. 긍정적인 클론 샘플의 20-50%는 확인 하십시오.
    참고: 이 메서드는 복제에 대 한 선택 및 분석 대부분 연구 실험실에서 수행할 수 있는 수단을 제공 합니다. 또는 다음-세대 시퀀싱 적용 될 수 있다 하 고 통계 및 비교 분석16을 허용 하는 큰 데이터 집합을 제공 합니다.
  23. 신선한 튜브 100 µ g/mL 암 피 실린과 파운드의 7 mL를 포함 하는 접시에서 긍정적인 클론을 예방.
  24. 37 ° c.에 하룻밤을 위해 동요와 성장
  25. 플라스 미드 DNA를 문화에는 miniprep를 수행 합니다.
  26. 긍정적인 복제품 뇌관 pEX-레 브 (CAGGCTTTACACTTTATGCTTCCGGC)을 시퀀싱 하는 표준을 사용 하 여 시퀀스.
  27. 결과 시퀀스를 단일 도메인 항 체에 전산 분석을 수행 합니다. 아니 정지 codons 또는 프레임 이동 확인 하십시오.
  28. 결과 시퀀스 유사성과 다양성에 대 한 분류. 반복적으로 식별 되는 순서는 가장 선택의 2 라운드 후 특히 높은 친 화력 바인딩 시퀀스를 될 것 이다.
  29. 익스프레스 BL21 파생 식 스트레인의를 사용 하 여 단일 도메인 항 체 E. 코일. 22 ° c.에 하룻밤 성장 IPTG의 추가 통해 식 유도
  30. 고정된 금속 친화성 크로마토그래피 (IMAC)을 사용 하 여 단일 도메인 항 체 정화.
  31. 풀 다운, 기본 젤 전기 이동 법, ELISA 등 직접 상호 작용 분석 결과 사용 하 여 단일 도메인 항 체/항 원 바인딩을 확인 합니다.
  32. 특정 실험에 대 한 원하는 대로 응용 프로그램 관련 단일 도메인 항 체 성능을 확인 합니다.

Representative Results

여기에 제시 된 프로토콜은 다양 한 단백질 항 원에 대 한 단일 도메인 항 체를 생성 하기 위해 이용 되었다. 5 항 알파 카 당 활용 했다. 면역 감시 표시 대부분의 항 원 3 주 (그림 1)에서 시작 하는 강력한 응답을 보였다. 생산 물림 및 도서관 건설 후 약 6 주 제공 동물에 대 한 최고의 균형을 여러 항 원을 주입 있다. 이동 하는 2 라운드 각 항 원에 대 한 수행 되었고 고립 된 식민지 상영 (그림 2). 긍정적인 식민지의 시퀀싱 다른 항 원에 대 한 다양 한 단일 도메인 항 체 시퀀스를 식별합니다. 예를 들면, 3 개의 독특한 클론 참조 항 원 맥 아당 의무적인 단백질 (MBP) (그림 3A)에 격리 했다. 자주 관찰 단일 도메인 항 체에는 중요 한 순서 성과 높은 변수 CDR3 길이 (그림 3) 포함 되어 있습니다. 이러한 기능은 단일 도메인 기준 단일 도메인 항 체/CX3CL1 복잡 한17 (그림 3B)에서 본 항 체/항 원 상호 작용에 특히 중요 하다.

전체 길이 단일 도메인 항 체 시퀀스의 대부분 표현 하 고 1-10 mg/l의 문화 (그림 4A) 정화 수 있습니다. CDR3 길이에 다양성 때문에 서로 다른 단일 도메인 항 체 분자량에 약간의 변화를 보여줍니다. 직접 바인딩 및 응용 프로그램 특정 성능 확인이 중요 합니다. 예를 들어 2 라운드 후 항 원 B에 대 한 선택의, 단일 도메인 항 체 되었다 위원 확인 (그림 2). 여러 개의 동일한 시퀀스 확인 되었다, 그리고 단일 도메인 항 체 생성 하 고 정화 되었다. 다음 항 원 친화성 수 지 다운 직접 풀을 통해 테스트 되었고 강력한 복용량 의존 바인딩 (그림 4B)를 보였다. 중요 한 것은, 단일 도메인 항 체 수 지 제어에 대 한 바인딩을 보였다. 이러한 데이터는 직접 바인딩 상호 작용, 그리고 선호도 캡처 풀 다운 및 ELISA 기반 형식에 적합 한 보여 줍니다.

Figure 1
그림 1 : 두 가지 항 원 같은 동물에 별개의 항 원에 중요 한 특정 면역 응답을 보여주는 대표적인 면역 모니터링. 많은 항 원 면역, 6 주 후 최대한 응답을 보여주는 대부분 개시 후 3 주 일찍 강력한 응답을 표시 합니다. 6 주 또한 친 화력 성숙 가능 하며 생산 도련 및 B 세포 격리에 대 한 권장된 시간 이다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2 : 긍정적인 클론의 PCR 기반 확인. 뇌관 스팬 pMES4 벡터의 MCS 및 긍정적인 nanobody 복제 생산 하는 amplicon ~ 500의 bp (으로 표시 된 *). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3 : 알파 카 단일 도메인 항 체 다양성을 강조 하는 항 원 특정 시퀀스. (A) 참조 단일 도메인 항 체 4XT1, 프레임 워크와 complementarity 결정 영역 (Kabat) 아래 강조 MBP 격리 선택 단일 도메인 항 체 시퀀스의 맞춤입니다. (B) 구조 알파 카 단일 도메인 항 체 4XT1의 CX3CL1에 바인딩된 (PDB 4XT1), 특정 항 원 바인딩에서 루프 변수 CDR의 중요 한 역할을 강조. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4 : 정화 및 단일 도메인 항 체의 유효성 검사. (A) SDS-페이지 아이맥 정화 단일 도메인 항 체의 다양 한 단일 도메인 항 체 비교. 다른 분자 무게는 주로 CDR3 루프의 다양 한 길이 되어야 한다. 단일 도메인 항 체 순화 된 단백질의 불 쌍 한 수확량을 보여주는의 소수 식의 다른 레벨도 관찰 된다. (B) 항 원 선호도 풀 다운 메뉴를 사용 하 여 직접 바인딩의 확인. 강력한 복용량 의존 단일 도메인 항 체 바인딩은 항 원 결합 수 지만 수 지 제어 하지 관찰 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Discussion

앞에서 언급 했 듯이, 높은 선호도 안정성, 손쉬운 식와 결합 하 여 단일 도메인 항 체의 특이성 있도록 응용 프로그램에 대 한 이상적인 시 약, 생물 의학 연구에 중요 한 생 화 확 적인 시 약, 진단 도구로 또는 치료제18. 상용 응용을 위해 고려해 야 하는 몇 가지 문제 지적에 관련된 속성이 있다. 또한, 단일 도메인 항 체 특정 마커 또는 세포질 분석 실험 또는 진단에 기자로 사용할 수 있는 태그를 포함 하도록 설계 될 수 있다. 이러한 사용의 핵심 관심의 항 원에 대하여 특정 단일 도메인 항 체를 생산 하는 능력 이다. 메서드 설명 여기 alpacas를 사용 하 여 단일 도메인 항 체를 생산 하는 다양 한 단백질 항 원에 대 한 강력한 면역 반응을 생산 합니다. 동물 처리 및 규정 준수에 대 한 고려 사항은 설명 합니다. 이 프로세스의이 부분에서 성공 위한 핵심입니다.

예방 접종, 필요 하지 않지만 대신 선택 및 선호도19,20의 반복 최적화에 대 한 다른 시스템과 semisynthetic 라이브러리를 사용 하는 단일 도메인 항 체 생산을 위한 다른 전략 . 그러나, 면역된 동물에서 파생 된 라이브러리를 사용 하 여 장점은 안정적으로 높은 농축 하 고, 다양 한, 그리고 높은 선호도 단일 도메인 항 체를 분리 하는 기능입니다. 또한, 뿐만 아니라 중요 한 순서 변이 관찰 된다, 하지만 특정 단일 도메인 항 체 분리의 상당한 대다수 CDR3에 특히 독특한 삽입 및 삭제을 했다.

추가, 단일 도메인 항 체만 항 원, 그리고이 과정 후 작은 주사를 필요로 하는 간단한 과정을 통해 생성 될 수 있다, 동물 무리 반환 될 수 있습니다. 메모의, 동물 섬유 생산을 위해 자유롭게 사용 될 수 있습니다 하지만 단일 도메인 항 체 생산을 위한 테스트 항 및 비 FDA 승인 된 보조의 사용으로 인해 고기 (인간 먹이 사슬)으로 사용에서 제외 해야 합니다. 프로시저가 완료 되 면 동물 최종 수의 시험을 주어진 1 주 동안 모니터링 해야 고 수 수 중 그들의 가정 농장에 반환 또는 단일 도메인 항 체 생산의 또 다른 라운드 전에 6 개월 동안 휴식.

Disclosures

박사 Whiteheart와 허 켄터키의 대학에는 단일 도메인에 대 한 서비스 요금으로 알파 카에 항 체를 생산 하는 분자 의학 센터에서 핵심 운영.

Acknowledgments

이 작품은 건강의 국가 학회 (P30GM103486)에 의해 지원 되었다.

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Alpacas (<em>라마 pacos</em>) 단백질 항 원 및 항 원 특정 단일 도메인 항 체의 생산의 면역
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter