Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Biochemistry

Immunisering av alpackor (Lama pacos) med proteinantigener och produktion av Antigen-specifika enda domän antikroppar

doi: 10.3791/58471 Published: January 26, 2019

Summary

En metod för framställning av enda domän antikroppar från alpackor, inklusive immunisering, blodinsamling, B-cell isolering och urval är beskrivna.

Abstract

I detta manuskript, är en metod för immunisering av alpacka och molekylärbiologiska metoder producera antigen-specifika enda domän antikroppar beskrivs och visat. Kameldjur, har såsom alpackor och lamor, blivit en värdefull resurs för biomedicinsk forskning eftersom de producerar en ny typ av tunga kedja-bara antikroppar som kan användas för att producera enstaka domän antikroppar. Eftersom immunförsvaret är mycket flexibel, kan enkel domän antikroppar göras till många olika proteinantigener, och även olika konformationer av antigenet, med en mycket hög grad av specificitet. Dessa funktioner, bland annat gör enda domän antikroppar ett ovärderligt verktyg för biomedicinsk forskning. En metod för framställning av enda domän antikroppar från alpackor rapporteras. Ett protokoll för immunisering, blodinsamling och B-cell isolering beskrivs. B-cellerna används för byggande av en immuniserade bibliotek, som används i valet av specifika enda domän antikroppar via panorering. Förmodad specifika enda domän antikroppar erhållits via panorering bekräftas av pull-down, ELISA eller gel-shift analyser. De resulterande enda domän-antikropparna kan sedan användas antingen direkt eller som en del av en konstruerad reagens. Användningar av enda domän antikropp och enda domän antikroppsbaserade regents omfatta strukturella, biokemiska, cellulär, in vivo, och terapeutiska tillämpningar. Enda domän antikroppar kan produceras i stora mängder rekombinanta proteiner i prokaryota uttryck system, renat, och använda direkt eller kan vara konstruerad för att innehålla specifika markörer eller taggar som kan användas som reportrar i cellulära studier eller i diagnostik.

Introduction

Alpackor och andra medlemmar av familjen kameldjur, har blivit en populär källa för att skapa antikroppar för biomedicinsk forskning1,2,3. Kameldjur har ett unikt immunsystem genom att de producerar både normala antikroppar samt tung-kedjan bara antikroppar som gör att produktionen av mycket mindre enda domän antikroppar, bibehållen hög specificitet och hög affinitet. Kameldjur antikroppar ger därmed, en mångsidig reagens som är användbara för olika ändamål. Här beskrivs en metod för att vaccinera alpacka och producera enda domän antikroppar mot en mängd proteinantigener. Dessa antikroppar kan produceras i kameldjur via en relativt enkel process som endast kräver immunisering via små injektioner av målproteinet (antigen) och blod draw4. Därefter används bibliotek konstruktion, M13 phage display5 och panorering kontra den rekombinanta antigen6 för att isolera och enda domän antikroppar med de önskade egenskaperna. Eftersom processen tar fördel av kraften i phage displayteknik, fem eller fler antigener kan utnyttjas samtidigt per djur, vilket minskar antalet djur som används och tillhörande kostnader.

Typiska däggdjurs antikroppar eller immunoglobuliner är stora molekyler som består av två typer av kedjor (2 tunga kedjor och 2 lätta kedjor), som är sammankopplade genom disulfide obligationer. Dessa antikroppar är relativt stor, uppvisar molekylvikter av ~ 140-190 kDa för rikligare IgG arter från människor, möss, getter och kaniner. På grund av deras flera subenhet struktur, hög molekylvikt och disulfide obligationer, kan immunglobuliner vara ganska utmanande att producera i stora kvantiteter, gör deras höga kostnad. På 90-talet upptäcktes det att kameldjur, som inkluderar kameler, lamor och alpackor göra, förutom den typiska däggdjur typ immunglobulin, en ny form av immunglobulin som är enklare i struktur, som har endast tunga kedjor7. Dessa unika kameldjur antikroppar ha samma förmåga till specifikt binder främmande ämnen med hög affinitet men endast består av ett protein kedjan8. Dessutom kan kameldjur antikroppar trunkeras experimentellt till en ännu mindre enhet VHH fragment, även kallad en enda domän antikropp9. På grund av sin storlek, domän antikroppar är användbara för ett brett användningsområde biomedicinsk forskning och är tillgängliga från en mängd olika akademiska och kommersiella källor1,10. Ett undantag verkar vara Western blotting eftersom enda domän antikroppar riktas oftare mot konformation beroende epitoper, som vanligtvis försvinner de denatureringen villkor som används i Western blotting.

Eftersom de består av en enda polypeptidkedja, kan specifika enda domän antikroppar väljas och enkelt produceras i stora mängder som rekombinanta proteiner i bakterier. Enda domän antikroppar kan också vara genetiskt konstruerade för att innehålla specifika markörer eller taggar som kan användas som ”reporter grupper” för att diagnostisera sjukdomar11. Denna användarvänlighet manipulation i kombination med deras flexibilitet att använda antikroppar enda domän en viktig resurs för forskare på universiteten och annorstädes.

Som en del av en National Institutes of Health stöds core, har befintliga metoder anpassats till producera enda domän antikroppar från alpackor3,4. Alpackor har betydande fördelar i både enkel hantering i förhållande till större kameldjur familjemedlemmar samt tillgänglighet. Alpackor höjs kraftigt för fiber och kött och således kan erhållas regionalt från lokala alpacka bönder, som kan identifieras genom sina webbplatser eller genom staten uppfödare föreningar. Det finns två raser av alpackor, Suri och Huacaya. Huacaya är vanligare och användes för detta protokoll, men protokollet är allmänt tillämpliga på antingen raser och även mer allmänt tillämpliga på andra kameldjur.

Protocol

Alla förfaranden med alpackor utfördes i enlighet med protokoll (2017-2627 och 2018-2925) godkänd av University of Kentuckys institutionella djur vård och användning kommittén (IACUC).

1. generering av Antigen-specifika alpacka antikroppar

  1. Alpacka hantering och allmänna överväganden
    1. Skaffa lämpliga institutionella och föreskrivande godkännande.
    2. Få vuxna alpackor, mindre än 10 år med en kropp villkor score minst 3,0 (skala 1-5)12. Eftersom de är flockdjur, hus minst två men helst tre djur tillsammans.
      Obs: Män rekommenderas eftersom, i allmänhet, de har en jämnare temperament och är lättare att arbeta med.
    3. Kontrollera hälsotillståndet hos djur genom en veterinärundersökning samt se över kosten, bostäder, vaccination och parasit kontroll program13. Se till att djuren är uppdaterade med vaccinationer lämpliga till lokala geografiska regionen baserat på professionella veterinära rekommendationer. Utveckla ett program med EKTO- och endoparasite kontroll i samråd med en veterinär som baserat på en genomgång av historien av ursprungsbesättningen och särskilda lokala villkor13.
    4. Acklimatisera sig för minst en vecka, inklusive grimma utbildning och exponering för återhållsamhet.
    5. Samla 4 mL blodprov för att få serum för användning som före immunisering kontroll (se steg 1.4). Frysa sera och förvaras vid-20 ° C i 0,5 mL portioner.
      Obs: Vid denna tid, kan ytterligare blod tas för en komplett blodkroppar (CBC) analys för att övervaka djurens ursprungliga hälsostatus.
  2. Antigen förberedelse
    1. Förbereda renat proteinantigener i fosfatbuffrad koksaltlösning (PBS) eller HEPES-buffrad koksaltlösning (HBS) och koncentrera ≥ 1 mg/ml. Cirka 3 mg protein behövs för komplett protokollet, inklusive immunisering, panorering och bekräftelse av kloner.
      Obs: Kameldjur antikroppar visar hög specificitet och selektivitet mot proteinantigener men generellt är inte väl lämpade för ostrukturerade proteiner eller peptid antigener som är allmänt ostrukturerad.
    2. Upprätta antigen renhet, med renhet > 90% önskas. Utnyttja en analysmetod såsom SDS-PAGE.
      Varning: Betydande förorening med andra proteiner kan leda till problem under valet där enda domän antikroppar kan isoleras till föroreningar i stället för målproteinet.
    3. Förbereda fryst alikvoter av antigen som innehåller sammanlagt 100 µg antigen. 50 µL av en 2 mg/mL beredning är perfekt. 100 µL av 1 mg/mL är den mest spädda protein lösningen som är lämplig för immunisering. Alternativt, om antigenet kan inte genomgå frysas och tinas och är kända för att vara stabil i lösning långsiktigt, det kan lagras vid 4 ° C.
      Obs: För att säkerställa antigenet kan genomgå en frysning/upptining cykel, muromgärdade test en 20 µL alikvot av antigenet bör sprutas in i en tunn PCR-röret och snap fryst i flytande kväve. Tina upp röret, utföra hög hastighet centrifugering och verifierar den kvantitativa återhämtningen genom att jämföra UV/VIS absorption före och efter frysning eller genom att köra en SDS-PAGE gel. Om möjligt bör antigenet också testas för kvarhållandet av biologisk aktivitet. Om cykelns frysa Tina lyckas är återstående antigenet kick frysta i 100 µL portioner och lagras vid-80 ° C. Om det finns problem med frysning/upptining cykel, protokollet kan upprepas med tillägg av upp till 20% glycerol.
  3. Immunisering
    1. Blanda upp till fem antigener, 200 µg varje, med adjuvant i en slutlig volym av mellan 300 till 1000 µL. Adjuvans bör utgöra ≥50% av den slutliga volymen som använder vatten som spädningsvätska.
      Obs: Om buffert är nödvändigt, Använd HEPES, moppar eller glycin. Ett pH-värde mellan 5 och 6 har ofta visat sig vara mer gynnsam än strikt neutral. Undvika polyvalenta joner såsom fosfat eller citrat, eftersom de kan framkalla koagulering.
    2. Trimma den alpaca hår med elektriska hårklippningsmaskiner, i en månskära mönster längs basen av dess hals från Axel till Axel att exponera regionerna som gränsar till fören lymfkörtlarna.
    3. Håll alpacka halsen och injicera långsamt antigenet subkutant längs basen av halsen nära fören lymfkörtlar med hjälp av en 22 G nål. Utför fem injektioner på ~ 200 µL (eller mindre) ~ 5 cm mellanrum.
      Obs: Djuren bör hållas tillbaka av en andra anställd under injektionerna. Injektionen och blödning alpackor kräver försiktighet eftersom de inte är benägna att sparka, bara bakifrån men i sidled. Att ha djuren nära varandra, i en grupp, under förfaranden som är optimal. Med tanke på att de är flockdjur, de är lugnare i en grupp och mindre kraftfullt återhållsamhet behövs under förfarandena.
    4. Övervaka djuren för ~ 20 min efter injektionen för tecken på anafylaxi (se steg 1.6). Monitor för lokaliserad inflammation vid injektionsställe varje vecka, vilket inte beräknas när du använder de rekommenderade adjuvant. Se till att blod läckan från injektionsstället inte överdriven.
    5. Utför fem efterföljande öka injektioner varje vecka använder 100 µg varje antigen i blandningen. Klippning hår på injektionsställena kanske krävs varje vecka beroende på säsong. Under höst och vinter, kan djurens hår växa snabbt.
  4. Rita blod
    1. Klipp och desinficera den samling webbplatsen med spritkompresser.
    2. Hindra djuret försiktigt med nacken hålls upprätt och rak.
      Obs: Djur kan vara återhållsamma manuellt som demonstreras i videon. Om tillgängligt, använda en alpacka ränna för att hindra alpackor under blödning och injektioner kan underlätta hantering. För att använda en alpacka ränna, haltered alpackor leds in banan och återhållsam med hals barer och remmar med snabba releaser. Versioner av alpacka banan finns från kommersiella leverantörer.
    3. Använda den ventrala projektionen av den tvärgående processen av Kotor som ett landmärke, Täpp venen genom att tillämpa tryck bara mediala till ventrala processen.
      Obs: Det finns inga distinkta jugular fåra i vuxen alpacka. Jugular venerna skyddas av ventrala projektioner av de tvärgående vertebrala processerna. Denna tjocka hud (t.ex. 1 cm tjocka ”fighting plattan” över den mellersta 1/3 av halsen hos män) och hals muskulatur gör det svårt att visualisera eller palpera halsvenen själv. Därefter är användning av vertebrala sevärdheter de mest användbara indikatorerna för jugular läge.
    4. Stick in nålen i 45° vinkel något mediala (~ finger bredd) till projektionen mot mitten av nacken. Manipulera nålen tills de blod rinner.
      Obs: De halsvenen och halspulsådern är nära varandra. Venöst blod kan vara ganska röd i färgen men är fortfarande mörkare än arteriellt blod. Efter insamling, trycket bör tillämpas på webbplatsen för 0,5-1 min (eller längre om halspulsådern nås) tills hemostas är säkrad.
    5. Dra 4-10 mL blod för analytiska ändamål. Utnyttja en 1,5 tums, 20 G nål vanligtvis i samband med en lämplig storlek spruta eller bloduppsamlingsrör. Utnyttja lavendel topp K2EDTA rör för samlande av helblod när renande lymfocyter. Utnyttja gold top serum separation rör (BD) när samla blod för serum produktion.
    6. Dra 50-100 mL blod för produktionsändamål. Använd filnamnstillägget ytterligare 12-tums infusion set med ett 19-20 G bevingade ”butterfly” infusionsset.
      Obs: En förlängning set konfiguration tillåter en assistent att fylla flera blod insamling rör, så att venipuncturist att fokusera på att stabilisera samling nålen. Tillägg av infusionssetet rymmer potentiella rörlighet av djuret (3-5 min förfarande) och ger en bekväm arbetsavstånd för operatörerna.
  5. Immun övervakning
    1. Tre till fyra dagar efter 3rd och 5th injektioner, utföra ett litet test utfall från varje djur att få sera för testning. Frysa och lagra sera i 0,5 mL alikvoter. Erhålla ytterligare blodprover samtidigt att övervaka hälsan hos djuret, som diskuterats ovan.
    2. Bekräfta förekomsten av antigen-specifika antikroppar med ELISA använder sera erhållits från test utfall före immun, tre veckor och fem veckors tidpunkter. Det är bäst att ta ett sista utfall medan antikropp titern ökar fortfarande.
    3. Generera antigen affinitet plattor använder surface behandlade 96 brunnar. Späd 0.1 µg av antigen i 100 mM natriumkarbonat buffert, pH 9,0. Tillsätt 100 µL av lösningen till varje brunn och inkubera över natten vid 4 ° C. Tio utspädningar av varje antigen testas i duplikat. Ett blankprov är väl förberedda som är belagd med karbonat buffert endast.
    4. Efter den natten inkubationen, vänd på plattan för att ta bort innehållet i brunnarna och tvätta tre gånger med 0,1 mL PBS, 0,1% Tween-20 (PBS-T).
    5. Blockera brunnarna genom att tillsätta 0,1 mL av BSA (5 mg/mL) i PBS-T och ruvning plattan för 1 h i rumstemperatur.
    6. Tvätta plattan tre gånger med PBS-T genom pipettering tvättlösningen i brunnen och därefter avlägsna tvättlösningen genom inversionen av plattan.
    7. Förbereda tvåfaldiga seriella utspädningar av 0,3 mL varje pre immun- och immunsystem sera i PBS-T buffert med en start utspädning av 1/100, och upp till 1/102, 400.
    8. Tillsätt 100 µL av varje utspädning till brunnarna och låt Inkubera i 2 h i rumstemperatur.
    9. Ta bort serumet från varje brunn och tvätta med 0,2 mL PBS-T tre gånger.
    10. Inkubera vart bra med 0,1 mL av HRP-konjugerad get anti lamadjur IgG-antikropp vid en spädning av 1:20,000 för 1 h.
      Obs: Immunsvaret mätt omfattar både konventionella samt tung-kedjan bara antikroppar som är närvarande i ungefär lika proportioner i omsättning3,14.
    11. Ta bort antikropp lösningen och tvätta varje brunn med 0,2 mL PBS-T tre gånger.
    12. Tillsätt 100 µL av kromogen peroxidas substrat till brunnen och odla i rumstemperatur tills intensiteten av de två högsta koncentration punkterna har blivit mättad, vilket tar 5-10 min.
    13. Tillsätt 100 µL 0,1 M svavelsyra till varje brunn för att stoppa reaktionen.
    14. Mät absorbansen hos varje brunn vid 450 nm med en spektrofotometer.
    15. Rita absorbansen som en funktion koncentration.
  6. Alpacka övervakning och potentiella komplikationer
    1. Säkerställa lämplig alpacka övervakning under hela förfarandet.
      Obs: Förfaranden som förväntas inte ha betydande negativa effekter. Djurens välbefinnande och hälsa bör kontrolleras dagligen av djurhållning och/eller forskning personal under utfodring och vattning. Alla djur med unalleviated experimentellt inducerad eller spontan naturlig sjuklighet bör remitteras för utvärdering veterinärmyndigheter med behandling(ar) som tillhandahålls i förekommande upp till humana eutanasi, om det behövs.
      Potentiella negativa konsekvenser i samband med flebotomi är blödning, blåmärken och hematom. Djuren bör övervakas för 20 min post blodprov att leta efter tecken på blödning. Ytterligare tryck på webbplatser bör användas. Om blödningen inte slutar, bör en veterinär kontaktas.
      Andra potentiella negativa konsekvenser i samband med injektioner och blödning inkluderar granulombildning och inflammation. Granulombildning förväntas inte och har inte observerats vid University of Kentucky. Injektion webbplats inflammation (rodnad eller svullnad) kan inträffa och bör föras till en veterinär. Produktion utfallet representerar en potentiellt betydande volym av blod, och djuren ska övervakas för att försäkra att de är stabila och aktiva efter blodinsamling.
      Anafylaxi och pyrogent svaren är de två mest sannolika allvarliga negativa konsekvenserna, men observeras mycket sällan. Om det skulle inträffa, anafylaxi skulle inträffa strax efter antigen injektionerna och manifesteras av en ökad rektaltemperatur, svaghet, kräkningar, andningsbesvär eller diarré. Rektal temperatur kan övervakas efter varje injektion för att upptäcka någon ökning i kroppstemperatur. Om dessa redovisas, meddela en veterinär omedelbart för en konsultation. Dessutom bör en ”Crash Nödkit” (t.ex. epinefrin, kortikosteroider och antihistamin) utarbetats i samråd med en veterinär vara tillgängliga för att behandla djur som misstänks ha en biverkning.

2. renande lymfocyter för enda domän antikropp bibliotek konstruktion

  1. Samla 50 mL blod tre till fem dagar efter den sista injektionen (se steg 1.4).
    Obs: Snabb behandling av blod och isolering av RNA är viktigt att få en lämplig bibliotek storlek15,3, vilket är mycket viktigt för framgången för panorering.
  2. Späd ut 15 mL insamlade blodet med 5 mL PBS.
  3. Utnyttja en lymfocyter separation tube för att isolera perifera blodlymfocyter (PBLs) täthet lutning centrifugering enligt tillverkar förslag.
    Varning: Tillverkarens anvisningar visar att upp till 25 mL blod kan användas, men detta kan mätta systemet och förhindra att erhålla en ren lymfocyter beredning.
  4. Tillsätt 5 mL PBS prechilled till 4 ° C till PBL.
  5. Snurra i 20 min vid 800 x g vid 4 ° C.
  6. Tvätta två gånger genom att tillsätta 5 mL PBS prechilled till 4 ° C till PBL följt av centrifugeringen i 20 min vid 800 x g vid 4 ° C.
  7. Isolera total-RNA med en spin-kolonn baserat system, enligt tillverkarens instruktioner. Homogenisera cellerna genom vertexing i anpassade buffertvärden och tillämpa ett biopolymer-fragmentering system. Använd ett lämpligt antal mini eller maxi-kolumner baserat på cell ingång.
  8. Syntetisera cDNA med omvänt transkriptas genom att kombinera 10 µg av RNA med en blandning av 0,1 µg Oligo (dT) 12-18 primers.
  9. Generera en bacteriophage-bibliotek som med etablerade metoder4. Detta innebär att kloning med restriktionsenzym in den phage display vektor pMES4 följt av uttrycket av skäret smält till Gen III av den fintrådiga phage för produktion av phage lösningen.

3. enkel domän antikropp panorering

  1. Producera antigenet affinitet plattor med surface behandlas 96 brunnar. Späd 0,25 µg av antigen i 100 mM natriumkarbonat buffert, pH 9,0. Tillsätt 100 µL av denna lösning till varje brunn och inkubera över natten vid 4 ° C. Coat två brunnar per antigen. Förbereda ett blankprov som väl som är belagd med karbonat buffert endast.
    Obs: Plattorna kan produceras och lagras i upp till en vecka vid 4 ° C om flera rundor av urval kommer att utföras. Denna metod använder också, direkt upptagning som inte kräver märkning medan andra metoder använder biotinylation eller andra typer av märkning strategier.
  2. Inkubera plattan över natten. Invertera om du vill ta bort innehållet i brunnarna och tvätta tre gånger med 0,1 mL i PBS-T.
  3. Blockera brunnarna genom att tillsätta 0,1 mL av BSA (20 mg/mL) i PBS och ruvning plattan för 2 h i rumstemperatur.
  4. Tvätta plattan tre gånger med PBS-T följt av tre gånger med PBS. Antigener kan också kovalent märkas och används i capture system såsom, till exempel streptividin/biotin system.
  5. Förbehandla phage lösningen (100 µL) med 100 µL av 40 mg/mL BSA i PBS på en vibrerande plattform i rumstemperatur i 30 min.
  6. Lägga till phage lösningen till antigen belagda brunnar och inkubera med mild agitation för 2 h i rumstemperatur. Använda flera brunnar för att säkerställa sammanlagt 1011 phage för varje antigen.
  7. Kassera den obundna phage genom inversion och sedan Tvätta brunnarna fem gånger med 200 µL av PBS-T följt av fem gånger med PBS.
  8. Eluera de bundna phage genom att tillsätta 0,1 mL av 0,25 mg/mL trypsin i PBS och ruvar i 30 min i rumstemperatur på vibrerande plattformen vid 700 rpm.
  9. Överför lösningen till en injektionsflaska innehållande 5 µL av 4 mg/mL 4-benzenesulfonyl fluor hydrochloride(AEBSF) lösning att släcka trypsin aktivitet.
  10. Odla TG1 phage display behöriga cellerna vid 37 ° C under skakning tills OD600 = 0,5.
  11. Tillsätt 50 µL eluerade phage i 3 mL TG1 cellerna.
  12. Inkubera vid 37 ° C utan att skaka i 30 min.
  13. Tillsätt 7 mL LB media kompletteras med 100 µg/mL ampicillin, 2% glukos.
  14. Skaka över natten vid 37 ° C.
    Obs: För att få de mest skiftande enda domän-antikropparna, kan kloner vara sekvenserade, testade för önskade egenskaper och utnyttjas efter en runda av panorering. För att få den högsta affiniteten enda domän antikroppar, bör två rundor av panorering utnyttjas.
  15. Tallrik bakterier efter övernattning tillväxt på LB agarplattor kompletteras med 100 µg/mL ampicillin, 2% glukos. Flera seriespädningar kommer att behöva testas, börjar med två utspädningar, plätering 100 µL av 1/10 000 och 1/100 000 utspädningar.
  16. Inkubera plattan över natten vid 37 ° C.
  17. Plocka kolonierna och Inokulera brunnarna i en steril plattan med 96 brunnar innehållande 100 µL av 2XYT med 100 µg/mL ampicillin, 2% glukos, 10% v/v glycerol per brunn.
  18. Inkubera över natten vid 37 ° C utan att skaka.
  19. Nästa dag, skaka på 170 rpm vid 37 ° C i 60 min.
  20. Ta bort 2 µL av media i PCR-rören. Återstående lösningen kan kvar i plattan och lagras vid 4 ° C i 1-2 dagar eller frysas och förvaras vid-80 ° C för senare användning.
  21. Utför PCR-reaktion med primers som är lämpliga för den vektor som används. För pMES4 är PCR-screening av positiva kloner använder primers som flankerar flera kloning webbplatsen CCTATTGCCTACGGCAGCCGCTGGATTGTTATTAC och GGTGGTGTGAGGAGACGGTGACCTG. Utnyttja cykling förhållanden för polymerasen används, en glödgning temperatur 57 ° C, och 30 cyklar.
  22. Analysera PCR-reaktionen genom att köra en 1% (w/v) agarosgel. Kolonier som är positiva har enda domän antikropp gen skär ~ 500 bp. se till att positiva kloner är 20-50% av provet.
    Obs: Denna metod ger möjlighet att klona urval och analys som kan utföras i de flesta forskningslaboratorier. Alternativt, nästa generations sekvensering kan tillämpas och ger stora datamängder som tillåter statistiska och jämförande analyser16.
  23. Inokulera positiva kloner från plattan in färska rören som innehåller 7 mL LB med 100 µg/mL ampicillin.
  24. Växa med skakningar för övernattning vid 37 ° C.
  25. Utför en miniprep på kulturen att få plasmid DNA.
  26. Sekvensera positiva kloner använder standarden sekvensering primer pEX-Rev (CAGGCTTTACACTTTATGCTTCCGGC).
  27. Utföra beräkningsinriktad analys på resulterande enda domän antikropp sekvenser. Säkerställa att det finns ingen stop kodon eller ram skiftar.
  28. Klassificera de resulterande sekvenserna för likheten och mångfald. De sekvenser som identifieras vid upprepade tillfällen är mest sannolikt att vara hög affinitet bindande sekvenser, särskilt efter två rundor av urval.
  29. Express enda domän antikroppen använder en BL21-derived uttryck stam av E. spole. Inducera uttrycket genom tillägg av IPTG, växer över natten vid 22 ° C.
  30. Rena enda domän antikroppen använder immobiliserade metall affinitetskromatografi (IMAC).
  31. Validera enda domän antikropp/antigen bindande med en direkt interaktion-analys som pull-down, infödda gelelektrofores eller ELISA.
  32. Kontrollera programspecifika enda domän antikropp prestanda, som önskat för specifika experimentet.

Representative Results

Det protokoll som presenteras här utnyttjades för att generera enda domän antikroppar mot en rad proteinantigener. Fem antigener utnyttjades per alpacka. Immun övervakning anges att majoriteten av antigener visade robust svar början på tre veckor (figur 1). Produktion utfall och bibliotek konstruktion efter ca sex veckor ger bästa balans för djur som har flera antigener injiceras. Två rundor av panorering var utfört för varje antigen och isolerade kolonier skärmad (figur 2). Sekvensering av positiva kolonier identifieras olika enda domän antikropp sekvenser för de olika antigenerna. För exempel isolerades tre unika kloner till referensantigen maltos bindande Protein (MBP) (figur 3A). Som är frekvent, innehåller enda domän antikropparna betydande sekvens mångfald och mycket varierande CDR3 längd (figur 3). Dessa funktioner är särskilt viktigt i enda domän antikropp/antigen interaktioner som kan ses i referens enda domän antikropp/CX3CL1 komplexa17 (figur 3B).

Majoriteten av fullängds enda domän antikropp sekvenser kan uttryckt och renas på 1-10 mg/L av kultur (figur 4A). På grund av mångfalden i CDR3 längd Visa olika enda domän antikroppar liten variation i molekylvikt. Bekräftelse direkt bindande och programmets specifika prestanda är kritisk. Exempelvis efter två rundor av urval mot Antigen B identifierade en panel av enda domän antikroppar var (figur 2). Flera identiska sekvenser identifierades och enda domän antikroppen producerades och renas. Det var sedan testade via direkt dra ner med antigen affinitet harts och visade robust dosberoende bindande (figur 4B). Ännu viktigare, visade den enda domän antikroppen ingen bindning till styra harts. Dessa data visar ett riktaband interaktion, och en som är väl lämpad för affinitet fånga både pull-down och ELISA-baserade format.

Figure 1
Figur 1 : Representativa immun övervakning av två distinkta antigener visar betydande specifika immunsvaret mot olika antigener på samma djur. Många antigener Visa robust svar så tidigt som tre veckor efter påbörjandet immunisering, med de flesta visar maximalt svar efter sex veckor. Sex veckor också möjliggör samhörighet mognad och är rekommenderad tid för produktion utfall och B-cell isolering. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : PCR-baserade bekräftelse av positiva kloner. Primers spänner MCS vektorns pMES4, och en positiv nanobody klon producerar en amplikon på ~ 500 bp (markerade med *). Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Antigen-specifika sekvenser Markera alpacka enda domän antikropp mångfald. (A) anpassning av Välj domän antikropp sekvenser isolerat till MBP med en referens enda domän antikropp 4XT1, ram och komplementaritet-bestämma regioner (Kabat) markerade nedan. (B) struktur av alpacka enda domän antikropp 4XT1 bunden till CX3CL1 (PDB 4XT1), betonar den kritiska rollen av variabel CDR loopar i specifika antigen bindande. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Rening och validering av enda domän antikroppar. (A) SDS-PAGE av IMAC renat enda domän antikroppar, jämföra olika enda domän antikroppar. Olika molekylvikter beror främst på varierande längd av CDR3 slingan. Olika nivåer av uttryck observeras också, med en minoritet av enda domän antikroppar visar dålig avkastning av renat protein. (B) kontroll av riktaband använder en antigen affinitet nedrullningsbara. Robust dosberoende enda domän antikropp bindande observeras med antigen-kopplade harts men inte med kontroll harts. Klicka här för att se en större version av denna siffra.

Discussion

Som nämnts, den hög affinitet och specificitet av enda domän antikroppar, kombinerat med deras lättköpt uttryck och stabilitet, göra dem idealiska reagenser för applikationer i biomedicinsk forskning, som kritiska biokemiska reagenser, diagnosverktyg, eller terapeutiska medel18. För kommersiella tillämpningar finns det några problem relaterade till intellektuell egendom som måste beaktas. Dessutom kan enda domän antikroppar vara konstruerad för att innehålla specifika markörer eller taggar som kan användas som reportrar i cellulära analyser eller diagnostik. Nyckeln till dessa användningsområden är förmågan att producera specifika enda domän antikroppar mot antigenerna av intresse. En metod är beskrivs här för att producera enstaka domän antikroppar med alpackor, som producerar en robust immunsvar mot en mängd proteinantigener. Överväganden för djurhantering och regelefterlevnad beskrivs. Detta är nyckeln till framgång i denna del av processen.

Det finns andra strategier för att producera enstaka domän antikroppar som inte kräver immunisering, utan istället använda semisyntetiskt bibliotek med olika system för urval och iterativ optimering av tillhörighet19,20 . Fördelen med att använda bibliotek från immuniserade djur är dock möjligheten att på ett tillförlitligt sätt isolera mycket berikad, varierande och hög affinitet enda domän antikroppar. Dessutom inte bara betydande sekvens variationer observerats, men en betydande majoritet av specifika enda domän antikroppar isolerade hade unika infogningar och borttagningar, särskilt i CDR3.

Ytterligare, enda domän antikroppar kan produceras via en enkel process som endast kräver små injektioner av antigenet och efter denna process, djuren kan återföras till besättningen. Notera, djuret kan användas fritt för fiber produktion, men måste undantas från användning som kött (livsmedelskedjan) på grund av användningen av de antigener som test och icke-FDA godkända adjuvant för enda domän antikroppsproduktion. När proceduren är klar, kan djuren ska övervakas för en vecka, får en veterinär tentamen, och sedan antingen återvände till sina hem gård eller vilade för sex månader före ytterligare en runda av enda domän antikroppsproduktion.

Disclosures

DRS. Whiteheart och Hersh är vid University of Kentucky och driva en kärna i centrum för molekylärmedicin som producerar enda domän antikroppar i alpacka som en avgift-for-service.

Acknowledgments

Detta arbete stöds av National Institutes of Health (P30GM103486).

Materials

Name Company Catalog Number Comments
GERBU FAMA adjuvant Biotechnik, Heidelberg, Germany  3003,6001
Serum collection tube Becton Dickinson 367983
Blood collection tube Becton Dickinson 366643
Vacutainer blood collection set Becton Dickinson 368652
Maxisorp Immuno plates Nunc 439454
BSA Sigma-Aldrich A7906
HRP-conjugated goat anti-llama IgG antibody  Bethyl Labs A160-100P
TMB reagent chromogenic peroxidase substrate  KPL 50-76-03
Plate Reader Spectramax M5 Any UV/VIS capable reader is acceptable
Uni-SepMAXI+ lyphocyte separation tube Novamed U-17
RNeasy Mini Kit Qiagen 74104
QIAshredder column Qiagen 79654
Superscript IV reverse transcriptase   Invitrogen 18064014
AEBSF solution Biosynth A-5440
TG1 phage display competent cells Lucigen 60502

DOWNLOAD MATERIALS LIST

References

  1. Krah, S., et al. Single-domain antibodies for biomedical applications. Immunopharmacology and Immunotoxicology. 38, (1), 21-28 (2016).
  2. Rothbauer, U., et al. Targeting and tracing antigens in live cells with fluorescent nanobodies. Nature Methods. 3, (11), 887-889 (2006).
  3. Maass, D. R., Sepulveda, J., Pernthaner, A., Shoemaker, C. B. Alpaca (Lama pacos) as a convenient source of recombinant camelid heavy chain antibodies (VHHs). Journal of Immunological Methods. 324, (1-2), 13-25 (2007).
  4. Pardon, E., et al. A general protocol for the generation of Nanobodies for structural biology. Nature Protocols. 9, (3), 674-693 (2014).
  5. Hertveldt, K., Belien, T., Volckaert, G. General M13 phage display: M13 phage display in identification and characterization of protein-protein interactions. Methods in Molecular Biology. 502, 321-339 (2009).
  6. Kushwaha, R., Schafermeyer, K. R., Downie, A. B. A protocol for phage display and affinity selection using recombinant protein baits. Journal of Visualized Experiments. (84), e50685 (2014).
  7. Hamers-Casterman, C., et al. Naturally occurring antibodies devoid of light chains. Nature. 363, (6428), 446-448 (1993).
  8. Muyldermans, S., et al. Camelid immunoglobulins and nanobody technology. Veterinary Immunology and Immunopathology. 128, (1-3), 178-183 (2009).
  9. Muyldermans, S. Nanobodies: natural single-domain antibodies. Annu Rev Biochem. 82, 775-797 (2013).
  10. Muyldermans, S., Cambillau, C., Wyns, L. Recognition of antigens by single-domain antibody fragments: the superfluous luxury of paired domains. Trends in Biochemical Sciences. 26, (4), 230-235 (2001).
  11. Wang, Y., et al. Nanobody-derived nanobiotechnology tool kits for diverse biomedical and biotechnology applications. International Journal of Nanomedicine. 11, 3287-3303 (2016).
  12. Van Saun, R. J. Nutritional requirements and assessing nutritional status in camelids. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 265-279 (2009).
  13. Jones, M., Boileau, M. Camelid herd health. Veterinary Clinics of North America: Food Animal Practice. 25, (2), 239-263 (2009).
  14. Daley, L. P., Gagliardo, L. F., Duffy, M. S., Smith, M. C., Appleton, J. A. Application of monoclonal antibodies in functional and comparative investigations of heavy-chain immunoglobulins in new world camelids. Clinical and Diagnostic Laboratory Immunology. 12, (3), 380-386 (2005).
  15. Romao, E., et al. Identification of Useful Nanobodies by Phage Display of Immune Single Domain Libraries Derived from Camelid Heavy Chain Antibodies. Current Pharmaceutical Design. 22, (43), 6500-6518 (2016).
  16. Henry, K. A., et al. Isolation of TGF-beta-neutralizing single-domain antibodies of predetermined epitope specificity using next-generation DNA sequencing. Protein Engineering, Design and Selection. 29, (10), 439-443 (2016).
  17. Burg, J. S., et al. Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor. Science. 347, (6226), 1113-1117 (2015).
  18. Wesolowski, J., et al. Single domain antibodies: promising experimental and therapeutic tools in infection and immunity. Medical Microbiology and Immunology. 198, (3), 157-174 (2009).
  19. Harmsen, M. M., De Haard, H. J. Properties, production, and applications of camelid single-domain antibody fragments. Applied Microbiology and Biotechnology. 77, (1), 13-22 (2007).
  20. McMahon, C., et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology. 25, (3), 289-296 (2018).
Immunisering av alpackor (<em>Lama pacos</em>) med proteinantigener och produktion av Antigen-specifika enda domän antikroppar
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).More

Chow, K. M., Whiteheart, S. W., Smiley, J. R., Sharma, S., Boaz, K., Coleman, M. J., Maynard, A., Hersh, L. B., Vander Kooi, C. W. Immunization of Alpacas (Lama pacos) with Protein Antigens and Production of Antigen-specific Single Domain Antibodies. J. Vis. Exp. (143), e58471, doi:10.3791/58471 (2019).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter